Αρχείο κατηγορίας Uncategorized

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ 2018 (Β)

ΖΗΤΗΜΑ 1Ο

 Α. Επιλέξτε τη σωστή επιλογή που συμπληρώνει σωστά την πρόταση.

(μονάδες 20)

1) Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά τις ομάδες αίματος στο σύστημα ΑΒΟ του ανθρώπου:

2017 Διαγώνισμα προσομοίωσης Β-01

Τα άτομα της ΙΙΙ γενεάς έχουν φαινοτύπους:

α) Ο, Α, Β, Ο, Ο με πιθανότητα  (1/4)3 x(1/2) 2

β) Ο, Β, Ο, Α, Α με πιθανότητα  4 x(1/4)

γ) Ο, Α, Β, Ο, Α με πιθανότητα   1/4 x 1/4 x 1/4 x 1/4 x 1/4 x 1/4

δ) Ο, Ο, Ο, Ο, Ο με πιθανότητα  1 –  1023/1024

ε) Τίποτα από τα παραπάνω.

 

2) Δίνεται η παρακάτω υποθετική αλληλουχία του ενός κλώνου (κωδική

 

) γονιδίου που κωδικοποιεί για tRNA.

 

ΥΠΟΚΙΝΗΤΗΣ                   ΕΣΩΝΙΟ                     ΕΣΩΝΙΟ                        ΑΛΜ

ATCGCCTTAACCTACTACGCCTATACTATTCTATCCCCGCTATCTCATTCCTTT

—————-                    —————-                        ————                 ————-

Ποια είναι η αλληλουχία του ώριμου μεταγραφήματος;

α) Ομοίως με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

β) Συμπληρωματική με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

γ) Όμοια με την παραπάνω χωρίς τον υποκινητή και τα εσώνια αποτελούμενη από ριβονουκλεοτίδια.

δ) Συμπληρωματική με την παραπάνω χωρίς τον υποκινητή, τα εσώνια και τις ΑΛΜ αποτελούμενη από ριβονουκλεοτίδια.

ε) Τίποτα από τα παραπάνω.

3) Ένα άτομο προσήλθε στο νοσοκομείο και μετά από βιοχημικές εξετάσεις διαπιστώθηκε ότι έχει αυξημένα επίπεδα HbA2 και ήταν μολυσμένο από το πλασμώδιο. Το άτομο αυτό:

α) Νοσεί από δρεπανοκυτταρική αναιμία.

β) Νοσεί από β-θαλασσαιμία.

γ) Νοσεί από λοιμώδες νόσημα (ελονοσία).

δ) Είναι φορέας μίας γενετικής νόσου και δεν κινδυνεύει να πεθάνει από ελονοσία.

ε) Είναι φορέας δύο ασθενειών, της δρεπανοκυτταρικής αναιμίας (γενετική νόσος) και της ελονοσίας (λοιμώδης).

4) Ο καρκίνος είναι ένα γενετικό νόσημα που οφείλεται κατά κανόνα σε:

α) Έλλειψη πρωτοογκογονιδίων και υπερλειτουργία ογκοκατασταλτικών.

β) Έλλειψη ογκοκατασταλτικών και υπερλειτουργία πρωτοογκογονιδίων.

γ) Έλλειψη επιδιορθωτικών ενζύμων και υπερέκφραση ογκοκατασταλτικών γονιδίων.

δ) Λάθη που γίνονται κατά τη μείωση και τη μίτωση και οδηγεί σε ανευπλοειδία.

ε) Τίποτα από τα παραπάνω.

5) Στο βακτήριο E.coli η φυσιολογική έκφραση του ρυθμιστικού γονιδίου του οπερονίου της λακτόζης (υποθετικά) έχει ρυθμό 20 μόρια καταστολέα/24h και ρυθμό αποικοδόμησης καταστολέων 10 μόρια καταστολέα/24h όταν το βακτήριο αναπτύσσεται σε περιβάλλον με 100% γλυκόζη. Ένα βακτήριο που αναπτύσσεται σε περιβάλλον γλυκόζης και λακτόζης μετράται η παραγωγή των mRNA που κωδικοποιούνται από το οπερόνιο της λακτόζης.

2017 Διαγώνισμα προσομοίωσης Β-02

Στις χρονικές στιγμές t1, t2, t3 αντιστοίχως έχουμε μορια mRNA οπερονιου της λακτόζης:

α) 10 μόρια,     100 μόρια,        0 μόρια

β) 0 μόρια,       100 μόρια,        100 μόρια

γ) 10 μόρια,     100 μόρια,        100 μόρια

δ) 100 μόρια,   1000 μόρια,      0 μόρια

ε) Τίποτα από τα παραπάνω

Β. Χαρακτηρίστε ως Σ (Σωστή) ή Λ (Λανθασμένη) την καθεμία από τις παρακάτω προτάσεις:

α) Ένα πείραμα in vivo είναι το πείραμα δημιουργίας αμιγών στελεχών του Mendel.

β) Η Τρισωμία 21 (μη διαχωρισμός του 21ο χρωμοσώματος) έχει περισσότερες πιθανότητες να εμφανιστεί κατά τη μείωση σε σχέση με οποιαδήποτε άλλη τρισωμία του ανθρώπου.

γ) Για τα γονίδια α των αιμοσφαιρίνων ισχύουν οι νόμοι του Mendel.

δ) Ένα θηλυκό άτομο έχει όλα του τα γονίδια σε δύο αντίγραφα, ένα αρσενικό άτομο όχι.

ε) Το ρετινοβλάστωμα είναι μορφή καρκίνου που ελέγχεται μονογονιδιακά.

στ) Υπάρχει γονίδιό μας που γι’ αυτό υπάρχουν εκατοντάδες αντίγραφά του σε ένα μας κύτταρο.

ζ) Το ίδιο προϊόν ζύμωσης μπορεί να παράγεται από τον ίδιο μικροοργανισμό σε μεγάλες ποσότητες, τόσο στην εκθετική όσο και στη στατική.

η) Οι στόχοι της Ιατρικής είναι με τη σειρά: Η πρόληψη, η διάγνωση και η θεραπεία.

θ) Για τη δημιουργία των Βt φυτών δημιουργήθηκε cDNA βιβλιοθήκη του B. thurigiensis.

ι) Τα προϊόντα της ζύμωσης μπορεί να είναι ζωντανά ή νεκρά κύτταρα ή προϊόντα ζωντανών κυττάρων.

 

ΖΗΤΗΜΑ 2Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α. Δίνεται ο παρακάτω πίνακας. Να πραγματοποιηθούν όλες οι πιθανές αντιστοιχίσεις.

                                                            (μονάδες 5)

ΣΥΜΠΛΗΡΩΜΑΤΙΚΟΤΗΤΑ
1.     ΠΡΩΤΑΡΧΙΚΟ ΤΜΗΜΑ RNA Α. in vivo
2.     ΣΥΝΔΕΣΗ ΜΕΤΑΓΡΑΦΙΚΩΝ ΠΑΡΑΓ.
3.     ΔΗΜΙΟΥΡΓΙΑ 3΄       5΄ Ρ-ΔΕΣΜΩΝ B. in vitro
4.     ΣΥΝΔΕΣΗ ΚΟΛΛΩΔΩΝ ΑΚΡΩΝ
5.     ΙΧΝΗΘΕΤΗΜΕΝΟΣ ΑΝΙΧΝΕΥΤΗΣ Γ. ΤΙΠΟΤΑ ΑΠΟ ΤΑ ΠΑΡΑΠΑΝΩ

Β. 1) Ποιο θα είναι το αποτέλεσμα στην πρωτεΐνη που παράγεται σε προκαρυωτικό κύτταρο, αν στο γονίδιο που την κωδικοποιεί γίνει αντικατάσταση μίας βάσης;

(μονάδες 8)

2) Με ποιον από τους παρακάτω τρόπους θα μπορούσε να προκύψει ένα μηρυκαστικό ζώο το οποίο να παράγει τον πηκτικό παράγοντα ΙΧ στο γάλα του:

α) Με τη μέθοδο των επιλεκτικών διασταυρώσεων.

β) Με μεθόδους Γενετικής Μηχανικής.                                                    (μονάδες 2)

Αιτιολογήστε την απάντησή σας.                                                            (μονάδες 5)

3) Να αναφέρετε τα πλεονεκτήματα παραγωγής ανθρώπινης αυξητικής ορμόνης με μεθόδους Γενετικής Μηχανικής σε σχέση με την εξαγωγή της από πτώματα.

(μονάδες 5)

ΖΗΤΗΜΑ 3Ο

Α. Η Ράνια και η Αρεθα είναι δύο φίλες που ταξίδεψαν στο Περού πριν από μερικά χρόνια. Κατά το ταξίδι τους στα υψίπεδα των Άνδεων, εμφάνισαν συμπτώματα αναιμίας και μεταφέρθηκαν στο τοπικό νοσοκομείο, όπου και διαγνώστηκαν φαινοτυπικα ως ετεροζυγες για κάποιο παθολογικό αλληλόμορφο του γενετικού τόπου, όπου εδράζεται το γονίδιο της β σφαιρινης στο 11 χρωμόσωμα μας. Τα γονίδιά της α σφαιρινης εδράζονται στο 16ο χρωμόσωμα μας.

Μετά από βιοχημικές και μοριακές εξετάσεις στην Ελλάδα αποδείχθηκε ότι η Ράνια είναι φορέας της δρεπανοκυτταρική αναιμίας και η Αρεθα της μεσογειακής αναιμίας.

Παρακάτω φαίνεται το γενεαλογικό δένδρο των οικογενειών που δημιούργησαν οι δυο φίλες.

 2018 διόρθωση-01

Το άτομο ΙΙ3 νοσεί από δρεπανοκυτταρική αναιμία και το άτομο ΙΙ6 νοσεί από μεσογειακή αναιμία. Είναι γνωστό ότι τα άτομα ΙΙ8, ΙΙΙ7, ΙV6 είναι ομόζυγα φυσιολογικά για την μεσογειακή αναιμία και το άτομο ΙΙ1 είναι επίσης ομόζυγο φυσιολογικό για το γονίδιο β, ενώ ένα μόνο από τα άτομα ΙΙΙ2, ΙV2, V2 είναι ετεροζυγο για το γονίδιο βς.

Το άτομο VII1 γεννήθηκε με μίκροδρεπανοκυττταρική αναιμία.

α. Εάν υποθέσουμε ότι τα σχολικά εγχειρίδια στο Περού, κάνουν αναφορά στην δρεπανοκυτταρική αναιμία και την μεσογειακή αναιμία, με ποιο τρόπο κληρονόμησης νομίζετε ότι θα αναφέρουν ότι κληρονομούνται οι ασθένειες αυτές; (μονάδες 2)

β. Ποιά ήταν οι πιθανότητα, οι δυο φίλες να αποκτήσουν τον απόγονο VII1, που νοσεί από μίκροδρεπανοκυττταρική αναιμία, όπως προκύπτει από το γενεαλογικό δένδρο ; (5)

γ. Το ζευγάρι VI1, VI2, πρόκειται να αποκτήσει και δεύτερο παιδί. Το ζευγάρι ζήτησε γενετική καθοδήγηση για το ποιό είναι το ενδεχόμενο να αποκτήσει υγιές κορίτσι,  φορέα της δρεπανοκυτταρική αναιμίας ή υγιές αγόρι, φορέα της μεσογειακής αναιμίας ή υγιές κορίτσι ομόζυγο για το φυσιολογικό γονίδιο β1 ή υγιές αγόρι φορέα της δρεπανοκυττταρικής αναιμίας.

