Αρχείο κατηγορίας Uncategorized

Διαγώνισμα Κεφάλαιο 5 – Μενδελική Κληρονομικότητα

Ζήτημα 1ο                                                                                                μονάδες 25

Α.

  1. Στην περίπτωση του φυτού Anthirrium sp.

Α. Δεν ισχύει ο νόμος του διαχωρισμού των αλληλομόρφων για τον χαρακτήρα χρώμα άνθους.

Β. Τα ετερόζυγα άτομα εμφανίζουν φαινότυπο στον οποίο εκφράζονται ταυτόχρονα και τα δύο αλληλόμορφα του γονίδιου που ελέγχει το χρώμα του άνθους.

Γ. Άτομα με διαφορετικό φαινότυπο ως προς τον χαρακτήρα χρώμα άνθους έχουν και διαφορετικό γονότυπο πάντα.

Δ. Φυσιολογικά άτομα με διαφορετικό φαινότυπο για το χρώμα του άνθους δεν αποκλείεται να έχουν ίδιο γονότυπο.

 

  1. Από την διασταύρωση δυο φυτών του ιδίου είδους και αγνώστου φαινοτύπου προέκυψαν στην πρώτη θυγατρική γενεά:

9[ιώδη] : 4 [μπλε] : 3 [κόκκινα]

Το χρώμα αυτών των φυτών ελέγχεται:

Α. Μονογονιδιακά από δυο αλληλόμορφα

Β. Μονογονιδιακά από τρία αλληλόμορφα

Γ. Απο τρία ανεξάρτητα γονίδια με δυο αλληλόμορφα το καθένα

Δ. Απο δυο ανεξάρτητα γονίδια με δυο αλληλόμορφα το καθένα.

  1. Σε μια αυτοσωμική επικρατή νόσο που ελέγχεται μονογονιδιακά:

Α. Το υπολειπόμενο αλληλόμορφο αποκλείεται να εκφράζεται

Β. Το ετερόζυγο άτομο δεν εμφανίζει τη νόσο

Γ. Το αλληλόμορφο που επικρατεί ως προς την έκφραση , επικρατεί πάντα και φαινοτυπικώς

Δ. Το αλληλομόρφο που δεν εκφράζεται δεν αποκλείεται να επικρατεί και φαινοτυπικώς.

  1. Ένα γονίδιο με πέντε διαφορετικά αλληλόμορφα με σχέση πλήρους επικράτειας υποτέλειας διαδοχικά μεταξύ τους δημιουργεί

Α. 15 διαφορετικούς γονοτύπους

Β. 10 διαφορετικούς ετερόζυγους γονοτύπους

Γ. 20 διαφορετικούς φαινοτύπους

Δ. Τα δυο πρώτα είναι σωστά

  1. Στο γενεαλογικό δένδρο που φαίνεται παρακάτω εξετάζονται οι ασθένειες της αιμορροφιλίας και της β-θαλασσαιμίας.

Δεδομένου ότι όλα τα άτομα της γενεάς Ι είναι ετερόζυγα, να υπολογιστεί η πιθανότητα το άτομο ΙΙΙ1 να είναι υγιές.

Α. ½

Β. 2/3

Γ. ¼

Δ. 1/16

Διαγ 5 blog-05

 

Σημείωση: Το άτομο ΙΙ1 νοσεί από β θαλασσαιμία και το άτομο ΙΙ2 από αιμορροφιλία.                                                                                              (15)

 

Β.   Τις παρακάτω ερωτήσεις χαρακτηρίστε τις ως σωστές ή λανθασμένες:                                                                                                                 (10)

  1. Η αιμοσφαιρίνη είναι πολυγονιδιακός χαρακτήρας.
  2. Στην μελέτη του διυβριδισμού οι χαρακτήρες που μελέτησε ο Mendel δεν εμφάνιζαν επιχιασμό.
  3. Σε ένα αρσενικό άτομο οι νόμοι του Mendel ισχύουν για όλα τα γονίδια που βρίσκονται στον πυρήνα των σωματικών τους κυττάρων.
  4. Τα φυτά προϊόντα της αυτογονιμοποίησης εμφανίζουν ποικιλότητα στις πρώτες γενεές και βαθμιαία σε βάθος γενεών τείνουν σε ομοιομορφία.
  5. Ο τρόπος κληρονόμισης των μονογονιδιακών χαρακτήρων προσδιορίζεται από τον φαινότυπο των ετερόζυγων ατόμων πάντα.

Ζήτημα 2ο                                                                       μονάδες 25

 

  1. Εξηγήστε για ποιο λόγο η πιθανότητα να προκύψει είτε αγόρι είτε κορίτσι είναι ίση με ½. Και κάθε κύηση είναι ανεξάρτητο γεγονός που δεν επηρεάζεται από τα αποτελέσματα των προηγουμένων κυήσεων.; (8)

 

  1. Ένας τράγος διασταυρώθηκε με 64 κατσίκες. 24 από τις κατσίκες αυτές γέννησαν και νεκρούς απογόνους ενώ κάθε κατσίκα απέκτησε συνολικά 3 κατσικάκια. Υπολογίστε πόσες ακόμη κατσίκες από τις 64 που διασταυρωθήκαν με αυτόν τον τράγο είναι ετερόζυγες ως προς το θνησιγόνο αλληλόμορφο, αλλά δεν εντοπιστήκαν καθώς γέννησαν τρία υγιή κατσικάκια η καθεμιά.                                                                                                              (7)

 

  1. Γνωρίζοντας ότι υπάρχουν τέσσερα πολλαπλά αλληλόμορφα για το χρώμα του τριχώματος στα ποντίκια. Με σχέση πλήρους επικράτειας – υποτέλειας μεταξύ τους, πόσες διαφορετικές πιθανές διασταυρώσεις γονοτύπων  μπορούν να γίνουν,  αν το άτομο με τον πλέον επικρατή φαινότυπο  διασταυρώνεται με το άτομο με τον αμέσως  επόμενο κατά σειρά κυριαρχίας φαινότυπο και αποκτούν απογόνους, με φαινοτύπους όμοιους με τους γονείς τους  σε ίσες αναλογίες.                                                                       (10)

 

 

 

Ζήτημα 3ο                                                                        μονάδες 25                                                                                                                                                     

 

  1. Δίνεται το παρακάτω γενεαλογικό δένδρο που αφορά ένα αυτοσωμικό υπολειπόμενο γνώρισμα. Δεχόμενοι ότι όλα τα εισερχόμενα στην γενεαλογία άτομα είναι ετερόζυγα καθώς και τα άτομα της γενεάς Ι, βρείτε την πιθανότητα το άτομο V1 να εμφανίζει το γνώρισμα. (8)

Διαγ 5 blog-02

2. Το φυσιολογικό αλληλόμορφο του γονίδιου για την αιμορροφιλία πέμπεται σε δυο ισομεγέθη τμήματα, υπό την επίδραση της EcoRI

Ένα ζευγάρι έχει αποκτήσει δυο αγόρια και δυο κορίτσια. Το πήκτωμα της αγαρόζης των τεσσάρων παιδιών έδωσε την ακόλουθη εικόνα:

Διαγ 5 blog-03

 

Σημείωση: Όπου jβ, είναι Ζεύγη Βάσεων. Κατά την ηλεκτροφόρηση του DNA σε πήκτωμα αγαρόζης, γνωρίζετε ότι σε δεδομένο χρόνο εφαρμογής του ηλεκτρικού πεδίου στο πήκτωμα, τα μικρότερου μήκους τμήματα DNA διανύουν μεγαλύτερη απόσταση εντός του πηκτώματος.

Να προσδιορίσετε τους γονοτύπους των παιδιών 1,2,3,4 του ζευγαριού καθώς και τους γονοτύπους των γονέων τους.                                         (4)

Αιτιολογήστε την απάντηση σας.                                                                     (5)

3. Στους γορίλες (Gorilla gorilla), υπάρχει το γονίδιο WRS υπεύθυνο για το χρώμα του τριχώματος και το γονίδιο QPR που ελέγχει το μέγεθος του ύβου πίσω από το κεφάλι. Οι γορίλες μπορεί να είναι μαύροι ή ασημόραχοι και μπορεί να έχουν μεγάλο , μεσαίο ή μικρό ύβο.

Σε ένα παμμεικτικο πληθυσμό γοριλων πραγματοποιήθηκαν διασταυρώσεις μεταξύμαύρων αρσενικών με μεσαίο ύβο  με θηλυκα με τα ιδιά αυτά χαρακτηριστικά και έδωσαν :

 

F1:

3200 θηλυκά [μαύρα, μεγάλο ύβο]

3100 θηλυκά [μαύρα, μεσαίο ύβο]

1200 θηλυκά [ ασημόραχα, μεγάλο ύβο]

1000 θηλυκά [ασημόραχα, μεσαίο ύβο]

3300 αρσενικά [μαύρα, μεσαίο ύβο]

3100 αρσενικά [μαύρα, μικρό ύβο]

900 αρσενικά [ασημόραχα, μεσαίο ύβο]

1000 αρσενικά [ασημόραχα, μικρό ύβο]

 

Να ερμηνευθούν τα αποτελέσματα όταν γνωρίζετε πως μεταξύ των χαρακτηριστικών δεν παρατηρούνται φαινοτυπικες διακυμάνσεις.                                                   (8)

 

 

 

 

Ζήτημα 4ο                                                                 μονάδες 25

 

  1. Στο παρακάτω γενεαλογικό δένδρο μελετάται μια ασθένεια αυτοσωμική υπολειπόμενη. Όλα εισερχόμενα στη γενεαλογία άτομα είναι υγιή και ομόζυγα.

Διαγ 5 blog-04

 

Α. Να βρεθούν όλοι οι γονότυποι των ατόμων της γενεαλογίας.             (3)

Β. Αν τα άτομα Α και Β αποκτήσουν παιδί με ποια πιθανότητα θα νοσεί;                                                                                                                     (3)

Γ. Αν το πρώτο παιδί είναι φυσιολογικό με ποια πιθανότητα το δεύτερο θα είναι αγόρι με την ασθένεια;                                                                (3)

Δ. Αν το πρώτο παιδί νοσεί με ποια πιθανότητα το δεύτερο θα είναι υγιές;                                                                                                                   (3)

  1. Δίνεται το παρακάτω γενεαλογικό δένδρο που αφορά έναν χαρακτήρα του ανθρώπου. Τα άτομα με μαύρο χρώμα εμφανίζουν μια ασθένεια των οφθαλμών.

Να βρεθούν οι γονότυποι των ατόμων του δένδρου.                                            (13)

Διαγ 5 blog-01

 

Βιολογία Θετικής Κατεύθυνσης θέματα πανελλήνιων εξετάσεων 2015 ασάφειες και προβληματισμοί!

Τα φετινά θέματα της βιολογίας κατεύθυνσης θα πρέπει να χαρακτηριστούν διαφορετικής προσέγγισης, από τα θέματα που μέχρι πρότινος είχαμε συνηθίσει να βλέπουμε στις πανελλήνιες εξετάσεις στο συγκεκριμένο μάθημα.

Είναι αξιοπρόσεκτη η προσπάθεια των θεματοδότων, να μην επαναληφθούν, σε γενικές γραμμές, τα θέματα σχεδόν όλων των προηγούμενων ετών, που δεν υπήρχε σχεδόν ποτέ καμιά πρωτοτυπία στο Θέμα Γ και Δ. Στα θέματα εκείνα βλέπαμε μια επανάληψη ασκήσεων του 2ου κεφαλαίου (εύρεση κωδικής και μη κωδικής αλυσίδας ενός γονιδίου που κωδικοποιεί για mRNA) και μια άσκηση από το 5ο κεφάλαιο (σχεδόν πάντα αυτοσωμικό υπολειπόμενο χαρακτηριστικό). Επιπλέον φέτος, όπως και πέρυσι, υπάρχει εμφανείς διάθεση στο Θέμα Β να περιορίσουν την έκταση των θεμάτων που απαιτούν απλή ανάκληση αυτούσιων αποσπασμάτων του σχολικού βιβλίου.

Η προσπάθεια αυτή αναμφίβολα είναι ένα πολύ θετικό βήμα για τον τρόπο με τον οποίο άρχισε επιτέλους να αντιμετωπίζεται ενα απολύτως θετικό επιστημονικό αντικείμενο όπως είναι η Βιολογία. Καιρός ήταν πια να αρχίσει να παίρνει η Βιολογία την θέση που της αρμόζει και να απαλλαγεί από τον χαρακτηρισμό ενός μαθήματος » που μαθαίνει ο μαθητής το βιβλίο απέξω και γραφεί» όπως είναι ατυχώς η άποψη πολλών καθηγητών και μαθητών.

Ωστόσο δεν έλειψε και εφέτος η προχειρότητα με την οποία διατυπώθηκαν τα ερωτήματα, με αποτέλεσμα να δημιουργηθούν και πάλι (όπως και στο περυσινό θέμα Δ) προβλήματα σύγχυσης και πιθανών παρανοήσεων από τους μαθητές της θετικής κατεύθυνσης που κλήθηκαν να τα απαντήσουν.