Τι τους απάντησε ο γενετιστής πριν και μετά τις μοριακές εξετάσεις για το γονίδιο β στο έμβρυο. Οι γονείς δεν θέλησαν ωστόσο να μάθουν το φύλο του δεύτερου παιδιού τους πριν την γέννηση του.(6)

Η μοριακή εξέταση έγινε με μια περιοριστική ενδονουκλεαση που πέπτει το αλληλόμορφο βς και το β όχι. Επίσης αποδείχθηκε ότι το παθολογικό αλληλόμορφο β1 για την μεσογειακή αναιμία έχει πάθει έλλειψη 25 ζ.β εντός της 5´ αμεταφραστής περιοχής του.

δ. Για ποιο λόγο η αναιμία, που προκαλείται από το αλληλόμορφο β1, αλλά και διάφορα άλλα παθολογικά αλληλόμορφα του γενετικού τόπου της β σφαιρίνης, που οδηγούν σε ελάττωση της φυσιολογικής ποσότητας της HbA ονομάζεται μεσογειακή αναιμία ; (3)

ε. Είναι γνωστό ότι το γονίδιο για την α σφαιρίνη εδράζεται στο 16 χρωμόσωμα μας, και αυτός ο γενετικός τόπος είναι διπλός, διαδοχικά ο ένας μετά τον άλλο. Ο γενετικός τόπος δε, 16p13.2 (πάνω) εκφράζεται με μικρότερο ρυθμό ( υποθετικά στο μισό) σε σχέση με τον γενετικό τόπο του α γονιδίου 16p13.1(κάτω). Εάν υποθέσουμε ότι ο πρώτος γενετικός τόπος φέρει γονίδιο α που εκφράζεται και παράγει 50 μοναδες των αλυσίδων α, τότε ο δεύτερος θα παράγει 100 μονάδες από α σφαιρίνες.

Ένα παιδί του ζευγαριού IV1, IV2, που και οι δυο είναι υγιείς, παντρεύτηκε και απέκτησε δύο παιδιά. Το πρώτο παράγει 200 μονάδες αλυσίδων α και νοσεί από δρεπανοκυτταρική αναιμία, ενώ το δεύτερο παιδί του παράγει 250 μονάδες αλυσίδων α και σε συνθήκες υποξύας εμφανίζει συμπτώματα αναιμίας και δεν παράγει καθόλου HbA2.

Ποιοί είναι οι γόνοτυποι των γονέων των δυο αυτών παιδιών για την α θαλασσαιμία; (2)

Με ποιά πιθανότητα, οι γονείς αυτοί, μπορούν να αποκτήσουν παιδί που θα παράγει 250 μονάδες α σφαιρίνων και θα παράγει περίπου 3% HbA2, ενώ θα νοσεί και από μικροδρεπανοκυττταρική αναιμία; (2)

Β. Το γονίδιο lux της πυγολαμπίδας ενθέτεται σε έναν πλασμιδιακό φορέα κλωνοποίησης που φέρει γονίδιο ανθεκτικότητας στην τετρακυκλίνη (tetR), το οποίο με τη σειρά του φέρει θέση αναγνώρισης από την EcoRI, καθώς και το γονίδιο lacZ του οπερονίου της λακτόζης:

α) Εξηγήστε αν τα κύτταρα-ξενιστές που δέχθηκαν τον ανασυνδυασμένο φορέα κλωνοποίησης θα εμφανίζουν βιοφωταύγεια. (μονάδες 3)

β) Ποια ιδιότητα πρέπει να χαρακτηρίζει τα κύτταρα-ξενιστές (E.coli) ώστε να μπορεί να γίνει η επιλογή των μετασχηματισμένων με το ανασυνδυασμένο.   (μονάδες 2)

ΖΗΤΗΜΑ 4Ο

Α. Τα αλληλόμορφα α+, β+, γ+ και δ+ είναι ανεξάρτητα μεταξύ τους και ελέγχουν το σχηματισμό μαύρου χρώματος σε ένα ζώο. Τα αλληλόμορφα α, β, γ, δ είναι τα υπολειπόμενα τα οποία δεν εκφράζονται.

     Ένα μαύρο άτομο που είναι καθαρή σειρά διασταυρώθηκε με ένα λευκό άτομο και στην F1 γενεά όλοι οι απόγονοι ήταν μαύροι. Στη συνέχεια διασταυρώθηκαν τα άτομα της F1 γενεάς.

Γνωρίζετε ότι το μεταβολικό μονοπάτι είναι:

α+                                β+                             γ+                            δ+

ΛΕΥΚΟ    —>      ΛΕΥΚΟ     —>     ΛΕΥΚΟ   – –>       ΚΑΦΕ    —>     ΜΑΥΡΟ

α) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΛΕΥΚΟ;

β) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΚΑΦΕ;                (μονάδες 5)

Β. Στο βακτήριο E.coli υπάρχει μία πρωτεΐνη με φυσιολογικό αμινοτελικό άκρο:                                         H2N – Met – Val – Ser – Ser – Pro – Met – Gly – Ala – Ala – Met – Ser …

Μία μετάλλαξη προκάλεσε αλλαγή στο αντικωδικόνιο ενός μορίου t

RNA  από 5΄- GAU – 3΄ σε 5΄- CAU – 3΄. Ποιο/α μπορεί να είναι τα πιθανά αμινοτελικά άκρα αυτής της πρωτεΐνης στα μεταλλαγμένα κύτταρα E.coli;               (μονάδες 5)

Γ. Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά την ασθένεια της μυοτονικής δυστροφίας.

2017 Διαγώνισμα προσομοίωσης Β-05

 

Η μυοτονική δυστροφία εμφανίζεται με βαθμιαία σοβαρότερα συμπτώματα από γενεά σε γενεά. Για να εξηγηθεί αυτή η παρατήρηση πραγματοποιήθηκαν μοριακές εξετάσεις στα άτομα Ι2, ΙΙ2 και ΙΙΙ2.

Οι αναλύσεις αυτές έδειξαν ότι ο ιχνηθετημένος ανιχνευτής 5΄CTGCTGCTGCTGCTG 3΄ υβρίδισε στο άτομο Ι2 10 φορές με το άτομο ΙΙ2 300 φορές και με το άτομο ΙΙΙ2 2000 φορές.

α) Ποια διασταύρωση του δοθέντος γενεαλογικού δέντρου αποδεικνύει τον τρόπο κληρονόμισης της ασθένειας; Ποιος είναι ο τύπος κληρονομικότητας;

(μονάδες 2)

β) Τα αποτελέσματα των μοριακών εξετάσεων σε ποιο συμπέρασμα οδηγούν για την αιτία της αυξανόμενης σοβαρότητας των συμπτωμάτων της ασθένειας από γενεά σε γενεά;

(μονάδες 3)

γ) Οι ανιχνευτές υβριδίζουν στην περιοχή της 3΄ αμετάφραστης περιοχής του υπεύθυνου για την ασθένεια γονιδίου. Ποιο από τα τρία διαφορετικά είδη κλωνοποίησης του γονιδίου αυτού μπορούν να χρησιμοποιήσουν οι επιστήμονες; Αιτιολογήστε με συντομία την απάντησή σας.

(μονάδες 3)

δ) Πώς ονομάζονται τα γονίδια που ευθύνονται για την ασθένεια στα άτομα Ι2, ΙΙ2 και ΙΙΙ2;

(μονάδα 1)

ε) Προτείνετε ένα πιθανό τύπο μετάλλαξης που μπορεί να εξηγήσει το διαφορετικό μέγεθος της 3΄ αμετάφραστης περιοχής του υπεύθυνου γονιδίου από γενεά σε γενεά εάν γνωρίζετε ότι είναι αποτέλεσμα μηχανισμού κατά τη διάρκεια του κυτταρικού κύκλου.

(μονάδα 1)

στ) Οι επιστήμονες θέλουν να ενθέσουν σε φορείς έκφρασης (πλασμίδια) τα γονίδια που ευθύνονται για την ασθένεια των ασθενών ατόμων της γενεαλογίας που σας δίνεται. Δίνεται ο περιοριστικός χάρτης του γονιδίου και δύο διαφορετικοί φορείς κλωνοποίησης. Ποια/ες περιοριστικές ενδονουκλεάσες θα χρησιμοποιήσουν οι επιστήμονες ώστε να εξασφαλίσουν των έκφραση των γονιδίων;

2017 Διαγώνισμα προσομοίωσης Β-06

2017 Διαγώνισμα προσομοίωσης Β-07

  1. Ποιος από τους δύο φορείς έκφρασης θα χρησιμοποιηθεί;
  2. Εξηγήστε για ποιο λόγο ο φυσικός Υ1 του γονιδίου της AmpR είναι ο κατάλληλος για την έκφραση του ανθρώπινου γονιδίου στο βακτήριο ξενιστή.

(μονάδες 5)

‘Υλη Βιολογίας Ομάδας Θετικού Προσανατολισμού, ποια είναι άραγε;

ΝΙΚΟΛΕΤΤΑ ΜΑΡΓΑΡΙΤΗ

Με αφορμή το ΦΕΚ 2893/2017 αρ. 134932/Δ2 σχετικά με την εξεταστέα ύλη, για τις εξετάσεις εισαγωγής στην Τριτοβάθμια Εκπαίδευση, του μαθήματος της Βιολογίας Θετικού Προσανατολισμού, από το οριζόμενο στο παραπάνω ΦΕΚ σχολικό εγχειρίδιο για το μάθημα αυτό.

Πιο συγκεκριμένα εντός εξεταστέας ύλης είναι;

Α) Ολόκληρο το κείμενο για τα κεφάλαια 1,2,4,5,6 και 9 ενώ για τα κεφάλαια 8 και 7 είναι το σύνολο του κειμένου των δύο αυτών κεφαλαίων με εξαίρεση τις εκτός εξεταστέας ύλης παραγράφους τους (μία για το 7ο κεφάλαιο «Η παραγωγή της Πενικιλίνης αποτελεί σημαντικό σταθμό στην πορεία της Βιοτεχνολογίας» και δύο για το 8ο κεφάλαιο «Εμβόλια, αντιβιοτικά»).

Β) Εντός εξεταστέας ύλης είναι όλες οι εικόνες του κάθε κεφαλαίου, με εξαίρεση όσες αφορούν τις εκτός ύλης παραγράφους των κεφαλαίων 7 και 8, ανεξαρτήτως του χρωματικού πλαισίου που περιβάλλει την κάθε εικόνα. Ενώ εντός ύλης προς εξέταση είναι και οι λεζάντες των εικόνων των παραπάνω κεφαλαίων. Όταν οι εικόνες παρουσιάζουν χημικούς τύπους τότε δεν απαιτείται η απομνημόνευση αυτών.

Γ) Είναι εντός εξεταστέας ύλης τα τμήματα του καθενός από τα παραπάνω κεφάλαια με τίτλο «Ταξίδι στο χρόνο».

Δ) Είναι εντός εξεταστέας ύλης η περίληψη που υπάρχει στο τέλος καθενός από τα παραπάνω κεφάλαια.

Ε) Είναι εντός εξεταστέας ύλης, οι εργασίες – δραστηριότητες σε οποιοδήποτε από τα παραπάνω κεφάλαια.

ΣΤ) Είναι εντός ύλης οι πίνακες που υπάρχουν σε καθένα από τα παραπάνω κεφάλαια.

Ζ) Είναι εντός εξεταστέας ύλης, οι ερωτήσεις στο τέλος κάθε κεφαλαίου.

Η) Είναι εντός εξεταστέας ύλης, τα τμήματα των παραπάνω κεφαλαίων με τίτλο «σκεφτείτε» σε οποιοδήποτε από τα κεφάλαια αυτά υπάρχουν τέτοια τμήματα.

Θ) Τέλος, ποιες από τις γνώσεις που έχουν αποκτήσει οι υποψήφιοι από τις προηγούμενες τάξεις της γυμνασιακής και λυκειακής τους εκπαίδευσης στο μάθημα της Βιολογίας και οι οποίες δεν αναφέρονται στο βιβλίο της Γ’ Λυκείου, όπως αυτό αναφέρεται στο παραπάνω ΦΕΚ, είναι δυνατόν να τους ζητηθούν άμεσα ή έμμεσα; (Εδώ νοούνται προϋπάρχουσες γνώσεις, οι οποίες είναι απαραίτητες για να γίνει κατανοητό ένα τμήμα ή μία έννοια στο βιβλίο της Γ’ Λυκείου, η οποία δεν αναλύεται επαρκώς στο βιβλίο της Γ΄ Λυκείου καθώς θεωρείται γνωστή από προηγούμενες τάξεις.)

Προκείμενου να γίνει ποιο σαφές το ερώτημα μου, θα φέρω το παράδειγμα (υπάρχουν πολλά παραδείγματα, άλλα επιλέγεται ένα πρόσφατο) των θεμάτων των εισαγωγικών εξετάσεων των ημερησίων λυκείων του 2016, όπου τέθηκε το παρακάτω ερώτημα πολλαπλής επιλογής:

«Θέμα Α. Ερώτημα Α3:

Τα σωματικά κύτταρα του προβάτου Dolly περιείχαν:

α. ανασυνδυασμένο DNA

β. Το σύνολο του γενετικού υλικού του κυττάρου του μαστικού αδένα εξάχρονου προβάτου που χρησιμοποιήθηκε στη διαδικασία της κλωνοποίησης.

γ. το γονίδιο που είναι υπεύθυνο για την σύνθεση  της α1-αντιθρυψίνης

δ. το μιτοχονδριακό DNA του ωαρίου στο οποίο τοποθετήθηκε ο πυρήνας του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το κεφάλαιο 9 του σχολικού βιβλίου της Γ΄ Λυκείου, τη διαδικασία κλωνοποίησης, τον ορισμό και τη δημιουργία διαγονιδιακών ζώων.

Από το κεφάλαιο 1 του σχολικού βιβλίου της Γ΄ Λυκείου, ότι τα μιτοχόνδρια είναι μητρικής προέλευσης.

Από το κεφάλαιο 4 του σχολικού βιβλίου της Γ΄ Λυκείου, τον ορισμό του ανασυνδυασμένου DNA.

Θα έπρεπε όμως, να γνωρίζει τη θέση των μιτοχονδρίων στα κύτταρα (ότι δηλαδή αυτά δεν βρίσκονται εντός του πυρήνα, άλλα στο κυτταρόπλασμα ενός ευκαρυωτικού κυττάρου) και ποια κύτταρα διαθέτουν μιτοχόνδρια (ευκαρυωτικά τόσο τα σωματικά όσο και οι γαμέτες), γνώσεις που απέκτησε από την Β’ Λυκείου!

Όμως στην σελίδα 149 του σχολικού βιβλίου της Β’ Λυκείου, υπάρχει το ένθετο με τίτλο ΝΤΟΛΥ. Το ένθετο αυτό στην τελευταία παράγραφο του αναφέρει: ” Το μητρικό πρόβατο είχε αποκτήσει με την βοήθεια της Γενετικής Μηχανικής , την ιδιότητα να παράγει γάλα με ινσουλίνη. Η ιδιότητα αυτή πέρασε φυσικά και στην κόρη της την Ντόλυ.”

Ποια είναι λοιπόν η σωστή απάντηση που πρέπει να επιλέξει ο μαθητής, η α (το γενετικό υλικό της Ντόλυ ήταν ανασυνδυασμένο με ανθρώπινο γενετικό υλικό, αφού έφερε το ανθρώπινο γονίδιο της ινσουλίνης στο πυρηνικό DNA της, μιας και το πυρηνικό γενετικό υλικό της, ήταν πανομοιότυπο με το πυρηνικό γενετικό υλικό του μαστικού σωματικού κυττάρου του εξάχρονου προβάτου που χρησιμοποιήθηκε ως κύτταρο δότης του πυρήνα) ή η δ; (στο πρώτο κεφάλαιο του βιβλίου της Γ΄ Λυκείου, αναφέρεται ότι τα μιτοχόνδρια είναι μητρικής προέλευσης και η εξήγηση αυτού δίνεται στο ένθετο (που είναι εκτός ύλης, σύμφωνα με το αναφερόμενο παραπάνω ΦΕΚ!) του κεφαλαίου 5 του ίδιου βιβλίου, όπου αναφέρεται ότι τα σπερματοζωάρια φέρουν τα μιτοχόνδρια τους στην ουρά τους και κατά την γονιμοποίηση, η ουρά του σπερματοζωαρίου δεν εισέρχεται στο ωάριο. Όμως για να επιλέξει ο μαθητής αυτή την απάντηση, που θεωρήθηκε και η μοναδική σωστή από την ΚΕΕ, πρέπει να γνωρίζει ότι τα μιτοχόνδρια του ωαρίου δεν είναι στον πυρήνα του, αλλά στο κυτταρόπλασμα του, ώστε να ξέρει ότι τα μιτοχόνδρια του διπλοειδούς κυττάρου που έδωσε την Ντόλυ, ήταν εκείνα που υπήρχαν στο κυτταρόπλασμα του απύρηνου ωαρίου που χρησιμοποιήθηκε και όχι στον πυρήνα του μαστικού σωματικού κυττάρου, του οποίου ο πυρήνας χρησιμοποιήθηκε. Ωστόσο, τη γνώση, ότι τα μιτοχόνδρια δεν βρίσκονται στον πυρήνα των ευκαρυωτικών κυττάρων, άλλα στο κυτταρόπλασμα τους, οι μαθητές την απέκτησαν στην β’ Λυκείου. Στο βιβλίο της Γ’ Λυκείου, δεν γίνεται σε κανένα σημείο του οποιαδήποτε τέτοια αναφορά, εκτός από την εικόνα 1.9. όπου όμως δεν διευκρινίζεται ποιος είναι ο πυρήνας του κυττάρου καθώς και στο απόσπασμα στο κεφ. 1 “Στα ευκαρυωτικά κύτταρα το γενετικό υλικό κατανέμεται στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. Συνήθως όμως ο όρος γονιδίωμα αναφέρεται στο γενετικό υλικό που βρίσκεται στον πυρήνα” όπου όμως και πάλι δεν γίνεται σαφές ότι τα μιτοχόνδρια δεν είναι εντός του πυρήνα). Πώς λοιπόν, μπορεί να διαλέξει ο μαθητής τη μοναδική σωστή απάντηση, αφού αν δεν κάνει χρήση των γνώσεων που απέκτησε από την βιολογία γενικής παιδείας της Β’ Λυκείου, δεν μπορεί να επιλέξει την απάντηση δ. Αλλά, από την άλλη πλευρά, αν χρησιμοποιήσει τις γνώσεις της Β’ Λυκείου, τότε σωστή απάντηση είναι και η α.

Ένας μαθητής δηλαδή της Γ’ Λυκείου που δίνει εισαγωγικές εξετάσεις οφείλει να γνωρίζει από τη Β’ Λυκείου που βρίσκονται τα μιτοχόνδρια, ώστε μπορεί να αποκλείσει την επιλογή β στο παραπάνω ερώτημα κλειστού τύπου και να επιλέξει το δ, αλλά δεν πρέπει να γνωρίζει τι λέει το σχολικό βιβλίο της Β’ Λυκείου για την Ντόλυ, ώστε να μην επιλέξει το α;

Επίσης να παρατηρηθεί ότι:

Ι) Στο αναφερόμενο ΦΕΚ και στο οριζόμενο από αυτό εξεταζόμενο σχολικό βιβλίο ορίζονται ως εκτός εξεταστέας ύλης, τα τμήματα του σχολικού βιβλίου με τίτλο:

i) Παραθέματα

ii) «Ας ερευνήσουμε …» στο τέλος κάθε κεφαλαίου.

Τα τμήματα αυτά δεν απαντώνται σε κανένα σημείο του βιβλίου όπως αυτό ορίζεται από το προαναφερόμενο ΦΕΚ!

Σημείωση: Παρακαλώ όπως ενημερωθώ μεσώ ηλεκτρονικού ταχυδρομείου για τον αριθμό πρωτοκόλλου που έλαβε η επιστολή μου.

ΜΑΡΓΑΡΙΤΗ ΝΙΚΟΛΕΤΤΑ

ΕΚΠΑΙΔΕΥΤΙΚΟΣ

Συνημμένα:

1.Απόσπασμα του αναφερόμενου ΦΕΚ

2.Αποσπάσματα από τα βιβλία της Β’ και Γ’ Λυκείου.

3.Απόσπασμα των θεμάτων των Ημερήσιων Λυκείων 2016 στη Βιολογία Ομάδας Θετικού Προσανατολισμού.

Ένα σχόλιο για τη δυσκολία των θεμάτων των πανελληνίων εξετάσεων

Τα τελευταία χρόνια το Υπουργείο Παιδείας δημοσιεύει αναλυτικότερα στοιχεία για τις βαθμολογίες των υποψηφίων, τα οποία μας δίνουν τη δυνατότητα να αξιολογήσουμε τα θέματα των εξετάσεων και την καταλληλόλητά τους στον διαχωρισμό των υποψηφίων σε καλούς, πολύ καλούς και άριστους. Παραθέτουμε παρακάτω μια διαγραμματική απεικόνιση των κατανομών των βαθμολογιών των μαθητών για 5 βασικά μαθήματα, απαραίτητα για την εισαγωγή σε σχολές υψηλής ζήτησης για τα έτη 2016 και 2017.