Αξίζει δε να προσεχθεί, ότι τέτοια φαινόμενα σύγχυσης και προβληματισμού εμφανίζονται κυρίως στους λεγάμενους κάλους μαθητές, σε εκείνους που έχουν μοχθήσει ειλικρινώς ολόκληρη τη σχολική χρονιά και όχι απαραίτητα μόνο στην γ΄ λυκείου για να κατανοήσουν και να εμπεδώσουν την Βιολογία του λυκείου – και όχι μόνο του λυκείου πολλές φορές-. οι μαθητές αυτοί που διαβάζουν με μεγάλη προσοχή την κάθε ερώτηση και παρατηρούν κάθε λέξη και το νόημα της πρότασης που σχηματίζεται, μπορεί να βρεθούν σε δίλημμα για το τι ακριβώς ζητείται από ένα ερώτημα, αν αυτό δεν είναι διατυπωμένο με προσοχή ώστε να γίνεται σαφές και ακριβές, στο ποιο είναι το ζητούμενο στο οποίο καλείται να εξεταστεί ο μαθητής .

Δυστυχώς και φέτος τα θέματα της Βιολογίας θετικής κατεύθυνσης δεν ήταν απαλλαγμένα από αυτή την έλλειψη ακρίβειας και σαφήνειας στην διατύπωση των δεδομένων και των ερωτημάτων που τα ακολουθούσαν.

Προκειμένου να προλάβω ορισμένους αναγνώστες, θα ήθελα να επισημάνω οτι θέματα όπως τα φετινά  (θεμα Γ και Δ, χωρίς ασάφειες και προβληματισμούς) έχω συμπεριλάβει απο το 2007 στο βιβλίο μου κριτήρια αξιολόγησης για την βιολογία θετικής κατευθύνσης εκδόσεις Λιβάνη.

Πιο συγκεκριμένα όσον αφορά τα προβλήματα που παρουσίασαν τα φετινά θέματα:

Θέμα Β1

Στήλη Ι: Πρόταση 6: «οι μεταλλάξεις στο DNA δεν κληρονομούνται στην επόμενη γενιά.»

Παρατήρηση: Αναφέρεται άραγε η πρόταση στην επόμενη γενεά οργανισμών (πολυκύτταρων, αμφιγονικά αναπαραγόμενων) ή στην επόμενη γενεά κυττάρων ενός πολυκύτταρου οργανισμού (προϊόντα μίτωσης);

Στήλη Ι: Πρόταση 8: » Οι μεταλλάξεις στο DNA τους κληρονομούνται στην επόμενη γενιά.»

Παρατήρηση : Αναφέρεται άραγε και εδώ στην επόμενη γενεά οργανισμών όπως παραπάνω η πρόταση 6 ή στην επόμενη γενεά κυττάρων προϊόντων της κυτταρικής διαίρεσης;

Είναι φανερό πως αναλόγως με την ερμηνεία που δίνεται κάθε φορά σε κάθε πρόταση η απάντηση που κρίνεται ως σωστή είναι διαφορετική. Για παράδειγμα στην πρόταση 6 εάν αυτή ερμηνευθεί ως επόμενη γενεά οργανισμών τότε η σωστή απάντηση είναι η αντιστοίχηση της με την στήλη ΙΙ Α: Σωματικά κύτταρα. Εάν όμως θεωρηθεί ως : Επόμενη γενεά κυττάρων, η σωστή αντιστοίχιση της είναι στην στήλη ΙΙ Β: Γαμέτες, καθώς γνωρίζουμε ότι οι γαμέτες είναι τα τελικά προϊόντα της μείωσης και δεν υφίστανται οι ίδιοι καμιά κυτταρική διαίρεση. Ομοίως προβληματίζει και η πρόταση 8.

ΘΕΜΑ Γ1.

– «Να ονομάσετε τη διαδικασία που βρίσκεται σε εξέλιξη».

Μπορούμε να υποθέσουμε ότι η διαδικασία αυτή είναι η αντιγραφή. Εδώ κάποιος μαθητής μπορεί να αναρωτηθεί αν η διαδικασία που απεικονίζεται είναι in vivo σε ζωντανό κύτταρο ή in vitro για παράδειγμα, σε εκχύλισμα κυττάρων προκαρυωτικού ή ευκαρυωτικού κυττάρου (διαφορά στον βαθμό ικανότητας επιδιόρθωσης, όπως προκύπτει από το σχολικό βιβλίο –« Τα λάθη που δεν επιδιορθώνονται από τις DNA πολυμεράσες επιδιορθώνονται σε μεγάλο ποσοστό από ειδικά επιδιορθωτικά ένζυμα. Έτσι ο αριθμός των λαθών περιορίζεται στους ευκαρυωτικούς οργανισμούς στο ένα στα 1010» σελ. 30). Ο όρος εκχύλισμα ορίζεται στην άσκηση 10 του σχολικού βιβλίου, σελ. 39.

– «Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1».

Εδώ, απαιτείται διερεύνηση του όρου τελικό δίκλωνο μόριο.

Το τελικό μόριο ορίζεται πριν ή μετά την αντικατάσταση των ριβονουκλεοτιδίων από τις DNA πολυμεράσες και πριν ή μετά μιας πιθανής επιδιόρθωσης στις κακοζευγαρωμενές βάσεις C=C;

Βεβαίως όλα τα παραπάνω δεχόμενοι ορισμένες παραδοχές:

α. Η διαδικασία που απεικονίζεται στην εικόνα 1 λαμβάνει χώρα in vivo κάτι που δεν γίνεται σαφές από την εκφώνηση. Αν η διαδικασία συνέβαινε σε δοκιμαστικό σωλήνα, τότε δεν είναι απαραίτητο ότι μπορούσαν να συμβούν, η αντικατάσταση των ριβονουκλεοτιδίων από δεοξυνουκλεοτίδια ούτε και η επιδιόρθωση των κακοζευγαρωμένων βάσεων καθώς αυτά εξαρτώνται από τα ένζυμα που είναι διαθέσιμα και την λειτουργικότητα αυτών μέσα στο δοκιμαστικό σωλήνα.

β. Ακόμα και αν η διαδικασία που απεικονίζεται στην εικόνα 1 συμβαίνει σε ζωντανό κύτταρο πρέπει να εξεταστεί αν είναι δυνατή όχι μόνο η απομάκρυνση των ριβονουκλεοτιδίων του πρωταρχικού τμήματος, αλλά και η συμπλήρωση του τμήματος που απέμεινε με δεοξυνουκλεοτίδια, κάτι που σημαίνει ότι το δοθέν τμήμα που αντιγράφεται δεν είναι το 3΄ακρο ενός χρωμοσώματος αλλά ότι είναι τμήμα στο εσωτερικό ενός χρωμοσώματος (τμήμα ασυνεχούς σύνθεσης ή η θέση έναρξης της αντιγραφής στο κλώνο που συντίθεται συνεχώς), το οποίο όμως δεν φαίνεται να προκύπτει το ένα ή το άλλο συμπέρασμα από την εικόνα 1.

Στην περίπτωση που δεχθεί ο μαθητής ότι πρόκειται για 3΄ άκρο ενός χρωμοσώματος (έτσι απεικονίζεται στην εικόνα 1) τότε θα έπρεπε, για μπορέσει να απαντήσει σωστά από επιστημονικής απόψεως, να γνωρίζει την ύπαρξη των τελομερασών για να υποθέσει ότι μπορεί συμπληρωθεί το άκρο του χρωμοσώματος με δεοξυνουκλεοτίδια μετά την απομάκρυνση του πρωταρχικού τμήματος. Στο σχολικό βιβλίο βεβαίως δεν γίνεται κανένας υπαινιγμός για τα τελομερή των χρωμοσωμάτων, αντιθέτως καθίσταται σαφές στο σχολικό βιβλίο ότι οι DNA πολυμεράσες δεν μπορούν να ξεκινήσουν την αντιγραφή ενός κλώνου de novo, δηλαδή χωρίς την ύπαρξη προϋπάρχοντος ελεύθερου 3΄ακρο στο νεοσυντιθέμενο κλώνο.

Σχολικό βιβλίο σελ. 28 και 30 «Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA  ονομάζονται DNA πολυμερασες. Επειδή τα ένζυμα αυτά δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποιο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. Ένα είδος DNA πολυμεράσης επιμηκύνει τα πρωταρχικά τμήματα,… . Ταυτόχρονα ένα άλλο είδος DNA πολυμεράσης απομακρύνει τα πρωταρχικά τμήματα RNA και τα αντικαθιστά με τμήματα DNA.» και «Οι DNA πολυμεράσες λειτουργούν μόνο προς καθορισμένη κατεύθυνση και τοποθετούν τα νουκλεοτίδια στο ελεύθερο 3΄ακρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου κάθε αναπτυσσόμενης αλυσίδας».

ΘΕΜΑ Γ2.

– «Να ονομάσετε τα ένζυμα που είναι απαραίτητα για τη δημιουργία του τελικού δίκλωνου μορίου του ερωτήματος Γ1 και να αναφέρετε τη δράση του κάθε ενζύμου.»

Εδώ και πάλι απαιτείται ερμηνεία του όρου για τη δημιουργία του τελικού δίκλωνου μορίου, υποθέτοντας την in vivo αντιγραφή και όχι την in vitro έτσι αυθαίρετα, καθώς δεν προκύπτει με οποιοδήποτε τρόπο από τα θέματα ότι πράγματι είναι in vivo διαδικασία.

α. Η δημιουργία του τελικού δίκλωνου μορίου αναφέρεται από την στιγμή που παρουσιάζεται στην εικόνα 1 και μετά; Θεωρούμε δυνατή ή όχι την αντικατάσταση του πρωταρχικού τμήματος από δεοξυνουκλεοτίδια;

Σε αυτή την περίπτωση και θεωρώντας δυνατή την αντικατάσταση του πρωταρχικού τμήματος, θα δράσουν μόνο τα ένζυμα DNA πολυμεράσες (αντικατάσταση πρωταρχικού τμήματος, επιμήκυνση νεοσυντιθέμενου κλώνου DNA και επιδιόρθωση), η DNA δεσμάση, για να συνδέσει την τελευταία θυμίνη (Τ) που αντικατάστησε την τελευταία ουρακίλη (U) του πρωταρχικού τμήματος με την πρώτη θυμίνη (Τ) που φαίνεται στην εικόνα 1 όταν διαβάζουμε τον πάνω κλώνο που δίνεται με προσανατολισμό 5΄–>3΄ από τα αριστερά προς τα δεξιά. Τέλος πιθανόν να δράσουν τα επιδιορθωτικά ένζυμα για το κακοζευγαρώμα που ήδη υπάρχει (C=C) ή για κάποιο άλλο λάθος της αντιγραφής του τμήματος που δίνεται και που μπορεί να συμβεί.

β. Η δημιουργία του τελικού δίκλωνου μορίου, αναφέρεται από την στιγμή της έναρξης της αντιγραφής του μητρικού κλώνου που απεικονίζεται στην εικόνα 1.

Σε αυτή την περίπτωση θα πρέπει να θεωρηθεί ότι θα δράσουν επιπλέον της α. περίπτωσης και τα ένζυμα: DNA ελικάσες για να αποδιατάξουν τους δυο μητρικούς κλώνους, ένας από τους οποίους φαίνεται να αντιγράφεται στην εικόνα 1 και πριμόσωμα που δημιούργησε το πρωταρχικό τμήμα που φαίνεται στην εικόνα 1.

Στην περίπτωση που θεωρηθεί ότι η διαδικασία που απεικονίζεται στην εικόνα 1 λαμβάνει χώρα in vitro, τότε:

Αν συμβαίνει σε κυτταρικό εκχύλισμα και εφόσον θεωρήσουμε ότι η διαδικασία συμβαίνει στο μόριο που φαίνεται στην εικόνα 1 και όχι ότι αυτό δημιουργείται στο εκχύλισμα, τότε εφόσον τα ένζυμα της αντιγραφής των εκχυλιζόμενων κυττάρων είναι όλα πλήρως λειτουργικά (εάν αυτό είναι βεβαίως εφικτό, αναλόγως των συνθηκών δημιουργίας του εκχυλίσματος) τότε τα ένζυμα που θα δράσουν μπορούμε να θεωρήσουμε ότι θα είναι εκείνα που θα είναι και στην in vivo αντιγραφή.

Αξίζει να σημειωθεί πως ένα ερώτημα στο ερώτημα Β στα περυσινά θέματα των Ημερήσιων και Εσπερινών λυκείων της Βιολογίας θετικής κατεύθυνσης εξέταζε τα ένζυμα της αντιγραφής και την δράση τους.

Είναι φανερό από τα παραπάνω ότι η ασάφεια των ερωτημάτων Γ1 και Γ2 δημιουργούσε σύγχυση και έντονο προβληματισμό στους μαθητές. Η επιστημονικώς ορθή απάντηση είναι να πάρει ένας μαθητής όλες τις δυνατές περιπτώσεις και να τις εξετάσει ξεχωριστά. Σε μια τέτοια περίπτωση ο μαθητής θα έρθει αντιμέτωπος με προβλήματα που δεν είναι υποχρεωμένος να γνωρίζει τις απαιτούμενες γνώσεις για να τα απαντήσει (π.χ. τελομέρη) και φυσικά ο χρόνος που έχει στη διάθεση του δεν θα επαρκούσε.