Βαθμολογίες ανά μάθημα

Η Χημεία και η Φυσική είναι δύο μαθήματα στα οποία οι θεματοδότες αποτυγχάνουν θεαματικά να διαχωρίσουν τους άριστους από τους απλώς καλούς υποψηφίους. Και στα δύο μαθήματα παρουσιάζεται μια αριστερή ασσυμετρία στην κατανομή των βαθμολογιών, πράγμα που πρακτικά σημαίνει ότι μεγάλος αριθμός υποψηφίων γράφουν άριστα ή κάτι πολύ κοντά σε αυτό. Στη Χημεία συγκεκριμένα βλέπουμε ότι ιδιαίτερα το 2016, περίπου το 23% των υποψηφίων έγραψε 19-20. Το ίδιο πρόβλημα παρουσιάζεται, σε μικρότερο και με τα θέματα του 2017, καθώς και με τη Φυσική. Παρόμοιο πρόβλημα παρουσιάζεται και στη Βιολογία, αν και σε μικρότερη κλίμακα. Εδώ αξίζει να σταθούμε λίγο παραπάνω στη Φυσική, ένα παραδοσιακά δύσκολο μάθημα, στο οποίο όμως τα τελευταία δύο χρόνια «έπεσαν» εύκολα θέματα με αποτέλεσμα τη συσσώρευση αριστούχων στην κορυφή ακόμα και εκεί.

Η έκθεση από την άλλη πλευρά είναι ένα ιδιόμορφο μάθημα, στο οποίο από ότι φαίνεται είναι σχετικά εφικτό για έναν μαθητή να γράψει ανάμεσα στο 13-17, ενώ μόνο ένα πολύ μικρό ποσοστό των μαθητών καταφέρνει να αριστεύσει.

Η ιδανική κατανομή βαθμολογιών παρουσιάζεται στα μαθηματικά, όπου παρουσιάζεται μια δεξιά ασσυμετρία. Οι άριστοι μαθητές είναι λίγοι, αλλά όχι μηδαμινοί, όπως στην έκθεση και όσο χαμηλώνει ο βαθμός, τόσο αυξάνονται οι μαθητές που τον επιτυγχάνουν. Αυτό μπορεί να λογιστεί ως επιτυχία των θεματοδοτών στα μαθηματικά, οι οποίοι έχουν ελαχιστοποιήσει τα θέματα θεωρίας, άρα και την αποστήθιση, και κλιμακώνουν ορθά τη δυσκολία των θεμάτων τους, έτσι ώστε να επιτυγχάνεται η διάκριση των καλών, των πολύ καλών και των αρίστων υποψηφίων.

Οι θεματοδότες των υπόλοιπων μαθημάτων μπορούν να διδαχθούν πολλά από τους συναδέλφους τους των μαθηματικών. Πρωτότυπες ασκήσεις υπάρχουν πλέον και σε μαθήματα όπως η βιολογία, τα οποία παλαιότερα οι μαθητές αποστήθιζαν. Δε δικαιούμαστε να αδικούμε τους άριστους συνωστίζοντάς τους μαζί με ένα σημαντικό ποσοστό καλών απλώς υποψηφίων, οι οποίοι αριστεύουν λόγω των εύκολων θεμάτων στα περισσότερα μαθήματα.

 

Γιώργος Καρακατσάνης

Οικονομολόγος

Λύσεις Βιολογίας θετικού προσανατολισμού Πανελληνίων εξετάσεων 2017 – Ημερήσια

Βιολογία Ομάδας Θετικού Προσανατολισμού

ΘΕΜΑΤΑ 2017 ΗΜΕΡΗΣΙΑ ΓΕΛ

ΘΕΜΑ Α

Οι ζητούμενες απαντήσεις, είναι :

A1: δ , Α2 : δ , Α3 : β , Α4 : γ , Α5 : α

ΘΕΜΑ Β

B1

Ι → Α

Ι Ι → Ε

ΙΙΙ → ΣΤ

ΙVB

VZ

VI →Γ

VII → Δ

Β2

Η δοθείσα εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο.

Αιτιολόγηση : Γνωρίζουμε ότι στα προκαρυωτικά κύτταρα οι διαδικασίες της μεταγραφής ενός γονιδίου που κωδικοποιεί για μόριο mRNA και της μετάφρασης αυτού του μορίου mRNA, συμβαίνουν ταυτόχρονα. Δηλαδή, πριν ολοκληρωθεί η μεταγραφή, έχει ήδη ξεκινήσει η μετάφραση του νεοσυντιθέμενου μορίου mRNA καθώς είναι άμεσα δυνατή η πρόσδεση της μικρής ριβοσωμικής υπομονάδας στην 5′ αμετάφραστη περιοχή του mRNA. Αυτό είναι δυνατό καθώς τα βακτηριακά κύτταρα δεν διαθέτουν πυρηνική μεμβράνη και επομένως το μόριο DNA βρίσκεται στο κυτταρόπλασμα στην περιοχή του πυρηνοειδούς μαζί με τα ριβοσώματα, τα οποία είναι τα ειδικά σωματίδια του κυττάρου, που μαζί με άλλα μόρια (π.χ tRNA , rRNA κ.α ) και αρκετή ενέργεια πραγματοποιούν την διαδικασία της πρωτεϊνοσύνθεσης του κυττάρου.

Β3

Το ιδανικό φάρμακο είναι εκείνο που δεν επιφέρει καμία παρενέργεια στον οργανισμό ενώ ταυτόχρονα θεραπεύει αποτελεσματικά. Το ιδανικό φάρμακο είναι τα αντισώματα.

Τα αντισώματα είναι πρωτεϊνικά μόρια που παράγει ο οργανισμός των θηλαστικών (και των πτηνών) και έχουν την δυνατότητα να συνδέονται εκλεκτικά με ένα ορισμένο τμήμα ( αντιγονικός καθοριστής ) ενός ξένου προς τον οργανισμό σώματος (αντιγόνο).

Το αντιγόνο είναι ξένη προς τον οργανισμό ουσία που μπορεί να προκαλέσει ανοσολογική απόκριση, δηλαδή παραγωγή από τον οργανισμό ειδικών κυττάρων (λεμφοκυττάρων) και κυτταρικών προϊόντων ( π.χ αντισώματα) που θα δράσουν για την εξουδετέρωση του.

Τα αντισώματα παράγονται από τα Β-λεμφοκύτταρα του οργανισμού, κάθε διαφορετικό Β-λεμφοκύτταρο παράγει συγκεκριμένο διαφορετικό αντίσωμα, κατάλληλο για την αναγνώριση και την σύνδεση του μ’ έναν συγκεκριμένο αντιγονικό καθοριστή. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων είναι όλα όμοια μεταξύ τους και ονομάζονται μονοκλωνικά αντισώματα.

Τα μονοκλωνικά αντισώματα βρίσκουν πολλές εφαρμογές ως διαγνωστικά εργαλεία στην Βιολογία και την Ιατρική. Τα μονοκλωνικά αντισώματα δεν μπορούν να παραχθούν σε μεγάλες ποσότητες από τα Β-λεμφοκύτταρα όταν αυτά αναπτύσσονται σε κυτταροκαλλιέργειες in vitro καθώς τα φυσιολογικά Β – λεμφοκύτταρα (κυτταρική σειρά) δεν μπορούν να διαιρεθούν περισσότερες από 50 με 70 φορές, μιτωτικά, στην κυτταροκαλλιέργεια.

Προκειμένου λοιπόν να παραχθούν τα μονοκλωνικά αντισώματα που θέλουμε σε μεγάλες ποσότητες, πρέπει να συντηχθούν τα ειδικά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα (τα κύτταρα αυτά έχουν παραχθεί σε ένα ποντίκι εμβολιασμένο με τον επιθυμητό αντιγονικό καθοριστή, το οποιο πραγματοποιεί πρωτογενή ανοσοβιολογική απόκριση εναντίον αυτού του αντιγονικού καθοριστή) με καρκινικά Β-λεμφοκύτταρα ποντικού (μυέλωμα). Τα κύτταρα που προκύπτουν από την σύντηξη, ονομάζονται υβριδώματα και εμφανίζουν τις δύο ιδιότητες που θέλουμε, να παράγουν τα επιθυμητά αντισώματα και να διαιρούνται για πολύ περισσότερες φορές από 50-70 διαιρέσεις σε κυτταροκαλλιέργεια in vitro. Η τελευταία ιδιότητα είναι ιδιότητα των καρκινικών κυττάρων.

Έτσι προκειμένου να παράγουμε μονοκλωνικά αντισώματα που αναγνωρίζουν και συνδέονται με την χορειακή γοναδοτροπίνη του ανθρώπου ώστε να δημιουργήσουμε ένα ευαίσθητο διαγνωστικό έλεγχο για την εγκυμοσύνη στα πρώτα στάδια της, πρέπει :

α) Να χορηγήσουμε με ένεση σ’ ένα υγιές ποντίκι, ανθρώπινη χορειακή γοναδοτροπίνη, που έχουμε απομονώσει από γυναίκα που είναι έγκυος στα πρώτα στάδια της εγκυμοσύνης. Θεωρούμε δεδομένο ότι το ποντίκι δεν παράγει χορική γοναδοτροπίνη όμοια με του ανθρώπου, ώστε η ανθρώπινη ορμόνη να λειτουργήσει ως αντιγόνο σε αυτό. Επίσης, το ποντίκι που εμβολιάστηκε με την ανθρώπινη ορμόνη, ζει σε στείρο περιβάλλον ώστε να μην παράγει κατά το δυνατό αλλά αντισώματα, διαφορετικά από τα ζητούμενα, ώστε να διευκολυνθούμε στην απομόνωση των κατάλληλων Β-λεμφοκυττάρων

β) 15 μέρες μετά τον εμβολιασμό του, όταν έχει μεγιστοποιηθεί η ανοσολογική πρωτογενής αντίδραση του ποντικιού έναντι της ανθρώπινης ορμόνης, από το ποντίκι αφαιρείται ο σπλήνας του. Ο σπλήνας είναι δευτερογενές λεμφικό όργανο των θηλαστικών, στο οποίο πραγματοποιείται η ανοσολογική απόκριση .Επομένως, στον σπλήνα θα υπάρχουν πολλά Β-λεμφοκύτταρα του ποντικιού που παράγουν το επιθυμητό αντίσωμα.

γ) Από τον σπλήνα του ποντικιού απομακρύνονται τα επιθυμητά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα .

δ) Τα κατάλληλα Β-λεμφοκύτταρα του ποντικιού συντήκονται με καρκινικά Β-λεμφοκύτταρα ποντικιού που αναπτύσσονται σε κυτταροκαλλιέργεια (μυέλωμα). Τα προϊόντα της κυτταρικής σύντηξης ονομάζονται υβριδώματα. Τα Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντισωμα δίνουν στο υβρίδωμα τη δυνατότητα να παράγει το επιθυμητό αντισωμα και τα καρκινικά κύτταρα προσδίδουν αθανασία.