Ποια είναι λοιπόν η σωστή απάντηση για την Επιστήμη της Βιολογίας; Είναι άραγε η απάντηση αυτή και σωστή για τις πανελλήνιες εξετάσεις; Μήπως η σωστή επιστημονικώς απάντηση δεν είναι απαραιτήτως και σωστή για τις πανελλήνιες εξετάσεις ( δεν είναι η πρώτη φορά που συμβαίνει αυτό!) ; Πώς είναι δυνατόν η σωστή για της εξετάσεις απάντηση να μην ταυτίζεται με την ορθή επιστημονικώς απάντηση;

Μήπως απλώς η σωστή απάντηση είναι μόνο η απάντηση που σκεφτήκανε οι θεματοδότες ή μήπως θα πρέπει να θεωρηθεί σωστή οποιαδήποτε απάντησης καλύπτει μερικώς ορθά μια – δυο περιπτώσεις ή μήπως ως επιστήμη που είναι η Βιολογία η ορθή απάντηση είναι μόνο μια, αυτή που εξετάζει όλα τα ενδεχόμενα καλύπτει πλήρως καθένα από αυτά ακόμη και αν δεν λήφθηκε υπόψη από τους θεματοδότες ότι όλα τα ενδεχόμενα δεν απαντώνται με γνώσεις μέσα από το σχολικό εγχειρίδιο; Πόσο λοιπόν αντικειμενικοί μπορούν να είναι οι διορθωτές στο μάθημα που παίζει τον κυρίαρχο ρόλο για την εισαγωγή των μαθητών στην πλέον υψηλόβαθμη σχολή της Ελλάδας και ανεξάρτητα από αυτό;

Πάντως είναι βέβαιο, ότι είναι άδικο να πριμοδοτούνται οι μέτριοι και να αδικούνται οι πραγματικά ικανοί μαθητές. Επίσης δεν είναι σωστό να καλλιεργείται αντιεπιστημονική σκέψη επειδή αυτή κατά κανόνα επιβραβεύεται στις εξετάσεις στα πλαίσια της απλούστευσης που πολλές φορές παραβιάζει τα όρια της επιστημονικής ορθότητας. Άλλωστε η απλούστευση έχει αξία όταν πραγματικά απλουστεύει δύσκολες επιστημονικές έννοιες χωρίς να στερείται επιστημονικότητας.

Μπορεί ο ρόλος της δευτεροβάθμιας εκπαίδευσης να μην είναι να δημιουργήσει επιστήμονες είναι όμως υποχρέωση της να βάλει στους αυριανούς επιστήμονες που θα αποφοιτήσουν από τα πανεπιστήμια, τα πρώτα και γερά θεμέλια της επιστημονικής σκέψης και αντίληψης!

.

ΘΕΜΑ Δ

Το θέμα Δ εμφανίζει πολλά προβλήματα, με κυρίαρχα τα έξης που πηγάζουν από τις πληροφορίες που δίνονται στο σχολικό βιβλίο για τον ορισμό των δομικών χρωμοσωμικών ανωμαλιών και των γονιδιακών μεταλλάξεων σε συνδυασμό με την εικόνα 2 και τα δεδομένα του θέματος.

Σύμφωνα με το σχολικό βιβλίο σελ. 89″ οι γενετιστές κατατάσσουν τις μεταλλάξεις σε δύο μεγάλες κατηγορίες: τις γονιδιακές και τις χρωμοσωμικές. Ο τυπικός αυτός διαχωρισμός σχετίζεται με την έκταση της αλλαγής. Αν αυτή αφορά μικρό αριθμό βάσεων, στις οποίες συμβαίνει αντικατάσταση, προσθήκη, ή έλλειψη, τότε ονομάζεται γονιδιακή μετάλλαξη. αν αφορά αλλαγές σε μεγαλύτερο τμήμα του χρωμοσώματος, ονομάζεται χρωμοσωμική ανωμαλία.» και σελ. 97-98″ οι δομικές χρωμοσωμικές ανωμαλίες είναι αλλαγές στη δομή ενός ή περισσοτέρων χρωμοσωμάτων. Οι δομικές αλλαγές στο χρωμόσωμα μπορεί να αφορούν, μερικά γονίδια ή ένα μεγάλο τμήμα του χρωμοσώματος.» «οι δομικές χρωμοσωμικές ανωμαλίες έχουν ως αποτέλεσμα την αλλαγή στην ποσότητα ή στη διάταξη της γενετικής πληροφορίας στα χρωμοσώματα.» » Η μετατόπιση είναι αποτέλεσμα θραύσης ενός τμήματος του χρωμοσώματος και στη συνέχεια ένωσης του σε ένα άλλο μη ομόλογο χρωμόσωμα. Στις αμοιβαίες μετατοπίσεις έχουμε ανταλλαγή χρωμοσωμικών τμημάτων ανάμεσα σε μη ομόλογα χρωμοσώματα. Στις αμοιβαίες μετατοπίσεις δεν χάνεται γενετικό υλικό και τα άτομα που τις φέρουν εμφανίζουν συνήθως φυσιολογικό φαινότυπο. Ταυτόχρονα όμως εμφανίζουν κίνδυνο απόκτησης απογόνων με χρωμοσωμικές ανωμαλίες, επειδή κατά το ζευγάρωμα των χρωμοσωμάτων στη μειωτική διαίρεση προκύπτουν και μη φυσιολογικοί γαμέτες.»

Από όσα αναφέρει το σχολικό βιβλίο και γνωρίζει ο μαθητής σε σχέση με το σχήμα που δίνεται στην εικόνα 2 του θέματος Δ, ο παρατηρητικός και διαβασμένος μαθητής προβληματίζεται για το αν οι εικονιζόμενες αλλαγές στα χρωμοσώματα χαρακτηρίζονται ως γονιδιακές μεταλλάξεις (πολύ μικρής έκτασης αλλαγές στο γενετικό υλικό μη ομολόγων χρωμοσωμάτων) ή ως αμοιβαία μετατόπιση (επειδή γίνεται αντάλλαγη DNA τμημάτων μεταξύ μη ομολόγων χρωμοσωμάτων). Αξίζει να σημειωθεί ότι τα τμήματα που ανταλλάσσονται είναι στα άκρα των χρωμοσωμάτων και δεν γίνεται πουθενά φανερό αν αποτελούν τμήματα γονιδίων.

Θέμα Δ1.

«Να γράψετε όλα τα πιθανά χρωμοσώματα που θα προκύψουν μετά την αμοιβαία μετατόπιση, με τις αντίστοιχες αλληλουχίες DNA (μονάδες 4).»

Όλα τα πιθανά χρωμοσώματα που θα προκύψουν είναι οκτώ!

Τα οκτώ αυτά χρωμοσώματα είναι:

Τμήμα Α- Τμήμα Β και Τμήμα Β-Τμήμα Α

Τμήμα Α-Τμήμα Β ανεστραμμένο και Τμήμα Β – τμήμα Α ανεστραμμένο

Τμήμα Α- Τμήμα Β και Τμήμα Β- τμήμα Α ανεστραμμένο

Τμήμα Α- τμήμα Β ανεστραμμένο και Τμήμα Β- τμήμα Α

Θέμα Δ2

«Να γράψετε όλους τους πιθανούς γαμέτες αυτού του ενήλικα (προέκυψε από ζυγωτό με μια από τις παραπάνω αμοιβαίες μετατοπίσεις και έχει φυσιολογικό φαινότυπο) χρησιμοποιώντας τους συμβολισμούς των χρωμοσωμάτων, όπως σας έχουν δοθεί».

Ποια μπορεί να είναι άραγε η σωστή απάντηση σε αυτήν την ερώτηση;

α) Σύμφωνα με τις γνώσεις που μπορεί να έχει ο μαθητής από το σχολικό βιβλίο για την αμοιβαία μετατόπιση και τον 2ο νομό Mendel.

β) Σύμφωνα με τα πραγματικά γεγονότα που λαμβάνουν χώρα στη μείωση ενός ατόμου ετερόζυγου για αμοιβαία μετατόπιση.

γ) Να θεωρήσει ο μαθητής σύμφωνα με τους ορισμούς του σχολικού βιβλίου (που είναι αυτοί που οφείλει να γνωρίζει) ότι δεν πρόκειται για δομική χρωμοσωμική ανωμαλία (παρόλο που σε ολόκληρο το θέμα Δ γίνεται φανερό ότι ο θεματοδότης, είτε αγνοώντας είτε αδιαφορώντας για τους ορισμούς των διαφορετικών τύπων μεταλλάξεων του σχολικού βιβλίου, θεωρεί ότι πρόκειται για δομική χρωμοσωμική ανωμαλία) αλλά ο μαθητής να θεωρήσει ότι πρόκειται για δυο γονιδιακές μεταλλάξεις στα άκρα δύο μη ομολόγων χρωμοσωμάτων που δεν επηρεάζουν γονίδια ή την λειτουργικότητα γονιδίων.

Προφανώς ένας μαθητής θα μπορούσε να εξετάσει μόνο τις περιπτώσεις α και γ.

Περιπτώσεις α και γ.

Η περίπτωση β δεν εξετάζεται διότι είναι πόλυ μικρά τα τμήματα των χρωμοσωμάτων Α και Β που ανταλλάσσονται και επομένως δεν έχει νόημα αφού δεν θα υπάρξουν κατά την σύναψη των ομολόγων χρωμοσωμάτων προβλήματα, επιπλέον ο μαθητής δεν οφείλει να γνωρίζει αυτόν τον τρόπο.

Άτομο με χρωμοσωμική σύσταση 42+ΑαΒβ θα αποκτήσει τους εξής γαμέτες: 21+ΑΒ και 21+αβ ή 21+Αβ και 21+ αΒ. Όπου 42 τα υπόλοιπα από τα 46 χρωμοσώματα των σωματικών κυττάρων του ανθρώπου.

Θέμα Δ3.

«Κάθε γαμέτης που προκύπτει στο ερώτημα Δ2 γονιμοποιείται με φυσιολογικό γαμέτη. Να εξηγήσετε τι ποσοστό των απογόνων θα είχε φυσιολογικό φαινότυπο (μονάδες 5) και τι ποσοστό των απογόνων θα έχει φυσιολογικό καρυότυπο (μονάδες 4).»

Σύμφωνα με όσα αναφέρθηκαν προηγουμένως οι πιθανοί απόγονοι θα είναι οι έξης:

42+ΑΑΒΒ ή 42+ΑαΒβ ή 42+ΑΑΒβ ή 42+ΑαΒΒ.

Ο φυσιολογικός γαμέτης έχει χρωμοσωμική σύσταση : 21+ΑΒ

Περίπτωση 1: Τα τμήματα που ανταλλάχθηκαν μεταξύ των χρωμοσωμάτων Α και Β δεν αποτελούν τμήματα γονιδίων.

Το ποσοστό των απογόνων με φυσιολογικό φαινότυπο είναι 100% διότι το τμήμα του χρωμοσώματος Α που βρίσκεται στο χρωμόσωμα β καθώς και το τμήμα του χρωμοσώματος Β που βρίσκεται στο χρωμόσωμα α είναι τόσο μικρό (λιγότερο σε κάθε περίπτωση από 10 ζεύγη βάσεων) και στο άκρο του χρωμοσώματος ωστε δεν μπορεί να επηρεάσει με κάποιο τρόπο τον φαινότυπο των ατόμων με χρωμοσωμική σύσταση 42+ΑΑΒβ ή 42+ΑαΒΒ. Τα άτομα με χρωμοσωμική σύσταση 42+ΑΑΒΒ και 42+ΑαΒβ είναι φυσιολογικά όπως προκύπτει άμεσα από την εκφώνηση.

Το ποσοστό των απογόνων με φυσιολογικό καρυότυπο θα είναι επίσης 100%.

Σύμφωνα με τον ορισμό του σχολικού βιβλίου για τον καρυότυπο αυτός αποτελεί την απεικόνιση κατά ελλατούμενο μέγεθος των ζευγων των μεταφασικών χρωμοσωμάτων διαιρούμενων ευκαρυωτικών κυττάρων και η παρατήρηση τους γίνεται στο οπτικό μικροσκόπιο. Σελ. 20 σχολικό βιβλίο.

Τα τμήματα που ανταλλάχθηκαν μεταξύ των χρωμοσωμάτων Α και Β είναι πολύ μικρά και δεν μπορεί η διαφορά των χρωμοσωμάτων Α και α καθώς και Β και β να είναι παρατηρήσιμη με το οπτικό μικροσκόπιο. Το σχολικό βιβλίο αναφέρει στη σελίδα 20 ότι τα μεταφασικά χρωμοσώματα είναι η μόνη μορφή των χρωμοσωμάτων όπου καθίστανται ορατά ως μεμονωμένες δομές στο οπτικό μικροσκόπιο. Επίσης το σχολικό βιβλίο αναφέρει και εμφανίζει μάλιστα και εικόνα από ηλεκτρονικό μικροσκόπιο, ότι το νουκλεόσωμα (πρώτος βαθμός πακεταρίσματος του ευκαρυωτικού  πυρηνικού DNA) αποτελείται από 146!! ζεύγη βάσεων τυλιγμένων γύρω από τις ιστόνες και είναι παρατηρήσιμο ΜΟΝΟ στο ηλεκτρονικό μικροσκόπιο. Γι αυτό άλλωστε και ο καρυότυπος αφορά μεταφασικά χρωμοσώματα. (Για να είναι παρατηρήσιμες οι δομικές αλλαγές στα χρωμοσώματα στον καρυότυπο πρέπει να έχουν μέγεθος μεγαλύτερο από 10.000 ζεύγη βάσεων. Αυτό βεβαίως δεν οφείλει να το γνωρίζει ο μαθητής).

Περίπτωση 2. Στα άκρα των χρωμοσωμάτων Α και Β που συνέβει η ανταλλαγή των τμημάτων υπήρχαν γονίδια που η έκφραση τους είναι ικανή να παρατηρηθεί στο φαινότυπο, συνεπώς τα χρωμοσώματα α και β φέρουν υπολειπόμενες μεταλλάξεις έναντι των χρωμοσωμάτων Α και Β ως προς τα ακραία αυτά γονίδια καθώς από την εκφώνηση της άσκησης το άτομο με χρωμοσωμική σύσταση 42+ΑαΒβ είναι φυσιολογικό.

Στην περίπτωση αυτή το ποσοστό των φυσιολογικών απογόνων είναι 100%.

Και για τους λογούς που αναπτύχθηκαν στην προηγουμένη περίπτωση το ποσοστό των φυσιολογικων καρυτυπικώς απογόνων είναι πάλι 100%.

Το ποσοστό να είναι 50 % οι φυσιολογικοί απόγονοι ( 42+ ΑΑΒΒ και 42+ ΑαΒβ) και 25% οι φυσιολογικά καρυοτυπικώς απόγονοι (μόνο οι 42+ΑΑΒΒ) αποκλείεται διότι τα τμήματα που ανταλλάσσονται μεταξύ των χρωμοσωμάτων Α και Β είναι πολύ μικρά.

Θέμα Δ4.

«Να εξηγήσετε τα ειδή των δομικών χρωμοσωμικών ανωμαλιών που σίγουρα θα έχει κάθε απόγονος με μη φυσιολογικό καρυότυπο.»

Προηγουμένως, καταλήξαμε ότι αποκλείεται να υπάρχουν απόγονοι με μη φυσιολογικό καρυότυπο καθώς οι αλλαγές στα χρωμοσώματα α και β είναι αδύνατον να παρατηρηθούν με το οπτικό μικροσκόπιο. Αν ωστόσο θεωρήσουμε ότι το ερώτημα αφορά τα άτομα με χρωμοσωμική σύσταση 42+ ΑαΒβ και 42+ΑΑΒβ και 42+ΑαΒΒ τα οποία φέρουν τα μεταλλαγμένα χρωμοσώματα α και β, και αν θεωρήσουμε ότι το ερώτημα ορίζει ως δομικές χρωμοσωμικές ανωμαλίες τις αλλαγές αυτές στα χρωμοσώματα α και β -κατά παράβαση του ορισμού του σχολικού βιβλίου για τις δομικές χρωμοσωμικές ανωμαλίες, που αναφέρθηκε παραπάνω- τότε τα άτομα :

42+ΑαΒβ, θα φέρουν φυσιολογική ποσότητα DNA, αλλά αμοιβαία μετατόπιση μικρών ακραίων τμημάτων μεταξύ των χρωμοσωμάτων Α και Β (χρωμοσώματα α και β).

42+ΑαΒΒ, θα φέρουν μια επιπλέον φορά το ακραίο τμήμα του χρωμοσώματος Β όπως δίνεται στην εικόνα 2 (διπλασιασμός!;) και μια μόνο φορά το ακραίο τμήμα του χρωμοσώματος Α όπως δίνεται στην εικόνα 2 (έλλειψη!).

42+ΑΑΒβ , θα φέρουν μια επιπλέον φορά το τμήμα του χρωμοσώματος Α όπως δίνεται στην εικόνα 2 (διπλασιασμός!;) και μια μόνο φορά το τμήμα του χρωμοσώματος Β όπως δίνεται στην εικόνα 2 (έλλειψη!).

Στο σχολικό βιβλίο οι ορισμοί του διπλασιασμού και της έλλειψης που είναι δομικές χρωμοσωμικές ανωμαλίες δίνονται στη σελ 97. «Η έλλειψη είναι η απώλεια γενετικού υλικού.» και «Ο διπλασιασμός είναι η επανάληψη ενός χρωμοσωμικού τμήματος στο χρωμόσωμα.». Ως δομικές χρωμοσωμικές ανωμαλίες αφορούν μερικά γονίδια ή μεγάλο τμήμα χρωμοσώματος.

Φυσικά και εδώ ισχύει , ποια άραγε απάντηση θα θεωρηθεί σωστή…..;

Είναι πράγματι απορίας άξιο με ποιο πνεύμα προτείνονται τα θέματα!

Ας ελπίζουμε ότι η πρόταση « κάθε απάντηση επιστημονικώς τεκμηριωμένη είναι ΠΡΑΓΜΑΤΙ αποδεκτή.»

ίσως η νεα ηγεσία του Υπουργείου Παιδείας θα πρέπει να εξετάσει το ενδεχόμενο να δημοσιοποιεί τα ονόματα των μελών των επιτροπών των θεμάτων των πανελληνίων εξετάσεων μετά το πέρας των εξετάσεων.

Ερωτήσεις κατανοήσεις κεφαλαίου 5-Μενδελική Κληρονομικότητα.

  1. Ο πρώτος νόμος του Μέντελ ισχύει για όλα μας τα γονίδια.
  2. Ο πρώτος νόμος του Μέντελ ισχύει για το γονίδιο μας, της αχρωματοψίας στο κόκκινο χρώμα.
  3. Ο δεύτερος νόμος του Μέντελ ισχύει για δυο γονίδια που εδράζονται σε μη ομόλογη περιοχή των φυλετικών χρωμοσωμάτων μας Χ και Υ.
  4. Επειδή είμαστε διπλοειδείς οργανισμοί έχουμε όλα μας τα γονίδια σε δυο αντίγραφα.
  5. Το πλήθος των γενετικών μας τόπων είναι ίσο με το πλήθος των αλληλομόρφων των γονιδίων μας που διαθέτουμε.
  6. Όσα είναι τα γονίδια μας είναι και τα χαρακτηριστικά που διαθέτουμε.
  7. Άτομα με τον ίδιο γονότυπο θα έχουν και τον ίδιο φαινότυπο.
  8. Ο γονότυπος ενός ατόμου άφορα το είδος και το πλήθος των αλληλομόρφων του.
  9. Ο φαινότυπος ενός ατόμου προσδιορίζεται πάντα και από τον γονότυπο του.
  10. Ένα χαρακτηριστικό που ελέγχεται από γενετικό τόπο του Υ φυλετικού χρωμοσώματος κληρονομείται μόνο στους αρσενικούς απογόνους.
  11. Ο γονότυπος μας αφορά και τα γονίδια του μιτοχονδρικού γενετικού υλικού μας.
  12. Μια φυλοσύνδετη επικρατής νόσος εμφανίζεται στο 100% των θυγατέρων ενός ζευγαριού όταν νοσεί μόνο ο πατέρας και ποτέ στους υιούς.
  13. Ένα φυλοσύνδετο επικρατές χαρακτηριστικό μεταβιβάζεται με την ίδια πιθανότητα που μεταβιβάζεται ένα φυλοσύνδετο υπολειπόμενο χαρακτηριστικό όταν από τους γονείς είναι φορέας του υπεύθυνου αλληλόμορφου η μητέρα.
  14. Το χρωμόσωμα Υ του προ-προ-πάππου σας από την πλευρά του πάτερα σας το φέρει σίγουρα και ο αδελφός σας.
  15. Η πιθανότητα ένας απόγονος να είναι ετερόζυγος για ένα αυτοσωμικό υπολειπόμενο γνώρισμα όπως και οι γονείς του είναι 1/2.
  16. Η παραπάνω πιθανότητα είναι 2/3 αν είναι γνωστό ότι ο απόγονος δεν νοσεί.
  17. Ο Μέντελ ανακάλυψε τα γονίδια..
  18. Οι νόμοι της κληρονομικότητας του Μεντελ είναι καθολικοί στον έμβιο κόσμο όπως και ο γενετικός κώδικας.
  19. Ο Μέντελ με τα αποτελέσματα των πειραμάτων του υπέδειξε ποια πρέπει να είναι τα χαρακτηριστικά του γενετικού υλικού των οργανισμών.
  20. Ένα υπολειπόμενο φαινοτυπικό χαρακτηριστικό ελέγχεται πάντα από ένα αλληλόμορφο που δεν εκφράζεται στα κύτταρα.
  21. Τα δυο κύτταρα της πρώτης μειωτικής διαίρεσης ενός μειοκυττάρου ενός διπλοειδούς υβριδίου έχουν τον ίδιο λόγο A+T/C+G.
  22. Ένα φυσιολογικό αγόρι και ένα φυσιολογικό κορίτσι έχουν το ίδιο πλήθος διαφορετικών γονιδίων.
  23. Οι μιτοχονδριακές ασθένειες δεν αποκλείεται να ακολουθούν και μενδελικό τύπο κληρονομικότητας.
  24. Ένα φυσιολογικό κορίτσι έχει λιγότερους γενετικούς τόπους από ένα φυσιολογικό αγόρι αλλά έχει περισσότερα αλληλόμορφα από το αγόρι.
  25. Εάν αναπαραστήσουμε τα δυο αλληλόμορφα ενός γονίδιου με τα γράμματα Α και α και ορίσουμε ως p και q τις συχνότητες των αλληλομορφων αυτών αντίστοιχα μέσα στην γονιδιακή δεξαμενή, τότε οι συχνότητες των διαφορετικών γονότυπων είναι : p^2 + 2pq + q^2 =1, φυσικά p+q =1 και αναφερόμαστε σε παμμικτικό πληθυσμό με αόριστα μεγάλο μέγεθος που δεν υπάρχει μετανάστευση, και το περιβάλλον του βιοτόπου του παραμένει σταθερό.
  26. Ο παραπάνω τύπος δηλώνει ότι οι γονοτυπικές συχνότητες ενός παμμικτικού πληθυσμού αόριστα μεγάλου μεγέθους παραμένουν σταθερές από μια γενεά στην επόμενη.
  27.  Ο παραπάνω πληθυσμός βρίσκεται σε ισορροπία Hardy-Weinberg (HWE), δηλαδή η σχετική αφθονία των αλληλομορφων Α και α δεν αλλάζει από γενεά σε γενεά. Η μονή αλλαγή στη γενετική κατανομή του πληθυσμού είναι μια ανακατανομή των γονότυπων σε συχνότητες που θα παραμένουν σταθερές σε όλες τις επόμενες γενεές.
  28. Ο τύπος HW  ισχύει και για πολλαπλά αλληλόμορφα ενός γενετικού τόπου αλλά και για πολυγονιδιακούς χαρακτήρες.
  29. Ο νόμος HW μας παρέχει ένα βασικό επίπεδο ώστε να μπορούμε να συγκρίνουμε τις πραγματικές αλλαγές συχνοτήτων αλληλομορφων που συμβαίνουν από γενεά σε γενεά σε μια αναπαραγωγική κοινότητα (πληθυσμός).
  30. Αποκλίσεις από τον τύπο HW υποδεικνύει διατάραξη του ισοζυγίου γονοτυπικών συχνοτήτων από γενεά σε γενεά.
  31. Αποκλίσεις από τον τύπο HW προκύπτουν λόγω μεταλλάξεων, μετανάστευση νέων γονιδίων στο εσωτερικό του πληθυσμού, τυχαίες αλλαγές συχνοτήτων εξαιτίας δειγματοληπτικού σφάλματος (γενετική παρέκλιση) και φυσική επιλογή που ευνοεί έναν γονότυπο σε βάρος κάποιου άλλου.
  32. Σε μια κυψέλη η βασίλισσα είναι διπλοειδής και γονιμοποιείται από έναν κηφήνα που είναι απλοειδής, όπως όλοι οι κηφήνες, όλες οι εργάτριες έχουν ομοιότητα σε επίπεδο γενετικού υλικού του πυρήνα κατά 75%.
  33. Ο Punnett ρωτήθηκε κάποτε αν θα θυσιαζόταν στο όνομα της Βασίλισσας της Αγγλίας. Εκείνος απάντησε: «για την Βασίλισσα όχι, άλλα για δυο αδέλφια μου ή για 4 πρώτα ξαδέλφια μου ναι.» Δώστε μια εξήγηση για αυτήν την απάντηση του μεγάλου γενετιστή.
  34. Δυο κατσίκες που είναι μονοζυγωτικά δίδυμα διασταυρώθηκαν με τον ίδιο τράγο διαδοχικά η μια μετά την άλλη. Τα κατσικάκια που γεννήθηκαν είχαν πανομοιότυπο γενετικό υλικό και πυρηνικό και μιτοχονδριακό.
  35. Δυο κριοί μονοζυγωτικα δίδυμα διασταυρώθηκαν με δυο προβατίνες επίσης μεταξύ τους μονοζυγωτικά διδυμα την ιδια χρονικη περιοδο. Τα προβατακια ειχαν το ιδιο μιτοχονδριακο DNA και διαφορετικο πυρηνικο.
  36. Αν τα παραπάνω ζευγάρια ήταν καθαρές σειρές, οι μεν κριοί για την γαλακτοπαραγωγή και οι δε προβατίνες για την ποιότητα του μαλλιού, τότε τα προβατάκια θα ήταν όλα κλώνοι μεταξύ τους.
  37. Από την διασταυρωση ενός ατόμου ΑΑ με ένα άτομο αα, σύμφωνα με το πρότυπο διασταυρωσεων κατά Μεντελ, στην δεύτερη θυγατρική γενεά το 75% των απόγονων θα έχουν τον επικρατή φαινότυπο. Άρα, μπορούμε να υποθέσουμε ότι εξαιτίας της αριθμητικής υπεροχής του, το επικρατές αλληλομορφο θα γίνεται όλο και πιο κοινό στον πληθυσμό και το υπολειπόμενο όλο και πιο σπάνιο.
  38. ολα τα άτομα της πρώτης θυγατρικής γενεάς στα πειράματα του Μεντελ είναι μεταξύ τους κλώνοι.
  39. το ανάπτυγμα κύβου της παράστασης (3+1) μας δίνει την μενδελικη αναλογία τριυβρυδισμου.
  40. Καθαρη σειρά σημαίνει άτομα ομοζυγα αποκλειστικά για το γονίδιο που ελέγχει τον υπό μελέτη χαρακτήρα.
  41. Τα υβρίδια είναι μεταξύ τους κλώνοι.
  42. Ο χαρακτήρας ύψος ελέγχεται μονογονιδιακά σε όλους τους πολυκύτταρους οργανισμούς.
  43. Η αναλογία 3 προς 1 κατά την μελέτη δυο χαρακτήρων που ελέγχονται μονογονιδιακα με δυο αλληλομορφα  με σχέση πλήρους επικράτειας -υποτέλειας, προκύπτει οταν το ενα  ειναι εμβρυακο θνησιγονο σε ομοζυγη κατασταση (το υπολοιπομενο) ή οταν τα γονιδια ειναι συνδεδεμενα.
  44. Αν ο Μεντελ στις διασταυρωσεις μονουβριδισμου που πραγματοποίησε, εβρισκε τις εξης αναλογιες στην F2 γενεα: 8 [Α]:[α], θα διατυπωνε τον πρωτο νομο του ως εξης: Κατα την μείωση Ι, διαχωριζονται τα ομολογα χρωμοσώματα τυχαία μεν,  ισοπιθανα δε και κατανέμονται στους γαμετες. Η γονιμοποιηση ειναι τυχαιο γεγονος.
  45. Το υψος σε όλα τα είδη των οργανισμών είναι μονογονιδιακο χαρακτηριστικό.
  46.  Οι αιμομιξίες οδηγούν σε αύξηση της ομοζυγωτίας για τα ευνοϊκά χαρακτηριστικά ενός πληθυσμού σε βάθος γενεών.
  47. Οι αιμομιξίες έχουν οδηγήσει στο παρελθόν στην κατάρρευση βασιλικών δυναστειών.
  48. Από γονείς με ομάδα αίματος Α και Β αντίστοιχα, μπορούμε να έχουμε απογόνους με όλες τις διαφορετικές ομάδες αίματος ως προς το σύστημα ΑΒΟ.
  49.  Για έναν πολυγονιδιακό χαρακτήρα που ελέγχεται μόνο από αυτοσωμικά γονίδια ισχύει ο πρώτος νόμος του Μέντελ, για κάθε επιμέρους γονίδιο που τον ελέγχει καθώς και ο δεύτερος νόμος για όσα από τα γονίδια που τον ελέγχουν, δεν είναι συνδεδεμένα.
  50. Ένα χαρακτηριστικό χαρακτηρίζεται ως υπολειπόμενο όταν δεν εμφανίζεται φαινοτυπικά στο ετερόζυγο άτομο για αυτό το χαρακτηριστικό.
  51.  Ένα χαρακτηριστικό είναι φυλοσύνδετο υπολειπόμενο όταν από την διασταύρωση ετερόζυγων ατόμων προκύπτει αναλογία θηλυκών / αρσενικά 1:1 και φαινοτυπική αναλογία 3:1, οπού όλα τα άτομα με το χαρακτηριστικό είναι αρσενικά.
  52.  Το γονίδιο της αχρωματοψίας στο κόκκινο είναι διαφορετικό αλλά συνδεδεμένο με το γονίδιο της αχρωματοψίας στο πράσινο.
  53. Ο Μέντελ μελέτησε επτά χαρακτήρες του φυτού μοσχομπίζελο.
  54. Η πιθανότητα ένα παιδί να είναι αγόρι είναι 1/2 , διότι ο αρσενικός γονέας δημιουργεί δυο πιθανούς γαμέτες , αυτούς με Χ φυλετικό χρωμόσωμα και αυτούς με Υ φυλετικό χρωμόσωμα ενώ ο θηλυκός γονέας δημιουργεί μόνο γαμέτες με Χ φυλετικό χρωμόσωμα.
  55. Δεν δημιουργούνται επικρατή θνησιγόνα αλληλόμορφα γονιδίων.
  56. Ο πρώτος νόμος του Μεντελ στηρίζεται στην πρώτη μειωτική διαίρεση και ο δεύτερος νόμος στην δεύτερη μειωτική διαίρεση.
  57.  Και οι δυο νόμοι του Μεντελ στηρίζονται στο ίδιο στάδιο της μείωσης, στον διαχωρισμό των αδελφών χρωματίδων.
  58.  Ο δεύτερος νόμος του Μεντελ δεν ισχύει για μονογονιδιακούς χαρακτήρες.
  59. Είναι αδύνατον να προκύψει υγιές παιδί από γονείς που νοσούν από οικογενή υπερχολιστεριναιμία.
  60.  Στην πρώτη μειωτική διαίρεση συμβαίνει διαχωρισμός αδελφών χρωματίδων και επιχιασμός και στην δεύτερη μειωτική διαίρεση συμβαίνει αποχωρισμός ομολόγων χρωμοσωμάτων και σύναψη τους στο ισημερινό πεδίο του κυττάρου.
  61. Στα αγόρια υπάρχει περισσότερο γενετικό υλικό μητρικής προέλευσης ενώ στα κορίτσια το γενετικό υλικό τους είναι 50% μητρικής και 50% πατρικής προέλευσης.
  62.  Η αυτογονιμοποιήση των φυτών δεν συμβάλει στην γενετική ποικιλότητα τους.
  63. Η φαινοτυπική σχέση επικρατείας μεταξύ των αλληλομόρφων ενός γονιδίου προκύπτει με βάση το φαινότυπο του ετερόζυγου ατόμου.
  64.  Η σχέση επικρατείας των αλληλομόρφων ενός γονιδίου σε μοριακό επίπεδο ταυτίζεται πάντα με την φαινοτυπική σχέση επικρατείας τους.
  65.  Το 1940 οι επιστήμονες ήξεραν ότι το γενετικό υλικό δεν είναι οι υδατάνθρακες και τα λιπίδια επειδή είχε διατυπωθεί ήδη η χρωμοσωμική θεωρία της κληρονομικότητας.
  66. Οι νομοί του Μεντελ και ο επιχιασμος, είναι ικανές και αναγκαίες συνθήκες για την αλλαγή των συχνοτήτων των αλληλομορφων σε ένα πληθυσμό.
  67. Οι επιλεκτικές διασταυρώσεις είναι βιοτεχνολογική μέθοδος.