ε) Από τα υβριδώματα που παράγονται κάποια ευαισθητοποιούνται με την ανθρώπινη χορειακή γοναδοτροπίνη, όποτε κλωνοποιούνται (μιτωτικά) και στην συνέχεια κατά ένα μέρος τους διαφοροποιούνται σε πλασματοκύτταρα, τα οποία παραγάγουν και εκκρίνουν μεγάλες ποσότητες του επιθυμητού αντισώματος ενώ τα υπόλοιπα φυλάγονται στην κατάψυξη (-800C) για μεταγενέστερη χρήση.

Τα παραγόμενα από τα κατάλληλα υβριδώματα, μονοκλωνικά αντισώματα, που αναγνωρίζουν την ανθρώπινη χορειακή γοναδοτροπίνη, μπορούν τώρα να χρησιμοποιηθούν ως διαγωνιστικά εργαλεία για τον έλεγχο της ύπαρξης κύησης, κυρίως σε γυναίκες που βρίσκονται στα πρώτα στάδια της εγκυμοσύνης.

Η λήψη αίματος από μια γυναίκα που επιθυμεί να μάθει αν είναι έγκυος και η χρήση των μονοκλωνικών αντισωμάτων για τον ποσοτικό και ποιοτικό προσδιορισμό της χορειακής γοναδοτροπίνης της, μας επιτρέπει να γνωρίζουμε αν είναι έγκυος (εφόσον διαθέτει την ορμόνη στο αίμα της, ποιοτικός έλεγχος) και σε ποια αρχική εβδομάδα της κύησης βρίσκεται (ανάλογα με την ποσότητα της ορμόνης που εντοπίστηκε) .

Β4

Η τεχνολογία του ανασυνδυασμένου DNA έχει δώσει τη δυνατότητα δημιουργίας γονιδιωματικών βιβλιοθηκών των οργανισμών.

Η γονιδιωματική βιβλιοθήκη ενός οργανισμού είναι το σύνολο των βακτηρικών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό (με άγαρ) και κάθε κλώνος φέρει ενσωματωμένο σε ένα μόριο φορέα κλωνοποίησης (πλασμίδιο ή DNA λ-φάγου αντιστοίχως) ένα ορισμένο τμήμα από το DNA του οργανισμού, του οποίου δημιουργούμε την βιβλιοθήκη.

Αυτό το τμήμα του DNA του οργανισμού δότη του γενετικού υλικού (δηλαδή του οργανισμού του οποίου δημιουργούμε την γονιδιωματική βιβλιοθήκη), υπάρχει σε πολλαπλά αντίγραφα σε κάθε κλώνο της βιβλιοθήκης, δηλαδη, το DNA του οργανισμού δότη έχει κλωνοποιηθεί.

Το σύνολο των κλώνων της γονιδιωματικής βιβλιοθήκης φέρει το σύνολο του γονιδιώματος του οργανισμού δότη (συνήθως χωρίς το μιτοχόνδριακό ή/και το χλωροπλαστικό DNA -το τελευταίο μόνο σε περίπτωση φυτικού οργανισμού- αναφερόμενο σε ευκαρυωτικό οργανισμό) σε πολλά διαφορετικά τμήματα σε πολλά αντίγραφα το κάθε τμήμα. Γονιδιωματικές βιβλιοθήκες δημιουργούνται και για προκαρυωτικούς και για ευκαρυωτικούς οργανισμούς.

Γνωρίζουμε ότι τα κύτταρα ενός πολυκυτταρικού οργανισμού φέρουν όλα τα ίδιο γενετικό υλικό (εκείνο το DNA, του ζυγωτού του οργανισμού αυτού) αφού όλα είναι προϊόντα μίτωσης του πρώτου διπλοειδούς κυττάρου (ζυγωτό) αυτού του οργανισμού. ‘Έτσι όλα τα απόγονα κύτταρα από την μίτωση κυττάρων που διαιρούνται, ενός ζωικού οργανισμού, όπως είναι τα μυϊκά και τα ηπατικά, θα φέρουν το ίδιο DNA (θεωρούμε ότι δεν έχουν συμβεί καινοφανείς μεταλλάξεις στα όργανα αυτά).

Η δημιουργία της γονιδιωματικής βιβλιοθήκης ενός οργανισμού περιλαμβάνει τα εξής βήματα:

Α) Απομόνωση κυττάρων του οργανισμού π.χ μυϊκά ή/και ηπατικά.

Β) Απομόνωση του DNA των κυττάρων αυτών, με λύση των κυττάρων.

Γ) Πέψη του DNA των κυττάρων αυτών με μία ορισμένη περιοριστική ενδονουκλέαση π.χ EcoRI. H περιοριστική ενδονουκλέαση αναγνωρίζει και κόβει με συγκεκριμένη φορά, μία ορισμένη δίκλωνη αλληλουχία DNA μήκους 4-8 ζευγών βάσεων. Η EcoRI για παράδειγμα αναγνωρίζει την δίκλωνη αλληλουχία:

5’GAATΤC3’

3’CTTAAG5’

και κόβει μεταξύ του G και του Α με προσανατολισμό 5’→3’ αφήνοντας αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα). Κάθε περιοριστικό ένζυμο δημιουργεί τέτοια κολλώδη άκρα όπως αυτά προκύπτουν με βάση την αλληλουχία αναγνώρισης DNA που αναγνωρίζει αυτό το ένζυμο. Για την EcoRI:

 

5’G 3′           5′ AATΤC3’

3’CTTAA 5′           3′G5’

AATT : κολλώδες άκρο Ι

TTAA : κολλώδες άκρο ΙΙ

Τα κολλώδη άκρα Ι και ΙΙ είναι συμπληρωματικά. Κάθε περιοριστικό ένζυμο κόβει το δίκλωνο DNA σε δυο φωσφοδιεστερικούς δεσμούς 3’→5’ και το ανάλογο πλήθος δεσμών υδρογόνου, σύμφωνα με την αλληλουχία αναγνώρισης του. Η ΕcoRI σπάει 8 δεσμούς υδρογόνου μεταξύ των 4 ζευγών βάσεων Α και Τ.

Δ) Απομόνωση κατάλληλου φορέα κλωνοποίηση, πλασμίδιο ή DNA φαγού λ και πέψη του φορέα κλωνοποίησης με το ίδιο περιοριστικό ένζυμο που χρησιμοποιήθηκε στο προηγούμενο βήμα, ώστε να δημιουργηθούν συμπληρωματικά κολλώδη άκρα .

Ε) Ανάμιξη και ανασυνδυασμός των τμημάτων DNA του οργανισμού δότη και των κομμένων φορέων κλωνοποίησης με την προσθήκη DNA δεσμάσης για την ένθεση – δημιουργία δυο 3′->5′ φωσφοδιεστερικων δεσμών ανα σημειο συνδεσης- ενός τμήματος DNA του οργανισμού δότη σε έναν φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακους φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου της καλλιέργειας (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών, για την ανάπτυξη αποικιών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Εφόσον σύμφωνα με τα δεδομένα της εκφώνησης τα ένζυμα και οι τεχνικές που χρησιμοποιούνται είναι ίδια τόσο για τη δημιουργία της βιβλιοθήκης του ηπατικού όσο και του μυϊκού κυττάρου, οι δύο γονιδιωματικές βιβλιοθήκες θα είναι ίδιες, εφόσον δεν φέρουν τα κύτταρα που απομονώσαμε από αυτά τα όργανα μεταλλάξεις.

cDNA βιβλιοθήκη ενός κυτταρικού τύπου ενός ευκαρυωτικού οργανισμού είναι το σύνολο των βακτηριακών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό και φέρουν σε πολλαπλά αντίγραφα, το ολικό ώριμο mRNA του κυτταρικού τύπου με τη μορφή δίκλωνου DNA ενσωματωμένο σε φορείς κλωνοποίησης (πλασμίδια ή DNA λ-φάγου, αντιστοίχως).

Η διαδικασία δημιουργίας της cDNA βιβλιοθήκης ενός κυτταρικού τύπου εν συντομία, είναι:

Α) Απομόνωση κυττάρων του κυτταρικού τύπου του οργανισμού π.χ μυϊκά ή ηπατικά στο κατάλληλο αναπτυξιακό στάδιο στην επιθυμητή φάση του κυτταρικού κύκλου των κυττάρων, στις επιθυμητές συνθήκες για τον οργανισμό.

Β) Απομόνωση του ολικού ώριμου mRNA των κυττάρων αυτών με ήπια λύση των κυττάρων.

Γ) Χρήση του ολικού ωρίμου mRNA ως καλούπι για την σύνθεση cDNA με την βοήθεια της αντίστροφης μεταγραφάσης.

Δ) Δημιουργία δίκλωνου DNA από το cDNA με την βοήθεια της DNA πολυμεράσης.

Ε) Ένθεση του δίκλωνου DNA, μετά από κατάλληλη κατεργασία, σε φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακούς φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους αντιστοίχως.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Η cDNA βιβλιοθήκη ενός κυτταρικού τύπου διαφέρει ανάλογα με το αναπτυξιακό στάδιο του οργανισμού καθώς και την φάση των κυττάρων του οργανισμού δότη, που έγινε η απομόνωση του ολικού ώριμου mRNA των κυττάρων του, εξαιτίας του γεγονότος ότι, διαφορετικά γονίδια εκφράζονται σε κάθε χρονική στιγμή.

Επίσης, η cNAD βιβλιοθήκες δύο διαφορετικών κυτταρικών τύπων του ίδιου οργανισμού, την ίδια χρονική στιγμή, διαφέρουν εξαιτίας της κυτταρικής διαφοροποίησης, δηλαδή της επιλεκτικής έκφρασης διαφορετικών γονιδίων από κάθε κύτταρο που ανήκει σε διαφορετικό κυτταρικό τύπο του ίδιου οργανισμού, όπως το ήπαρ και οι μύες, ώστε κάθε κύτταρο του κάθε κυτταρικού τύπου, να διαθέτει τις κατάλληλες πρωτεΐνες για την σωστή δομή και λειτουργία του, στο ορισμένο αναπτυξιακό στάδιο του οργανισμού και τις συνθήκες που επικρατούν στον οργανισμό και στο περιβάλλον του, έτσι ώστε να ανταποκριθούν καταλλήλως τα κύτταρα του κάθε κυτταρικού τύπου.

Βεβαίως κάθε κύτταρο ενός οργανισμού παράγει και πρωτεΐνες που είναι αναγκαίες για τις βασικές λειτουργίες του όπως π.χ τις λειτουργίες της μεταγραφής και της μετάφρασης καθώς και της αντιγραφής για τα μυϊκα και τα ηπατικά κύτταρα, τα οποία διαιρούνται. Επομένως, οι cDNA βιβλιοθήκες ενός ηπατικού και ενός μυϊκού κυττάρου αναμένεται να έχουν πολλούς διαφορετικούς κλώνους και ορισμένους κοινούς κλώνους.

ΘΕΜΑ Γ

Γ1

Θεωρούμε ότι η α1 αντιθρυψίνη που αναφέρεται στην εκφώνηση του ερωτήματος είναι η πρωτεΐνη του ανθρώπου που παράγεται στο ήπαρ και η έλλειψη της οδηγεί σε πνευμονικό εμφύσημα.

Γνωρίζουμε ότι μπορούμε σήμερα να δημιουργήσουμε διαγονιδιακά ζώα, δηλαδή ζώα, που με την τεχνολογία του ανασυνδυασμένου DNA, φέρουν ένα ετερόλογο γονίδιο, δηλαδή γονίδιο ενός άλλου είδους όπως παραδείγματος χάριν του ανθρώπου, στο γονιδίωμά τους. Τα ζώα αυτά χρησιμοποιούνται σήμερα ως εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών (gene farming) καθώς είναι δυνατή η έκφραση των ανθρώπινων γονιδίων από τα ζωικά κύτταρα.

Για να εκφράσει ένα γονίδιο πρέπει στα κύτταρα του κυτταρικού τύπου του ευκαρυωτικού οργανισμού οπου θα εκφράζεται αυτό το γονίδιο, να υπάρχουν οι κατάλληλοι μεταγραφικοί παράγοντες οι οποιοι αναγνωρίζουν και συνδέονται με τον υποκινητή του γονιδίου αυτού, δηλαδή του γονιδίου, που εκφράζεται. Μόνο όταν ο σωστός συνδυασμός μεταγραφικών παραγόντων έχει συνδεθεί στον υποκινητή του γονιδίου, είναι δυνατή η σύνδεση της RNA πολυμεράσης με τον υποκινητή του γονιδίου αυτού, ώστε να ξεκινήσει σωστά η μεταγραφή του.

Επίσης δεδομένου ότι ο γενετικός κώδικας είναι σχεδόν καθολικός, δηλαδή όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα και σε συνδυασμό με το γεγονός πως τα ριβοσώματα των οργανισμών μπορούν να χρησιμοποιηθούν ως θέσεις πρωτεινοσυνθεσης για οποιοδήποτε μόριο mRNA οποιουδήποτε οργανισμού ή ιού. Το ζωικό κύτταρο θα μπορεί να μεταφράσει το mRNA που θα προκύψει από την μεταγραφή του ανθρώπινου γονιδίου, το οποίο είναι ενσωματωμένο κατάλληλα στο γονιδίωμα του ζώου.

Ένα διαγονιδιακό ζώο που θέλουμε να παράγει την ανθρώπινη α1-αντιθρυψίνη στα μαστικά του κύτταρα, θα πρέπει να έχει δημιουργηθεί με τέτοιο τρόπο ώστε το ανθρώπινο γονίδιο που με μικροέγχυση έχει εισέλθει στο γονιμοποιημένο ωράριο του ζώου, να έχει τοποθετηθεί στο γονιδίωμα του ζώου με τέτοιο τρόπο, ώστε να βρίσκεται υπό τον έλεγχο του υποκινητή ενός γονιδίου του ζώου, το οποίο εκφράζεται αποκλειστικά στα μαστικά κύτταρα. Τέτοιο γονίδιο του ζώου, είναι το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος του ζώου.

Σύμφωνα με τα δεδομένα της εκφώνησης, το ανθρώπινο γονίδιο της α1-αντιθρυψίνη έχει τοποθετηθεί με το σωστό προσανατολισμό μέσα στο γονίδιο της καζεΐνης του γάλακτος του ζώου, δηλαδή η κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης έχει τοποθετηθεί με το 5’ άκρο της προς τον υποκινητή του γονιδίου της ζωικής καζεΐνης και συνεπώς η μη-κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης θα έχει το 3’άκρο της προς τον υποκινητή του γονιδίου της καζεΐνης του ζώου. Έτσι , κατά την μεταγραφή του γονιδίου της καζεΐνης του ζώου από την RNA πολυμεράση του ζώου, θα μεταγράφεται η μη κωδική αλυσίδα του γονιδίου της ανθρώπινης α1-αντιθρυψίνης. ‘Έτσι το ζωικό κύτταρο στη συνέχεια, μετά την μεταγραφή του γονιδίου της ανθρώπινης α1-αντιθρυψίνης, θα ωριμάσει αρχικά (αν το ανθρώπινο γονίδιο δεν έχει απομονωθεί από cDNA βιβλιοθήκη ανθρωπίνων ηπατικών κυττάρων) και θα μεταφράσει στη συνέχεια, το κατάλληλο mRNA για την παραγωγή της ανθρώπινης πρωτεΐνης σε πρόδρομη μορφή. Η λειτουργική πρωτεΐνη α1-αντιθρυψίνη του ανθρώπου, θα δημιουργηθεί από τους μετά-μεταφραστικούς μηχανισμούς του ζώου, που δεν διαφέρουν από εκεινους του ανθρώπου καθώς και τα δυο είδη είναι θηλαστικά.

Γ2

Μας δίνεται το δίκλωνο γραμμικό τμήμα DNA:

5’GAATTCCGCAAATTAA

3’CTTAAGGCGTTTAATT5’

To οποίο πέπτεται από το περιοριστικό ένζυμο ΕcoRI . Το περιοριστικό ένζυμο EcoRI αναγνωρίζει την δίκλωνη αλληλουχία

5’GAATTC3’

3’ CTTAAG5’

και κόβει με προσανατολισμό 5’→3’ μεταξύ του G και Α σπάζοντας τους φοσφωδιεστερικούς δεσμούς μεταξύ τους και ταυτόχρονα σπάει και τους 8 δεσμούς υδρογόνου μεταξύ των συμπληρωματικών ζευγών Α και Τ, αφήνοντας μονόκλωνες αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα).

Δηλαδή μετά την επίδραση της EcoRI το δοθέν τμήμα DNA πέπτεται ως εξής, εφόσον φέρει μοναδική θέση αναγνώρισης του περιοριστικού ενζύμου στα αριστερά.

ΕΙΚΟΝΑ Α

5’G3΄            5΄AATTCCGCAAATTAA

3’CTTAA5΄           3′ GGCGTTTAATT5’

3′ TTAA5’ KOΛΛΩΔΕΣ ΑΚΡΟ Ι

AATΤ ΚΟΛΛΩΔΕΣ ΑΚΡΟ ΙΙ

Η τεχνολογία του ανασυνδυασμένου DNA είναι το σύνολο των τεχνικών και των μεθόδων που μας επιτρέπουν την επέμβαση μας στο γενετικό υλικό των οργανισμών.

Μέσω της τεχνολογίας αυτής είναι δυνατή η ένθεση ενός γραμμικού δίκλωνου τμήματος DNA, που έχει κοπεί σε δύο σημεία με την ίδια περιοριστική ενδονουκλέαση, ώστε να φέρει στα δύο άκρα του συμπληρωματικά κολλώδη άκρα. Το τμήμα αυτό μπορεί να ενθεθει σ΄ ένα πλασμίδιο, όταν το πλασμίδιο έχει κοπεί σε μοναδικό σημείο από την ίδια περιοριστική ενδονουκλέαση ώστε να φέρει συμπληρωματικά κολλώδη άκρα στο σημείο τομής.

2017 Blog 8-9-01

Όπως προκύπτει από τις εικόνες Α και Β είναι αδύνατη η έκθεση του τμήματος που μας δίνεται σε πλασμίδιο που έχει κοπεί μία φορά με το ΕcoRI, καθώς το τμήμα που μας δίνεται διαθέτει μόνο μία φορά την αλληλουχία που αναγνωρίζεται από την ΕcoRI και επομένως φέρει ένα μονάχα κολλώδες άκρο στην μία ακριανή πλευρά του (εικόνα Α).

Η ένθεση του τμήματος που μας δίνεται θα ήταν εφικτή με το δοθέν πλασμίδιο, μονάχα αν ήταν δυνατό να προστεθεί το κατάλληλο κολλώδες άκρο, με την βοήθεια κατάλληλου ενζύμου, στο δεξιό άκρο του τμήματος μας.

Γ3

Σύμφωνα με τα δεδομένα της εκφώνησης έχουμε το παρακάτω γενεαλογικό δέντρο:

2017 Blog 8-9-01 extra 1

Η μελέτη της κληρονομικότητας στον άνθρωπο εμφανίζει πολλές δυσκολίες καθώς ο άνθρωπος δεν εμφανίζει τα χαρακτηριστικά του κατάλληλου οργανισμού μοντέλου για την Γενετική. Ο άνθρωπος έχει μεγάλο χρόνο γενεάς, αφήνει λίγους απογόνους και δεν επιδέχεται επιλεκτικές διασταυρώσεις. Επομένως, η μελέτη της Γενετικής του ανθρώπου γίνεται με την δημιουργία γενεαλογικών δέντρων, δηλαδή μιας διαγραμματικής απεικόνισης των γάμων και των γεννήσεων μιας οικογένειας για πολλές γενεές .

Σύμφωνα με τα δεδομένα της άσκησης μια γυναίκα (Γ1) παντρεύτηκε με δύο διαφορετικούς συζύγους στην διάρκεια της ζωής της και απέκτησε με τον καθένα από ένα παιδί .

Η γυναίκα έχει ομάδα αίματος 0, και ο ένας σύζυγος της έχει ομάδα αίματος ΑΒ (Σ1) ενώ ο άλλος έχει ομάδα αίματος Α (Σ2). Το παιδί Π1 έχει ομάδα αίματος 0 και το παιδί Π2 έχει ομάδα αίματος Β.

Γνωρίζουμε ότι η ταυτοποίηση των ομάδων αίματος του ανθρώπου μπορεί να γίνει με τη χρήση κατάλληλων διαγνωστικών εργαλείων, όπως είναι τα μονοκλωνικά αντισώματα.

Ένα άτομο με ομάδα αίματος 0 δεν εμφανίζει κανένα αντιγόνο ούτε Α, ούτε Β στην επιφάνεια των ερυθροκυττάρων του, επομένως κατά την ταυτοποίηση με αντι-Α-αντισώματα και αντί-Β-αντισώματα, δεν θα πραγματοποιηθεί ανοσολογική αντίδραση in vitro, μεταξύ των ερυθροκυττάρων του ατόμου και των αντί-Α και αντί-Β αντισωμάτων.

Ένα άτομο με ομάδα αίματος ΑΒ θα εμφανίζει στην επιφάνεια των ερυθροκυττάρων του και το αντιγόνο Α και το αντιγόνο Β και in vitro, θα εμφανίζει ανοσολογική αντίδραση με τα δυο διαφορετικά είδη αντισωμάτων που αναγνωρίζουν αυτά τα αντιγόνα. Ομοίως σκεπτόμενοι, άτομα με ομάδα αίματος Α αντιδρά ανοσολογικά μόνο με το αντι-Α-αντίσωμα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με τα αντί-Α-αντίσωματα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με το αντι-Β-αντίσωματα.