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

 

Βιολογία Θετικής κατεύθυνσης το Δ θέμα στις εξετάσεις 2014!

 

Επιστημονικά λάθη φέτος στη Βιολογία κατεύθυνσης!

 

Τα φετινά θέματα της βιολογίας θετικής κατεύθυνσης μέχρι το ερώτημα Δ2 δεν χαρακτηρίζονται από καμιά πρωτοτυπία. Συγκεκριμένα το Α θέμα όπως πάντα από το 2003 και μετά αποτελούνταν από 5 ερωτήσεις πολλαπλής επιλογής που απαιτούσαν απλή ανάκληση γνώσεων από το σχολικό βιβλίο. Το Β θέμα βεβαίως αυτή τη φορά δεν απαιτούσε την παράθεση αυτούσιων τμημάτων του σχολικού βιβλίου αλλά, σε δυο ερωτήματα ζητούσε τοποθέτηση κατά χρονική σειρά και αντιστοίχηση και πάλι όμως αρκούσε η αυτούσια γνώση του σχολικού βιβλίου για να απαντηθεί. Το θέμα Γ για άλλη μια χρονιά ήταν μια κλασσική άσκηση του 5ου κεφαλαίου. Για άλλη μια φορά ήταν ένα πολύ απλό και εύκολο γενεαλογικό δένδρο που αφορούσε ένα κληρονομικό χαρακτηριστικό που όπως συνήθως ακολουθούσε αυτοσωμικό υπολειπόμενο τρόπο κληρονόμησης. Το θέμα Δ, μέχρι το ερώτημα Δ2 στερούνταν και πάλι πρωτοτυπίας αφού ζητούσε να βρεθεί η κωδική αλυσίδα του δοθέντος τμήματος γονιδίου, το mRNA και ο προσανατολισμός τους.

Είναι πράγματι άξιο απορίας γιατί τα θέματα της Bιολογίας εμφανίζουν τόσο μεγάλη επαναληψιμότητα, Μήπως δεν είναι η Βιολογία ένα επιστημονικό πεδίο ακόμα και σε επίπεδο λυκείου που έχει ποικιλία ασκήσεων και ερωτήσεων που απαιτούν κριτική σκέψη;

Πέραν όμως της στερούμενης πρωτοτυπίας των θεμάτων μέχρι το ερώτημα Δ2, στα επόμενα τρία ερωτήματα που ακολουθούσαν στο θέμα Δ τα ζητούμενα παρουσίαζαν πρωτοφανή πρωτοτυπία! Ζητούνταν από τους μαθητές να απαντήσουν στα ερωτήματα με επιστημονικώς λανθασμένες απαντήσεις!!!

Ας δούμε όμως καθένα από αυτά τα ερωτήματα ξεχωριστά:

 

Ερώτημα Δ3: Να γράψετε το τμήμα του mRNA στο οποίο θα συνδεθεί η μικρή ριβοσωμική υπομονάδα κατά την έναρξη της μετάφρασης.

 

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

 

1) το τμήμα του σχολικού βιβλίου που αφορά την έναρξη της μετάφρασης.

” κατά την έναρξη της μετάφρασης το mRNA προσδένεται, μεσώ μιας αλληλουχίας που υπάρχει στην 5′ αμετάφραστη περιοχή του με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος σύμφωνα με τους κανόνες της συμπληρωματικότητας των βάσεων.”

2) Το τμήμα του mRNA που προκύπτει από το δοθέν τμήμα του πρώτου γονιδίου του οπερονίου της λακτόζης (απάντηση ερωτήματος Δ2):

 

5′ AGCUAUGACCAUGUUACGGAUUCACUG3′

Σύμφωνα με αυτά, ο μαθητής παρατηρεί ότι το μόνο τμήμα 5′ αμετάφραστης περιοχής που του δίνεται είναι τα 4 νουκλεοτίδια που προηγούνται του κωδικονίου έναρξης της μετάφρασης (AUG), όποτε δεν του μένει άλλη επιλογή από το δώσει αυτήν την τετράδα νουκλεοτιδίων της 5′ αμετάφραστης περιοχής ως απάντηση, ανεξάρτητα από το αν τον προβληματίζει η διατύπωση του σχολικού βιβλίου “μεσώ μιας αλληλουχίας που υπάρχει στην 5′ αμετάφραστη περιοχή του”, το οποίο ορθώς αφήνει να εννοηθεί ότι αυτή η αλληλουχία δεν είναι ολόκληρη η 5΄αμετάφραστη περιοχή, όποτε δεν σημαίνει απαραίτητα ότι είναι σωστή η μοναδική απάντηση που μπορεί να δοθεί, δηλαδή τα 4 τελευταία νουκλεοτίδια της 5΄αμετάφραστης περιοχής.

Πράγματι, όπως όφειλε να γνωρίζει ο θεματοδότης, τα 4 τελευταία νουκλεοτίδια της 5΄αμετάφραστης περιοχής των mRNAs του βακτηρίου E. coli, δεν αποτελούν την αλληλουχία σύνδεσης τους με το τμήμα του rRNA της μικρής ριβοσωμικής υπομονάδας. Η αλληλουχία αυτή στην 5′ αμετάφραστη περιοχή ονομάζεται Shine-Delgarno και είναι μια συντηρημένη αλληλουχία συνήθως 7-9 νουκλεοτιδίων πλουσίων σε Α και G (5’UAAGGAGGU3′)(πολλά textbooks βιολογίας π.χ. GeneVIII, άλλα και πιο ειδικά επιστημονικά άρθρα όπως JinH, ZhaoQ, GonzalezdeValdiviaEI, ArdellDH, StenströmM, IsakssonLA. Mol Microbiol. 2006 Apr; 60(2):480-92.καιDetermination of the optimal aligned spacing between the Shine-Dalgarno sequence and the translation initiation codon of Escherichia coli mRNAs.Nucleic Acids Research. Nov 25, 1994; 22(23)4953) και η αλληλουχία αυτή (S-D) του mRNA απέχει από το κωδικόνιο έναρξης 4-5 νουκλεοτίδια! (Determination of the optimal aligned spacing between the Shine-Dalgarno sequence and the translation initiation codon of Escherichia coli mRNAs.Nucleic Acids Research. Nov 25, 1994; 22(23)4953).