Γνωρίζουμε ότι το γονίδιο Ι που ελέγχει για τις ομάδες αίματος είναι αυτοσωμικό και έχει τρία πολλαπλά αλληλόμορφα τα ΙΑ, ΙΒ , και i . Τα ΙΑ και ΙΒ είναι συνεπικρατή μεταξύ τους και επικρατούν του i. Tο αλληλόμορφο ΙΑ κωδικοποιεί για μια πρωτεΐνη που μετατρέπει μια πρόδρομη ουσία σε αντιγόνο Α, το οποίο τοποθετείται στην επιφάνεια των ερυθροκυττάρων. Ομοίως το ΙΒ κωδικοποιεί την πρωτεΐνη που σχηματίζει το αντιγόνο Β, ενώ το αλληλόμορφο i δεν κωδικοποιεί για κάποια πρωτεΐνη. Έτσι άτομα με γονότυπο ΙΑ ΙΑ και ΙΑI έχουν φαινότυπο ομάδα αίματος Α. Τα άτομα με το γονότυπο ΙΒ ΙΒ ή ΙΒ i έχουν φαινότυπο ομάδα αίματος Β, άτομα γονότυπου ΙΑΙΒ έχουν φαινότυπο ομάδα αίματος ΑΒ και τέλος τα άτομα γονότυπου ii έχουν ομάδα αίματος 0.

Σύμφωνα με τα παραπάνω και με δεδομένο ότι κάθε γονέας κληροδοτέι ένα πλήρες απλοειδές γονιδίωμα σε κάθε απόγονο του σύμφωνα με τον 1ₒ νόμο του Μendel, ο οποίος αναφέρει ότι κατά τον σχηματισμό των γαμετών, τα αλληλόμορφα γονίδια διαχωρίζονται και κατανέμονται στους γαμέτες τυχαία μεν άλλα ισοπιθανα δε. Η γονιμοποίηση είναι τυχαίο γεγονός.

Έχουμε λοιπόν τις εξής δύο διασταυρώσεις :

  1. Ρ1 : Γ1 Χ Σ1

F1 : Παιδί Α

Δηλαδή : Ρ1 : ii × IA I B

γαμέτες : i, i / IA , IB

γαμέτες/ γαμέτες

IA

IB

i

IAi

IBi

i

IAi

IBi

Oι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών μιας διασταύρωσης και τρόπου συνδυασμού τους, μεταξύ τους.

Γονοτυπική αναλογία F1 γενεάς: IAi : IBi

Φαινοτυπική αναλογία F1 γενεάς: [ Α ] : [ B ]

Δηλαδή η γυναίκα αυτή μπορεί να αποκτήσει με τον σύζυγο 1, παιδιά με ομάδα αίματος Α ή με ομάδα αίματος Β. Δεν μπορεί να αποκτήσει παιδιά με ομάδα αίματος ΑΒ και παιδιά με ομάδα αίματος 0. Θεωρούμε ότι δεν εμφανίζονται νέες μεταλλάξεις και όλα συμβαίνουν φυσιολογικά.

Β) Ρ2 : Γ1 x Σ2

F1 : Παιδί Β

Δηλαδή : P2 : ii x IAIA ή P2 : ii x IA i

γαμέτες: i , i / IA , IA γαμέτες : i , i / IA , i

F1 :

γαμέτες/ γαμέτες

IA

IA

i

IAi

IAi

i

IAi

IAi

ή

F1 :

γαμέτες/ γαμέτες

IA

i

i

IAi

ii

i

IAi

ii

F1

Γονοτυπική αναλογία : 100% IAi                   ή                  Γονοτυπική αναλογία : ΙΑi : ii

Φαινοτυπική αναλογία : 100 % [A]                  ή                   Φαινοτυπική αναλογία : [Α] : [0]

Επομένως , αναλόγως με τον γονότυπο του συζύγου 2, η γυναίκα αυτή με τον άνδρα αυτό, μπορεί είτε να αποκτήσει μόνο παιδιά με ομάδα αίματος Α ή παιδιά με ομάδα αίματος Α και με ίση αναλογία παιδιά με ομάδα αίματος 0.

Επομένως, με βάση τις παραπάνω, το παιδί Π1 αφού έχει ομάδα αίματος 0 είναι παιδί του Σ2, ο οποίος θα έχει ομάδα αίματος Α και γονότυπο ΙΑi και το παιδί Π2, αφού έχει ομάδα αίματος Β είναι παιδί του Σ1.

Δηλαδή το γενεαλογικό δέντρο είναι :

2017 Blog 8-9-01 extra 2

Γ4

Γνωρίζουμε ότι όλοι οι μικροοργανισμοί όπως και όλα τα έμβια όντα απαιτούν για την ανάπτυξη τους πηγή άνθρακα (C) στο περιβάλλον τους σε κατάλληλες ποσότητες, αφού όλα τα βιολογικά μακρομόρια που δομούν τα κύτταρα (πρωτεΐνες, DNA, RNA, λιπίδια και υδατάνθρακες) αποτελούνται από C. Οι ετερότροφοι μικροοργανισμοί προμηθεύονται από τo περιβάλλον τους τον C, με μορφή οργανικών ενώσεων, ενώ οι αυτότροφοι προμηθεύονται από τον C από τον CO2 της ατμόσφαιρας.

Το βακτήριο E.coli είναι ετερότροφο και απαιτεί ως πηγή άνθρακα είτε γλυκόζη (κατά προτίμηση), είτε λακτόζη, είτε κάποιον άλλον υδατάνθρακα που θα μπορεί να τον μεταβολίσει. Οι Γάλλοι επιστήμονες, Jacob και Monod απέδειξαν ότι το βακτήριο E. coli μπορεί να μεταβολίζει την λακτόζη (δισακχαρίτης αποτελούμενος από γλυκόζη και γαλακτόζη) χάρη στην ύπαρξη στο γονιδίωμα του, του οπερονίου της λακτόζης.

Το οπερόνιο της λακτόζης, απέδειξαν οι Γάλλοι επιστήμονες, ότι αποτελείται από τρία γονίδια που ονομάζονται δομικά ( με τη σειρά: Ζ,Υ,Α) τα οποία βρίσκονται υπό τον έλεγχο του ίδιου υποκινητή. Την έκφραση των δομικών γονιδίων του οπερονίου ελέγχουν δύο ρυθμιστικές αλληλουχίες του. Η μία ονομάζεται χειριστής και βρίσκεται μεταξύ της αλληλουχίας του υποκινητή του οπερονίου, και του πρώτου δομικού γονιδίου Ζ του οπερονίου.

Η άλλη ρυθμιστική αλληλουχία της έκφρασης των δομικών γονιδίων του οπερονίου της λακτόζης, ονομάζεται ρυθμιστικό γονίδιο και βρίσκεται μπροστά από τον υποκινητή του οπερονίου. Το ρυθμιστικό γονίδιο διαθέτει τον δικό του υποκινητή και τις δικές του αλληλουχίες λήξης της μεταγραφής.

Το ρυθμιστικό γονίδιο εκφράζεται συνεχώς και κωδικοποιεί λίγα μόρια μιας πρωτεΐνης, που ονομάζεται πρωτεΐνη καταστολεας. Η πρωτεΐνη αυτή έχει τέτοια στερεοδιάταξη ώστε να αναγνωρίζει την αλληλουχία του χείριστη και να συνδέεται με αυτήν. Η σύνδεση του καταστολέα με τον χειριστή παρεμποδίζει την μεταγραφή των δομικών γονιδίων του οπερονίου της λακτόζης.

΄Όμως, όταν εντός του βακτηρικού κυττάρου υπάρχει λακτόζη, τότε ο ίδιος ο διασακχαρίτης συνδέεται με την πρωτεΐνη καταστολέα σε κατάλληλο σημείο της. Η συνδεση αυτή οδηγεί σε αλλαγή στην στερεοδιάταξη της πρωτεΐνης καταστολέα ώστε αυτή τώρα να μην μπορεί να συνδέεται πλέον με τον χειριστή του οπερονίου. Οπότε, η ίδια η λακτόζη λειτουργεί ως επαγωγέας της έκφρασης των δομικών γονιδίων του οπερονίου, που την καταβολίζει. Δηλαδή, όταν το βακτήριο αναπτύσσεται σε περιβάλλον με μόνη πηγή άνθρακα λακτόζη, εκφράζεται το οπερόνιο της λακτόζης, δηλαδή μεταγράφεται και μεταφράζεται. Με την μεταγραφή του παράγεται ένα μόριο mRNA που φέρει τρεις πληροφορίες για την σύνθεση τριών διαφορετικών πρωτεϊνών (με τη σειρά β-γαλακτοζιδάση, περμεάση, τρανσακετυλάση) κατά την μετάφρασή του, οι οποίες συμμετέχουν στον καταβολισμό της λακτόζης.

Σύμφωνα λοιπόν με τα παραπάνω μπορούμε να ερμηνεύσουμε το δοθέν διάγραμμα, με βάση το οποίο, λίγο πριν την χρονική στιγμή t1, η πηγή άνθρακα του θρεπτικού υλικού έχει εξαντληθεί. Τη χρονική στιγμή t1 προστίθεται λακτόζη στο θρεπτικό υλικό. Μέτα την προσθήκη λακτόζης παρατηρείται σιγμοειδής αύξηση (παρατηρήθηκε εκθετική αύξηση στην παραγόμενη από τα κύτταρα ποσότητα mRNA, μέχρι μία ορισμένη μέγιστη τιμή πέρα από την οποία η ποσότητα του mRNA/βακτήριο δεν αυξάνεται άλλο) στην καμπύλη μεταβολής της συνάρτησης mRNA ανά κύτταρο =f(t).

Μετά την προσθήκη της λακτόζης στην καλλιέργεια την χρονική στιγμή t1, το βακτήριο E.coli άρχισε να εκφράζει το οπερόνιο της λακτόζης και να παράγει το mRNA από την μεταγραφή του, ενώ ταυτόχρονα, επειδή το κύτταρο διαθέτει πλέον πηγή C και επομένως ενέργεια και υλικά για την κάλυψη των αναγκών του και για την σύνθεση των βιολογικών μακρομορίων του, εκφράζει εκτός από το οπερόνιο της λακτόζης και τα υπόλοιπα γονίδια που σχετίζονται με την ανάπτυξη κάθε βακτηρίου για το δεδομένο περιβάλλον όπου αναπτύσσεται. Η παραγωγή των μορίων mRNA θα φτάσει κάποια χρονική στιγμή την μέγιστη δυνατή τιμή πέρα από την οποία δεν μπορεί να αυξηθεί άλλο, αφού αυτές είναι οι μέγιστες ενδογενείς δυνατότητες των βακτηρίων της καλλιέργειας σε αυτό το δεδομένο περιβάλλον.

ΘΕΜΑ Δ

Δ1

Στο φυσιολογικό γονίδιο της αλυσίδας β της αιμοσφαιρίνης Α (HbA) αντιστοιχεί η αλληλουχία ΙΙΙ της δοθείσας εικόνας 4. Στο παθολογικό γονίδιο βς αντιστοιχεί η αλληλουχία Ι της εικόνας 4.