 

Ερώτημα Δ4: Η φυσιολογική πρωτεΐνη, που παράγεται από την έκφραση του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης, αποτελείται από 1024 αμινοξέα. Μια γονιδιακή μετάλλαξη αντικατάστασης μιας βάσης στο παραπάνω τμήμα DNA οδηγεί στην παραγωγή μιας πρωτεΐνης με 1022 αμινοξέα, δηλαδή μικρότερης κατά δυο αμινοξέα . Να εξηγήσετε με ποιο τρόπο μπορεί να συμβεί αυτό.

 

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

 

1)τον ορισμό του οπερονίου της λακτόζης από το σχολικό βιβλίο.

2)τον ορισμό των μεταλλάξεων και ειδικότερα των γονιδιακών μεταλλάξεων και συγκεκριμένα τον ορισμό και τις επιπτώσεις των γονιδιακών μεταλλάξεων αντικατάστασης βάσης.

3)να διερευνήσει την ερμηνεία της φράσης στην εκφώνηση του ερωτήματος “..στο παραπάνω τμήμα DNA.. “

 

Διερεύνηση

 

Ερμηνεία Ι). Η φράση της εκφώνησης “στο παραπάνω τμήμα DNA αναφέρεται στο δοθέν από την εκφώνηση του Δ θέματος τμήμα DNA, του πρώτου δομικού γονιδίου του οπερονίου μήκους 28 ζευγών βάσεων, που κωδικοποιεί τα 8 πρώτα αμινοξέα του ενζύμου της β-γαλακτοσιδάσης.

Σε αυτή την περίπτωση η ζητούμενη απάντηση είναι ότι η αναφερόμενη στην εκφώνηση μετάλλαξη οδήγησε στην κατάργηση του πρώτου κωδικονίου 5’ATG3′ στην κωδική αλυσίδα του γονιδίου και αντίστοιχα της τριπλέτας 3’ΤΑC5′ της μη κωδικής αλυσίδας του γονιδίου με συνεπεία την παράγωγη ενός μεταλλαγμένου μορίου mRNA που προέκυψε από την μεταγραφή του οπερονίου. Το μεταλλαγμένο αυτό mRNA, όταν μεταφράζεται το τμήμα του που κωδικοποιεί για την β-γαλακτοσιδάση να έχει ως συνεπεία η μετάφραση, εάν είναι βεβαίως αυτό εφικτό να γίνει , εξαιτίας των συγκεκριμένων διαστάσεων και του τρόπου δράσης του ριβοσώματος με το mRNA, να ξεκινήσει από το επόμενο 5’AUG3′ που υπάρχει στο μεταλλαγμένο mRNA. Η θέση του 5’AUG3′ αυτού εντοπίζεται ακριβώς ένα κωδικόνιο μετά το φυσιολογικό εναρκτήριο κωδικόνιο της μετάφρασης, όποτε η παραγόμενη πολυπεπτιδική αλυσίδα που θα προκύψει από την μετάφραση του μεταλλαγμένου τμήματος του mRNA του οπερονίου να είναι κατά δυο αμινοξέα μικρότερη.

Ωστόσο ο θεματοδότης όφειλε να γνωρίζει ότι αυτή η πιθανή απάντηση δεν είναι απαραίτητα σωστή επιστημονικώς. Σύμφωνα με όσα αναφέρθηκαν στο προηγούμενο ερώτημα, η έναρξη της μετάφρασης στα γονίδια το βακτηρίου E. coli είναι εφικτή όταν πληρούνται συγκεκριμένες προϋποθέσεις, όπως είναι η ύπαρξη άλλα και η σωστή απόσταση της αλληλουχίας S-D από την τριπλέτα 5’AUG3′ στο mRNA καθώς οι διαστάσεις του ριβοσώματος και ο τρόπος με τον οποίο αυτό συνδέεται με το mRNA είναι συγκεκριμένες/ος.

 

Ερμηνεία ΙΙ). Η φράση της εκφώνησης “στο παραπάνω τμήμα DNA αναφέρεται σε ολόκληρο το δομικό γονίδιο Ζ του οπερονίου της λακτόζης πέραν του δοθέντος τμήματος του, το οποίο εξετάστηκε αμέσως παραπάνω.

Σε αυτή την περίπτωση η απάντηση θα μπορούσε να είναι ότι η αναφερόμενη στην εκφώνηση μετάλλαξη αντικατάστασης βάσης οδήγησε σε ένα μεταλλαγμένο γονίδιο Ζ του οπερονίου. Όταν μεταγράφεται αυτό το μεταλλαγμένο οπερονίο οδηγεί σε να μόριο mRNA του οποίου το τμήμα του που κωδικοποιεί την β-γαλακτοσιδάση να διαφέρει από το φυσιολογικό λόγω αντικατάστασης μιας βάσης στο 1023ο κωδικονίο, με αποτέλεσμα να υπάρχει σε αυτή τη θέση κωδικονίο λήξης (κωδικονίο χωρίς νόημα). Το μεταλλαγμένο αυτό mRNA όταν μεταφράζεται το τμήμα του που κωδικοποιεί για τη β-γαλακτοσιδάση οδηγεί σε ένα μεταλλαγμένο ένζυμο μικρότερο από το φυσιολογικό στο καρβοξιτελικό άκρο του κατά δυο αμινοξέα.

Σε αυτή την περίπτωση, σύμφωνα με τα δεδομένα της εκφώνησης του ερωτήματος, αφού η μετάλλαξη που συνέβει είναι αντικατάστασης βάσης και η παραγόμενη πρωτεΐνη είναι κατά δυο αμινοξέα μικρότερη, μπορεί ο μαθητής να υποθέσει με ασφάλεια ότι το φυσιολογικό 1023ο κωδικονίο έχει τέτοια αλληλουχία που είναι δυνατό με μια αντικατάσταση βάσης να σχηματιστεί κωδικόνιο λήξης.

Με αυτή την ερμηνεία ο μαθητής δεν κινδυνεύει να δώσει επιστημονικώς λανθασμένη απάντηση, ανεξάρτητα από το αν δεν είναι υποχρεωμένος – είναι όμως οπωσδήποτε ο θεματοδότης που επιλεγεί αυτό το ερώτημα – να γνωρίζει σε βάθος επιστημονικές λεπτομέρειες για την έναρξη της μετάφρασης (βλέπε π.χ. παραπομπές παραπάνω).

 

Ερώτημα Δ5. Μια γονιδιακή μετάλλαξη που συνέβει στο ρυθμιστικό γονίδιο του οπερόνιου της λακτόζης οδηγεί στην παραγωγή ενός τροποποιημένου mRNA. Το mRNA αυτό φέρει τέσσερις επιπλέον διαδοχικές βάσεις μεταξύ του 3ο και 4ο κωδικονίου του. Να εξηγήσετε ποια θα είναι η συνεπεία στην παράγωγη των ενζύμων που μεταβολίζουν τη λακτόζη όταν το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

1)    Από το 7ο κεφάλαιο « όπως και όλοι οι υπόλοιποι οργανισμοί…διάφορες οργανικές ενώσεις όπως οι υδατάνθρακες.»

2)    Από το 2ο κεφάλαιο οτιδήποτε αναφέρει το σχολικό βιβλίο για το οπερόνιο της λακτόζης στο βακτήριο E.coli. και την τελευταία άσκηση του σχολικού βιβλίου στο 2ο κεφάλαιο.

3)    Από το 6ο κεφάλαιο τον ορισμό των μεταλλάξεων και ειδικότερα των γονιδιακών μεταλλάξεων και συγκεκριμένα τον ορισμό και τις επιπτώσεις των γονιδιακών μεταλλάξεων προσθήκης βάσεων, εντός της κωδικής περιοχής του γονιδίου, σε πλήθος που είναι μη ακέραιο πολλαπλάσιο του τρία.

4)    Να διερευνήσει την ερμηνεία της φράσης στην εκφώνηση «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης

 

Διερεύνηση:

 

Ερμηνεία Ι). Η φράση της εκφώνησης «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.» αναφέρεται στην μεταφορά και τον εμβολιασμό του μεταλλαγμένου στελέχους σε θρεπτικό υλικό απουσία πηγής άνθρακα με σκοπό την ανάπτυξη του σε αυτό το θρεπτικό μέσο.

Σε αυτήν την περίπτωση δεδομένου ότι το βακτήριο E. coli είναι ετερότροφο και σύμφωνα με τα παραπάνω αποσπάσματα του σχολικού βιβλίου, είναι βέβαιο ότι το βακτηριακό αυτό στέλεχος θα αδυνατεί να αναπτυχθεί σε αυτό το θρεπτικό υλικό, αφού δεν θα είναι δυνατή η τροφοδότηση του με άνθρακα. Η αδυναμία αυτή είναι ανεξάρτητη από την μετάλλαξη που φέρει το βακτηριακό αυτό στέλεχος στο ρυθμιστικό γονίδιο του οπερονίου της λακτόζης. Ωστόσο εάν η μετάλλαξη αυτή είχε ως συνεπεία έναν μη λειτουργικό καταστολέα που θα αδυνατεί να συνδεθεί με τον χείριστη του οπερονίου, θα επιβάρυνε ακόμη περισσότερο την αδυναμία του βακτηρίου να αναπτυχθεί σε θρεπτικό υλικό που στερείται πηγής άνθρακα καθώς σε αυτή την περίπτωση το οπερόνιο της λακτόζης θα εκφραζόταν συνεχώς, γεγονός ιδιαίτερα ενεργοβόρο, για όσο χρονικό διάστημα μπορούσε να παραμείνει στη ζωή το βακτηριακό κύτταρο μέχρι να εξαντληθούν τα αποθέματα ενέργειας του κυττάρου.

 

Ερμηνεία ΙΙ) . Η φράση της εκφώνησης «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.» αναφέρεται στο γεγονός ότι το βακτηριακό αυτό στέλεχος με το μεταλλαγμένο ρυθμιστικό γονίδιο έχει ήδη αναπτυχθεί και συνεχίζει να αναπτύσσεται σε θρεπτικό υλικό, το οποίο δεν διαθέτει ως πηγή άνθρακα ούτε γλυκόζη ούτε λακτόζη, αλλά υποθέτει ο μαθητής ότι περιέχει μια άλλη πηγή άνθρακα την οποία μπορεί να προμηθεύεται το βακτήριο από το θρεπτικό του υλικό.

Σε αυτή την περίπτωση διακρίνονται δυο περιπτώσεις:

περίπτωση Α). Η μετάλλαξη του ρυθμιστικού γονιδιού του οπερονίου της λακτόζης όπως περιγράφεται από την εκφώνηση του ερωτήματος και σε συνδυασμό με τα παραπάνω τμήματα του σχολικού βιβλίου που έλαβε ο μαθητής υπόψη του οδήγησε πιθανότατα σε μια πρωτεΐνη καταστολέα που είναι μη λειτουργική και αδυνατεί να αναγνωρίσει ή/και να προσδεθεί στον χείριστη του οπερονίου, οπότε το οπερόνιο της λακτόζης σε αυτή την περίπτωση θα εκφράζεται συνεχώς και θα παράγονται συνεχώς τα τρία ένζυμα που αυτό κωδικοποιεί, ανεξάρτητα από την παρουσία ή όχι λακτόζης στο θρεπτικό υλικό ανάπτυξης του βακτηρίου.

Περίπτωση Β). Η αναφερόμενη στην εκφώνηση μετάλλαξη δεν αποκλείεται να οδηγήσει σε έναν τροποποιημένο καταστολέα που μπορεί να συνδέεται στον χείριστη του οπερονίου , όμως δεν μπορεί να απομακρυνθεί από αυτόν είτε υπάρχει είτε δεν υπάρχει στο κύτταρο επαγωγέας του οπερονίου της λακτόζης. Σε αυτή την περίπτωση το οπερονιο της λακτόζης θα βρίσκεται μονίμως σε καταστολή και δεν θα παράγονται καθόλου τα ένζυμα που αυτό κωδικοποιεί.

Αυτές λοιπόν τις σκέψεις και τις παρατηρήσεις κλήθηκε να πραγματοποιήσει, προκείμενου να απαντήσει σωστά, φέτος ο υποψήφιος της θετικής κατεύθυνσης στα ερωτήματα Δ3, Δ4, Δ5!

Αξίζει να αναλογιστεί και να συνυπολογίσει κάνεις το γεγονός ότι η Βιολογία κατεύθυνσης έχει τον μεγαλύτερο συντελεστή βαρύτητας (1,3) για τις ιατρικές και τις συναφείς με τις ιατρικές σχόλες της χώρας!

Μήπως όμως δεν είναι τελικά έτσι; Μήπως η απαίτηση της επιτροπής που έβαλε τα θέματα ήταν απλώς ο μαθητής να μην ξέρει τίποτα, μα τίποτα άλλο πέρα από την στεγνή αποστήθιση του σχολικού βιβλίου και του τρόπου λύσης δυο κατηγοριών ασκήσεων χωρίς απαραίτητα να έχει πολυκαταλαβεί, διότι αν είχε καταλάβει κινδύνευε να μην απαντήσει “σωστά”;

Ας αναρωτηθεί όμως και κυρίως ας απαντήσει επισήμως και η Πανελληνία Ένωση Βιοεπιστημόνων, μελή της οποίας είναι οι θεματοδότες και οι διορθωτές των γραπτών των εξετάσεων, γιατί θα πρέπει να σιωπά όταν συμβαίνουν τέτοια πράγματα στις πανελλαδικές εξετάσεις στο μάθημα της Βιολογίας θετικής κατεύθυνσης!!!

Ποιοι είναι πιο ειδικοί για να απαντήσουν, αν όχι η επιτροπή παιδείας της Πανελληνίας Ένωσης Βιοεπιστημόνων;

Πόσα παιδιά θα τιμωρηθούν φέτος επειδή σκεφτήκαν σωστά και δεν στάθηκαν μόνο στο να αποστηθίσουν το σχολικό βιβλίο και δυο τύπους ασκήσεων ;

Πόσα παιδιά θα επιβραβευτούν φέτος επειδή το μόνο που έμαθαν στην Βιολογία θετικής κατεύθυνσης ήταν το σχολικό βιβλίο απέξω λέξη προς λέξη και τίποτα περισσότερο;

Είναι άδικο να επιβραβεύονται λαμβάνοντας ακόμα και τον ίδιο βαθμό εκείνοι οι μαθητές που απλώς μάντεψαν την απάντηση που θα ήθελε η επιτροπή, με εκείνα τα παιδιά που ανέπτυξαν κριτική σκέψη και παρατηρητικότητα και αιτιολόγησαν την απάντηση τους!

 

 

Διαγώνισμα για την Βιολογία Γενικής Παιδείας Β’ Λυκείου

ΔΙΑΓΩΝΙΣΜΑ Για την ΒΙΟΛΟΓΙΑ Β΄ΛΥΚΕΙΟΥ

ΖΗΤΗΜΑ 1ο                                                                                    25 μονάδες

Στις παρακάτω ερωτήσεις επιλέξτε τη σωστή απάντηση:

 

1) Σχετικά με την ποικιλία των διαφορετικών μονομερών, ποια βιολογικά μακρομόρια (βιοπολυμερή) είναι περισσότερο πολύπλοκα;

α) Οι πρωτεΐνες, διότι συντίθενται από 20 διαφορετικά μονομερή;

β) Τα νουκλεϊκά οξέα, διότι έχουν τεράστιο μήκος (εκατομμύρια νουκλεοτίδια) και σε αυτά συμμετέχουν πολλά διαφορετικά συστατικά (αζωτούχες βάσεις, πεντόζες, φωσφορικό οξύ).

γ) Οι πολυζακχαρίτες, διότι έχουν ρόλο δομικό ή αποθηκευτικό.

 

2) Σε μια αντίδραση συμπύκνωσης:

α) Κάθε μονομερές χάνει ένα μόριο Η2Ο.

β)  Κάθε μονομερές χάνει -Η ή -ΟΗ, οπότε αποβάλλεται συνολικά ένα μόριο Η2Ο.

γ) Τα μονομερή διασπώνται μεταξύ τους.

δ) Το κύτταρο ξοδεύει μόρια  Η2Ο.

 

3) Ποιες από τις παρακάτω χημικές ενώσεις είναι δομικό συστατικό των πρωτεϊνών;

α) ΝΗ4ΝΟ3

β) C2H5OH

γ) ΝΗ2CH2COOH

δ) C12O24O12

 

4) Προκειμένου να προκαλέσετε διάρρηξη της κυτταροπλασματικής μεμβράνης ενός κυττάρου, αυτό θα το τοποθετήσετε σε διάλυμα :

α) Ισότονο.

β) Υπέρτονο.

γ) Υπότονο.

δ) Με εξωκυττάρια συγκέντρωση Ο2 μικρότερη από την ενδοκυττάρια συγκέντρωση Ο2.

 

5) Γνωρίζοντας ότι κατά την ολοκλήρωση της πρωτεϊνοσύνθεσης όλα τα πολυπεπτίδια έχουν ως πρώτο αμινοξύ την μεθειονίνη, πόσα διαφορετικά εκατονταπεπτίδια είναι δυνατόν να υπάρξουν;

α) 20100

β) 20170

γ) 10020

δ) 2099

 

ΖΗΤΗΜΑ 2ο                                                                                   25 μονάδες

 

1)    Περιγράψτε το μοντέλο της διπλής έλικας του DNA.

2)    Ποια είναι τα μονομερή των πρωτεϊνών; Πώς συνδέονται μεταξύ τους; (σχηματικό παράδειγμα)

3)    Από ποιους παράγοντες εξαρτάται η χωροδιάταξη μιας πρωτεΐνης και ποια είναι η σημασία της τρισδιάστατης δομής μίας πρωτεΐνης, αυτή η δομή ταυτίζεται με την τριτοταγή δομή της πρωτεΐνης;

4)    Συγκρίνετε τη διάχυση με την όσμωση και την ενεργητική μεταφορά.

 

ΖΗΤΗΜΑ 3ο                                                                                                        25 μονάδες

 

α) Δύο πρωτεΐνες αποτελούνται η καθεμιά από 100 μονομερή και περιέχουν 35 φορές την ιστιδίνη, 15 φορές την γλυκίνη, 25 φορές την προλίνη, 17 φορές την κυστεϊνη και 8 φορές τη λευκίνη. Οι δύο αυτές πρωτεΐνες έχουν την ίδια μορφή και λειτουργία; Πόσες αντιδράσεις υδρόλυσης πρέπει να λάβουν χώρα, ώστε τα δύο αυτά μακρομόρια να διασπαστούν πλήρως στα μονομερή τους; Πόσα μόρια Η2Ο θα χάνει το κύτταρο;

 

β) Σε δοκιμαστικούς σωλήνες (Α,Β) που ο καθένας περιέχει υδατικό διάλυμα ενός είδους μακρομορίων ενός κυττάρου βρέθηκαν:

Στον σωλήνα Α άτομα C,H,O,N,S.

Στον σωλήνα Β άτομα C,H,O,N,Ρ.

Ποιο μακρομόριο βρίσκεται σε ποιο δοκιμαστικό σωλήνα; Πώς οδηγηθήκατε στο συμπέρασμά σας;

 

γ) Σκεφτείτε για ποιο λόγο τα γλυκά του κουταλιού δεν «χαλάνε», δεδομένου ότι υπεύθυνοι για την αλλοίωση των τροφίμων είναι οι μικροοργανισμοί.

 

 

 

ΖΗΤΗΜΑ 4ο                                                                                                              25 μονάδες

                                                                                                               

Με δεδομένο ότι οι ιοί μπορούν να έχουν ως γενετικό υλικό DNA ή RNA και το καθένα από αυτά τα μόρια μπορεί να είναι μονόκλωνο ή δίκλωνο,

α) ποιο είναι το γενετικό υλικό των παρακάτω ιών;

 

1ος ιός

2ος ιός

3ος ιός

4ος ιός

Α: 942 Α: 1001 Α: 888 Α: 755
C: 924 C: 405 C: 1214 C: 765
G: 924 G: 405 G: 1214 G: 775
T: 942 T: 111 U: 888 U: 785

 

β) Πόσους ομοιοπολικούς (φωσφοδιεστερικούς) δεσμούς και πόσους δεσμούς υδρογόνου έχει κάθε μόριο;

 

γ) Ποιου ιού το γενετικό υλικό πιστεύετε ότι είναι πιο δύσκολο να αποδιαταχθεί;

Βιολογία θετικής κατεύθυνσης και γενικής παιδείας – Τι πρέπει να προσέξω για να πετύχω!

α. Λίγο πριν από τις εξετάσεις:

1ο  θέμα

Το πρώτο θέμα συνίσταται από ερωτήσεις κλειστού τύπου, συνήθως πολλαπλής επιλογής ή σπανιότερα σωστού λάθους και ορισμένες φορές απαιτείται αιτιολόγηση της επιλογής σας.

Σε αυτό το θέμα απαντάμε σωστά όταν γνωρίζουμε άριστα την θεωρία της εξεταστέας ύλης του σχολικού βιβλίου.

Είναι σημαντικό, όταν μαθαίνουμε την θεωρία του σχολικού βιβλίου, να μην παραλείπουμε κανένα τμήμα της, ούτε τις λεπτομέρειές που αναφέρονται ακόμα και στις παρενθέσεις του κείμενου και  ειδικότερα για την Βιολογία Θετικού Προσανατολισμού, προσοχή ακόμη και στις εικόνες και στους πίνακες, ενώ τα μπλε (ή πράσινα, αναλόγως την έκδοση του σχολικού βιβλίου) πλαίσια και το ένθετο στο τέλος του σχολικού βιβλίου, περιέχουν χρήσιμες πληροφορίες, που μπορούν να φανούν πολύτιμες, όχι τόσο για το 1ο θέμα, όσο για το 3ο και το 4ο θέμα (βλέπε 3ο θέμα 2012 και  4ο θεμα 2015 Ημερησίων Λυκείων Θετικής κατεύθυνσης).

Μην Ξεχνάτε ότι έχετε και το δικαίωμα να ζητήσετε διευκρίνηση! Βεβαίως, κατά κανόνα, η απάντηση που θα δεχθείτε είναι: » όλα είναι σαφή»! Άλλα, εάν έχετε διατυπώσει το ερώτημα σας με ορθά επιχειρήματα που πηγάζουν άμεσα από την ύλη του σχολικού βιβλίου, πιθανόν να δεχθείτε ουσιαστική απάντηση, που να διευκρινίζει πραγματικά την ερώτησή σας.

2ο θέμα

Το δεύτερο θέμα συνίσταται από ερωτήσεις ανάπτυξής, που αφορούν συνήθως αυτούσια αποσπάσματά του σχολικού βιβλίου. Από το 2014 έχει εισαχθεί και ένας πίνακας αντιστοίχησης, που και πάλι όμως, απαντάται πολύ εύκολα, με βάση την γνώση αυτούσια από την θεωρία του σχολικού βιβλίου.

Συνεπώς και σε αυτό το θέμα, απαντάμε σωστά όταν γνωρίζουμε άριστα την θεωρία του σχολικού βιβλίου.

3ο θέμα

Το τρίτο θέμα συνίσταται συνήθως πριν από το 2011, από συνδυαστικές ερωτήσεις που αφορούν μια ή περισσότερες βιολογικές έννοιές ή φαινόμενα. Μέτα το 2011, αποτελείται κυρίως από ασκήσεις με περισσότερα του ενός υποερωτήματα, συνήθως από το πέμπτο κεφάλαιο ή/και από το δεύτερο κεφάλαιο, αλλά συχνά και από το έκτο κεφάλαιο ή και συνδυασμό αυτών, στην περίπτωση της Βιολογίας θετικού Προσανατολισμού.

Στην Βιολογία Γενικής Παιδείας, οι ασκήσεις του τρίτου θέματος, είναι συνήθως από την ενότητα της Ανοσοβιολογίας ή/και την Οικολογία (ροή ενέργειας ή βιογεωχημικοί κύκλοι ή/και βιοσυσσώρευση), αλλά συχνά και από την εξέλιξη (μετά το 2010, οπότε και η εξέλιξη είναι εντός ύλης).

Για να απαντήσουμε σε αυτό το θέμα, απαιτείται και πάλι άριστη γνώση της ύλης του σχολικού βιβλίου καθώς και να έχουμε κατανοήσει σε βάθος τις έννοιές και τα βιολογικά φαινόμενα που αναφέρονται σε αυτή, ώστε να είμαστε ικανοί, να συνδυάζουμε στην απάντησή μας, εκείνα τα τμήματά του σχολικού βιβλίου που αναφέρονται στην προς εξέτασή έννοια ή φαινόμενο και να αναπτύξουμε με λογική αλληλοδιαδοχή την απάντηση μας.

4ο θέμα

Το τέταρτο θέμα  είναι μια άσκηση με περισσότερα του ενός υποερωτήματα.

Κατά κανόνα αφορά συνηθέστερα  την ύλη του 2ου και του 5ου κεφαλαίου, αλλά και σπανιότερα του 6ου ή του 4ου κεφαλαίου, αλλά συχνά αποτελεί και συνδυασμό ορισμένων από αυτά τα κεφάλαια. Ελάχιστες φορές μόνο, από το 2000 μέχρι και το 2015, υπήρχε ερώτημα που αφορούσε το 8ο κεφάλαιο, ενώ ποτέ δεν υπήρξε ερώτημα από το 1ο το 7ο και το 9ο κεφάλαιο (στα Ημερήσια Λύκεια)  της Βιολογίας θετικού προσανοτολισμού.

Στην Βιολογία Γενικής Παιδείας, οι ασκήσεις του 4ου  θέματος, είναι συνήθως από την ενότητα της Ανοσοβιολογίας ή/και την Οικολογία (ροή ενέργειας ή βιογεωχημικοί κύκλοι ή/και βιοσυσσώρευση), αλλά συχνά και από την εξέλιξη (μετά το 2010, οπότε και η εξέλιξη είναι εντός ύλης).

Για να λύσουμε το θέμα αυτό, χρειάζεται όχι μόνο άριστη γνώση της θεωρίας άλλα και των τύπων των ασκήσεων που βρίσκονται στο σχολικό βιβλίο. Η απάντησή μας πρέπει να περιλαμβάνει τον ορισμό των εννοιών ή των βιολογικών φαινομένων που εξετάζονται από την άσκηση καθώς και την μετά από λογική αλληλουχία συλλογισμών, απόδειξή του ζητουμένου (ομοίως όπως και στο τρίτο θέμα).

Το τέταρτο θέμα συνεπώς, απαιτεί αναλυτική και συνθετική ικανότητά από τον μαθητή προκείμενου να απαντηθεί σωστά, επομένως θα πρέπει να εστιάσετε την προσοχή σας στην κατανόηση της θεωρίας και στην γνώση της μεθοδολογίας για την λύση των ασκήσεων.

Μην ξεχνάτε!

Στο μάθημά της Βιολογίας, σπουδαίο ρολό παίζει η σωστή και πολύ προσεκτική διατύπωση, ιδιαίτερα καθώς μια λέξη ή ακόμη και ένα γράμμα (π. χ. DNA αντί για RNA στη μεταγραφή ή στο γενετικό υλικό του ιού HIV) είναι δυνατό να οδηγήσει σε εσφαλμένη απάντηση.

Οι απαντήσεις μας πρέπει να διέπονται από ακρίβειά και σαφήνεια!

Δεν είναι αναγκαία η πίστη αναπαραγωγή τμημάτων του σχολικού βιβλίου, εφόσον ο μαθητής είναι ικανός να διατυπώσει την απάντησή του με λόγο ορθά επιστημονικό και η απάντησή του είναι πλήρης, καλύπτοντας τουλάχιστον όσα αναφέρει το σχολικό βιβλίο για όσα ζητούνται από την ερώτησή.

Οι απαντήσεις πρέπει να περιορίζονται εντός των πλαισίων της εξεταστέας ύλης του σχολικού βιβλίου. Ενίοτε, τα δεδομένα της άσκησης μπορεί να έρχονται σε αντίθεση με την γνώση του σχολικού βιβλίου!!! (βλέπε θέματα Ημερησίων Λυκείων 2014-2015 4ο θέμα Βιολογία Θετικής κατεύθυνσης), ακόμη  και σε αυτή την περίπτωση, οι απαντήσεις πρέπει να περιοριορίζονται εντός της εξεταστέας ύλης από το σχολικό εγχειρίδιο, επισημαίνοντας τα τμήματα του σχολικού βιβλίου που υποστηρίζουν την απάντηση σας ακόμα και αν έρχονται σε διάσταση, με τα ατυχώς δοσμένα δεδομένα της ερώτησης-άσκησης.

 

β. Κατά την διάρκειά των εξετάσεων:

1.  Διαβάζουμε προσεκτικά όλα τα θέματα και επιλέγουμε να ξεκινήσουμε να απαντάμε από εκείνα που γνωρίζουμε καλύτερα. Όσα μας δυσκολεύουν τα αφήνουμε τελευταία.

2.  Όταν ξεκινήσουμε να απαντάμε μια ερώτηση, την διαβάζουμε πολύ προσεκτικά ώστε να προσέξουμε όλες τις λεπτομέρειές της και βρισκόμαστε σε διαρκή επαφή μαζί της (διαβάζοντάς την ξανά και ξανά) ώστε να μη μας διαφύγει τίποτα από όσα ζητούνται, αλλά και να έχουμε κατανοήσει και συγκρατήσει καλά στην μνήμη μας κάθε λεπτομέρεια από τα δεδομένα. Όταν τελειώσουμε την απάντησή μας, ξαναδιαβάζουμε την ερώτηση και την απάντησή μας, ελέγχοντας ότι δεν έχουμε παραλείψει κανένα υποερώτημα και διορθώνουμε τυχόν λάθη μας.

3.  Οι απαντήσεις μας ως προς το περιεχόμενό τους:

  • Φροντίζουμε να είναι πλήρεις εξαντλώντας όλα τα στοιχεία που ζητούνται και τα οποία είναι δυνατόν να βρίσκονται σε διαφορετικά σημεία του βιβλίου.
  • Στο πρόβλημα πρέπει να αναπτύξουμε με σαφήνεια όλες τις πιθανές περιπτώσεις που είναι δυνατόν να υπάρχουν.

4.  Οι απαντήσεις μας ως προς την έκφρασή τους:

Φροντίζουμε να χαρακτηρίζονται από ακρίβεια και σαφήνεια ενώ κάθε μας σκέψη πρέπει να απορρέει λογικά από την προηγούμενη ώστε στο κείμενο να υπάρχει λογική αλληλουχία.

5.  Πριν παραδώσουμε το γραπτό μας είναι απαραίτητο να διαβάσουμε τουλάχιστον άλλη μια φορά τα θέματα και να εξετάσουμε πολύ σχολαστικά τις απαντήσεις μας  σε συσχετισμό με τις ερωτήσεις.

Εύχομαι επιτυχία και ανταμοιβή των κόπων σας !!!

 

Διαγώνισμα προσομοίωσης Βιολογίας Θετικού Προσανατολισμού 2012

Ζήτημα 1ο
Μονάδες 25
Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω προτάσεις 1-5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Επίσης να απαντήσετε σύντομα στις ερωτήσεις που ακολουθούν.
1. Οι «λείες» αποικίες των βακτηρίων στο πείραμα του Griffith το 1928, ξεχωρίζουν μορφολογικά από τις αποικίες του στελέχους που σχημάτιζε «αδρές» αποικίες
α. λόγω της ιδιότητάς τους να σκοτώνουν τα ποντίκια.
β. λόγω της παρουσίας ενός προστατευτικού καλύματος στα βακτήρια των λείων αποικιών.
γ. διότι οι αποικίες είναι ορατές με γυμνό οφθαλμό.
δ. όλα τα παραπάνω.
Μονάδες 2
Τι ορίζουμε ως αποικία;
Μονάδες 3
2. Κατά την επιμήκυνση της πρωτεϊνοσύνθεσης:
α. δημιουργείται το σύμπλοκο mRNA-μικρή υπομονάδα ριβοσώματος-tRNAmet.
β. σχηματίζεται ο πρώτος πεπτιδικός δεσμός του συγκεκριμένου μορίου της πεπτιδικής αλυσίδας.
γ. το tRNA κινείται κατά ένα κωδικόνιο κατά μήκος του mRNA.
δ. το mRNA μετακινείται κατά ένα κωδικόνιο κάθε φορά.
Μονάδες 2
Τι ορίζουμε ως κωδικόνιο, ποια μόρια νουκλεϊκών οξέων αφορά;
Μονάδες 3
3. Η ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA έγινε εφικτή, λόγω
α. της απομόνωσης των περιοριστικών ενδονουκλεασών καθώς και ειδικών φορέων που μεταφέρουν DNA από κύτταρο σε κύτταρο.
β. της ανάπτυξης της Γενετικής Μηχανικής και της ανάπτυξης των μορίων ανιχνευτών.
γ. της απομόνωσης και χρήσης ενζύμων που παρέχουν την δυνατότητα της in vitro «αναπαραγωγής» των διαδικασιών αντιγραφής, αντίστροφης μεταγραφής και μετάφρασης.
δ. λόγω των επιλογών α και γ.
Μονάδες 2
Πότε ένα μόριο DNA είναι ανασυνδυασμένο; Πώς γίνεται δυνατή η αναπαραγωγή και η διαιώνιση αυτού του μορίου DNA;
Μονάδες 3
4. Η φαινοτυπική αναλογία 3 : 1
α. εμφανίζεται πάντοτε στην F2 γενεά κατά τις διασταυρώσεις μονοϋβριδισμού.
β. εμφανίζεται μόνο κατά τις διασταυρώσεις μονοϋβριδισμού μεταξύ ετερόζυγων ατόμων με το ίδιο ζεύγος αλληλόμορφων για κάθε άτομο.
γ. είναι δυνατό να εμφανίζεται τόσο κατά της διασταυρώσεις μονοϋβριδισμού όσο και κατά τις διασταυρώσεις διϋβριδισμού.
δ. εμφανίζεται πάντα κατά τις διασταυρώσεις μεταξύ ετερόζυγων ατόμων σε διασταυρώσεις μονοϋβρισισμού.
Μονάδες 2
Τι πληροφορίες μας προσφέρουν τα γενεαλογικά δένδρα;
Μονάδες 3
5. Ποια από τα παρακάτω δεν είναι μεταλλαξογόνοι παράγοντες στο σύνολό τους;
α. Οι ακτινοβολίες γ, α, Χ και η ηλιακή ακτινοβολία.
β. Η φορμαλδεΰδη, το βενζοπυρένιο (κυκλικός αρωματικός υδρογονάνθρακας).
γ. Η φαινυλαλανίνη, οι πουρίνες και ΑΑΤ.
δ. Η πενικιλλίνη, η καφεΐνη και η αιθυλική αλκοόλη. Μονάδες 2
Τι είναι ο καρκίνος; Ποιες κατηγορίες γονιδίων ευθύνονται για τον καρκίνο;
Μονάδες 3
Ζήτημα 2ο
Μονάδες 25
Να απαντήσετε στις παρακάτω ερωτήσεις.
1. Οι αρχικές μελέτες της ρύθμισης των γονιδίων έγιναν το 1961 από τους γάλλους επιστήμονες Jacob και Monod. Με τις μελέτες αυτές ανακαλύφθηκε ο τρόπος με τον οποίο το βακτήριο E.coli λύνει το πρόβλημα της τροφοδότησής του με άνθρακα και ενέργεια όταν αναπτύσσεται σε περιβάλλον με μοναδικό υδατάνθρακα την λακτόζη. Τι απέδειξαν οι ερευνητές για τη λειτουργία του βακτηρίου E.coli σε τέτοιο περιβάλλον;
Μονάδες 5
2. Το 1953 περιγράφηκε η δευτεροταγής δομή του DNA στους οργανισμούς. Περιγράψτε τα χαρακτηριστικά αυτής της δομής. Μονάδες 5
3. Ποια είναι τα απαραίτητα βήματα για την εργαστηριακή καλλιέργεια των μικροοργανισμών; Μονάδες 5
4. Το 1997 έγινε δυνατή η κλωνοποίηση ενός εξάχρονου πρόβατου. Περιγράψτε τα βήματα που ακολουθήθηκαν και αναφέρεται ποιες μπορεί να είναι οι προοπτικές της κλωνοποίησης.
Μονάδες 5
5. Ποιες δυνατότητες προσφέρει η αλληλουχία του ανθρώπινου γονιδιώματος στους τομείς της μελέτης της οργάνωσης και λειτουργίας του και στην ανάπτυξη μεθοδολογίας για τη διάγνωση και τη θεραπεία των ασθενειών.
Μονάδες 5
Ζήτημα 3ο
Μονάδες 25
Στο παρακάτω γενεαλογικό δένδρο μελετάται η ασθένεια του αλφισμού.


α. Να βρεθούν οι δυνατοί γονότυποι όλων των ατόμων της γενεαλογίας.
Μονάδες 8
β. Το ζευγάρι IV1 και IV2 πρόκειται να αποκτήσουν και τέταρτο παιδί. Με ποια πιθανότητα αυτό θα είναι αγόρι με φαινότυπο με πολύ ήπια συμπτώματα ή θα είναι κορίτσι που θα νοσεί από αλφισμό με φαινότυπο όμοιο με αυτό της δεύτερης αδελφής του;
Μονάδες 8
γ. Τι γνωρίζεται για την ασθένεια του αλφισμού; Τι σημαίνει ετερογένεια σε φαινοτυπικό επίπεδο και πώς ερμηνεύεται σε γονοτυπικό επίπεδο;
Μονάδες 9
Ζήτημα 4ο
Μονάδες 25
Οι παρακάτω αλληλουχίες DNA αφορούν τον γενετικό τόπο του γονιδίου που ελέγχει για την ασθένεια του αλφισμού. Η πρώτη αλληλουχία συνιστά το φυσιολογικό επικρατές αλληλόμορφο του γονιδίου.
α. Να εντοπίσετε την μετάλλαξη που έχει συμβεί σε καθένα από τα παθολογικά αλληλόμορφα που σας δίνονται.
Μονάδες 4
β. Να υποδείξετε, σύμφωνα με τη μετάλλαξη που φέρει κάθε αλληλόμορφο, ποιο αναμένεται να ευθύνεται:
Μονάδες 4
i. για την παντελή έλλειψη ενεργότητας του ενζύμου.
ii. για την πολύ περιορισμένη ενεργότητα του ενζύμου.
iii. για περιορισμένη ενεργότητα του ενζύμου.
iv. για τη μικρή αλλαγή στην στερεοδιάταξη του ενζύμου.
γ. Ποια είναι υποθετικά η φυσιολογική πρωτοταγή δομή του ενζύμου στο τμήμα που σας δίνεται;
Μονάδες 4
δ. Οι επιστήμονες ενδιαφέρονται να αναπτύξουν γονιδιακή θεραπεία για τον αλφισμό.
i. Ποιες είναι οι απαραίτητες προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας;
Μονάδες 7
ii. Ποια μέθοδο θα πρέπει να ακολουθήσουν ex vivo ή in vivo; Να αιτιολογήσετε την απάντησή σας.
Μονάδες 6
(Μεταξύ των σημείων Χ και Υ περιέχονται τα κωδικόνια που κωδικοποιούν για τα αμινοξέα του ενεργού κέντρου του ενζύμου.)

Print
Δίνονται τα κωδικόνια:

ATG -> Met

AAA -> Lys

TTT -> Phe

GAG -> Glu

CCC -> Pro

GAA -> Glu

TCA -> Ser

AGA -> Arg

TCC -> Ser

TTG -> Leu

Καλή Επιτυχία!