Αιτιολόγηση: Γνωρίζουμε ότι η αιμοσφαιρίνη Α (ΗbA) είναι μία πρωτεΐνη των ερυθρών αιμοσφαιρίων μας, υπεύθυνη για την μεταφορά του οξυγόνου (02 )στους ιστούς. Η αιμοσφαιρίνη Α αποτελείται από 4 πολυπεπτιδικές αλυσίδες 2α και 2β.

Οι αλυσίδες β της ΗbA κωδικοποιούνται από ένα αυτοσωμικό γονίδιο, το γονίδιο β, στο οποίο έχουν βρεθεί περισσότερα από 300 πολλαπλά παθολογικά αλληλόμορφα. Ένα παθολογικό αλληλόμορφο του γονιδίου β είναι το γονίδιο βς το οποίο κωδικοποιεί για τις αλυσίδες βς που συνδεόμενες ανά 2, με 2 αλυσίδες α, δίνουν την μεταλλαγμένη αιμοσφαιρίνη ΗbS, αιτία της ασθένειας της δρεπανοκυτταρικής αναιμίας μίας σοβαρής αυτοσωμικής υπολειπόμενης νόσου.

Η διαφορά της πολυπεπτιδικής αλυσίδας β (φυσιολογική) από της βς (παθολογική ) είναι το 6ο αμινοξύ των πολυπεπτιδίων όπου η β φέρει ως αμινοξύ γλουταμινικό οξύ και η βς φέρει βαλίνη.

Γνωρίζουμε ότι η μεταφορά της γενετικής πληροφορίας από το γονίδιο στην πολυπεπτιδική αλυσίδα γίνεται μέσω της μεταφοράς της πληροφορίας από την μία αλυσίδα του γονιδίου στο κινητό αντίγραφο της γενετικής πληροφορίας, που είναι ένα μονόκλωνο μόριo mRNA, μέσω της διαδικασίας μεταγραφής του γονιδίου. Αντίγραφό λοιπόν της κωδικής αλυσίδας του γονιδίου (που φέρει άμεσα την γενετική πληροφορία του γονιδίου) είναι ένα μόριο mRNA, το οποίο μεταφέρεται στα ριβοσώματα για την παραγωγή του πολυπεπτιδίου, μέσω ενός κώδικα αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών (γενετικός κώδικας) χάρη στα μόρια tRNA.

O Γενετικός κώδικας είναι:

α) Τρίλεπτας, τρία νουκλεοτίδια του mRNA κωδικοποιούν ένα αμινοξύ (κωδικόνιο).

β) Συνεχής , κατά την μετάφραση δεν παραλείπεται κανένα νουκλεοτίδιο.

γ) Μη επικαλυπτόμενος, κάθε νουκλεοτίδιο του mRNA που μεταφράζεται ανήκει μόνο σ ένα κωδικόνιο.

δ) Έχει κωδικόνιο έναρξης της μετάφρασης (ΑUG) και κωδικόνιο λήξης της μετάφρασης ένα εκ των (5΄’UAG3 , 5’UAA3, , UGA). Η μετάφραση σταματάει στα κωδικόνια λήξης καθώς δεν υπάρχουν μόρια tRNA με συμπληρωματικά αντικωδικόνια για αυτά τα κωδικόνια.

Σύμφωνα με την διαδικασία της μεταγραφής, το παραγόμενο μονόκλωνο μόριο mRNA, είναι όμοιο σε αλληλουχία και προσανατολισμό, αποτελούμενο βεβαίως από ριβονουκλεοτίδια, με τον ένα από τους δυο κλώνους του γονιδίου. Ο κλώνος αυτός του γονιδίου, ονομάζεται κωδικός και είναι αυτός που φέρει την γενετική πληροφορία όπως και το κινητό αντίγραφο του, το μόριο mRNA. Το μεταγράφημα (mRNA) προέκυψε από την μεταγραφή της συμπληρωματικής προς τον κωδικό κλώνο αλυσίδας του γονιδίου του κυττάρου, η αλυσίδα αυτή ονομάζεται μη κωδική και είναι αυτός ο κλώνος του γονιδίου που χρησιμοποιήθηκε από το ένζυμο της μεταγραφής δηλαδή, την RNA πολυμεράση ως καλούπι για την σύνθεση του mRNA. O κλώνος αυτός δεν φέρει κωδικόνια.

Η RNA πολυμεράση, κατά την μεταγραφή, συνδέεται στον υποκινητή του γονιδίου με την βοήθεια των κατάλληλων μεταγραφικών παραγόντων και ξετυλίγοντας την διπλή έλικα συνθέτει το μόριο RNA με καλούπι της, τη μη κωδική αλυσίδα του γονιδίου. Δημιουργείται έτσι ένα μόριο RNA με προσανατολισμό 5’→3’ , αφού το ένζυμο συνδέει τα ριβονουκλεοτίδια στο αναπτυσσόμενο RNA, με 3’→5’ φωσφοδιεστερικό δεσμό. Επομένως το mRNA που παράγεται κατά την μεταγραφή, έχει προσανατολισμό 5’→3’ με το 5’ άκρο του προς τον υποκινητή του γονιδίου, που μεταγράφεται. Όμοιο προσανατολισμό, έχει και η κωδική αλυσίδα του γονιδίου. Η μη-κωδική αλυσίδα του γονιδίου έχει αντιπαράλληλο προσανατολισμό.

Το αμινοξυ. γλουταμινικο οξύ, κωδικοποιείται απο το κωδικονιο 5’GAG3’ ενώ η βαλινη κωδικοποιείται από το κωδικόνιο 5’GTG3’.

Επομένως στις δοθείσες αλληλουχίες Ι , ΙΙ ,ΙΙΙ της εικόνας 4, προκειμένου να βρούμε την αλληλουχία του φυσιολογικού αλληλόμορφου β και του μεταλλαγμένου αλληλόμορφου βς θα αναζητήσουμε το κωδικόνιο έναρξης 5’ΑΤG3’ σ’ έναν από τους δύο κλώνους, της κάθε αλληλουχίας και για το γονίδιο β θα αναζητήσουμε και ως έβδομο κωδικόνιο το 5’GΑG3’ , ενώ για το παθολογικό αλληλομορφο βς ως έβδομο κωδικόνιο το 5’GTG3’. Γνωρίζουμε ότι κατά την μετα-μεταφραστική τροποποίηση που υφίσταται το παραγόμενο από τη μετάφραση πολυπεπτίδιο του συγκεκριμένου γονιδίου, αφαιρείται η αρχική μεθειονίνη από το αρχικό αμινικό άκρο, δηλαδή το έκτο αμινοξύ, τόσο στο λειτουργικό πολυπεπτίδιο β όσο και στο παθολογικό βς κωδικοποιήθηκε από το έβδομο κωδικόνιο στo mRNA.

Σύμφωνα λοιπόν με τα παραπάνω και τις δοθείσες αλληλουχίες I,II,III της εικόνας 4 παρατηρούμε ότι κωδικονιο έναρξης 5’ΑTG3’ υπάρχει μόνο στην πάνω αλυσίδα, στις αλληλουχίες Ι και ΙΙΙ και στην Ι αλληλουχία το 70 κωδικόνιο είναι το 5’GTG3’ άρα πρόκειται για το γονίδιο βς ενώ στην αλληλουχία ΙΙΙ το 70 κωδικόνιο είναι το GAG3’. Επομένως πρόκειται για το φυσιολογικό γονίδιο β.

Δ2

Η αλληλουχία της εικόνας 4 που απομένει είναι η αλληλουχία ΙΙ και θα μπορούσε να αντιστοιχεί σε γονίδιο που προκαλεί την β-θαλασσαιμία.

Αιτιολόγηση:

Γνωρίζουμε ότι ο γενετικός τόπος του γονιδίου β εμφανίζει περισσότερα από 300 πολλαπλά αλληλόμορφα. Εκείνα τα αλληλόμορφα που φέρουν τέτοια μετάλλαξη, η οποία έχει ως συνέπεια την παντελή έλλειψη της πολυπεπτιδικής αλυσίδας β, είτε έχει ως συνέπεια την μειωμένη παραγωγή της, τα αλληλόμορφα αυτά του γονιδίου β ευθύνονται για την β-θαλασσαιμία μια ασθένεια που εμφανίζει ετερογένεια συμπτωμάτων και προκαλείται από την απουσία ή την μειωμένη παρουσία της ΗbA στα ερυθροκυτταρα του ανθρωπου.

Ένα γονίδιο δεν εκφράζεται όταν δεν είναι δυνατή είτε η μεταγραφή είτε η μετάφραση του. Όταν ένα γονίδιο έχει υποστεί τέτοια μετάλλαξη (μόνιμη αλλαγή στην αλληλουχία του DNA του) που δεν φέρει κωδικόνιο έναρξης 5’ΑΤG3’ , τότε δεν μεταφράζεται το μόριο mRNA που προκύπτει από το γονίδιο αυτό, το οποίο μόριο mRNA αντιστοιχεί στην κωδική αλυσίδα του γονιδίου, όπως αποδείχθηκε στο προηγούμενο ερώτημα.

Παρατηρούμε ότι η αλληλουχία ΙΙ δεν φέρει τριπλέτα 5’ΑΤG3 στον πάνω κλώνο παρά μόνο στον κάτω. Ωστόσο, ο κάτω κλώνος δεν είναι η κωδική αλυσίδα του γονιδίου β, όπως αποδείχθηκε στο προηγούμενο ερώτημα. Συνεπώς, το παραγόμενο κατά την μεταγραφή μόριο mRNA αδυνατεί, να μεταφρασθεί για να παραχθεί το πολυπεπτίδιο β. Συνεπώς, η αλληλουχία β μπορεί να αντιστοιχεί σε ένα παθολογικό αλληλόμορφο γονίδιο β΄ του γονιδίου β, το οποίο παθολογικό β΄ ευθύνεται για την β-θαλασσαιμία.

Παρατηρούμε ότι οι τρεις αλληλουχίες Ι,ΙΙ,ΙΙΙ που μας δίνονται στην εικόνα 4 είναι πολλαπλά αλληλόμορφα του ίδιου γενετικού τόπου. Το αλληλόμορφο β΄( αλληλουχία ΙΙ) εμφανίζει σημειακή μετάλλαξη προσθήκης ενός ζεύγους βάσης ανάμεσα στο 8ο φυσιολογικό ζεύγος βάσεων και στο 90 ζεύγος βάσεων από αριστερά προς τα δεξιά, όπου το ζεύγος C-G έχει προστεθεί στην αλληλουχία ΙΙ .

C

III

G

Η μετάλλαξη αυτή οδηγεί στην κατάργηση του κωδικόνιου έναρξης, που υπάρχει φυσιολογικά στο γονίδιο β, μετά από έξι συνεχόμενες αδενινες, διαβάζοντας από τα αριστερά προς τα δεξιά τον πάνω κλώνο (κωδικό) στις αλληλουχίες Ι και ΙΙΙ που μας έχουν δοθεί και αντιστοιχούν σε τμήμα του 1ου εξωνίου του γονιδίου β της HbA. Αρα το mRNA μόριο που θα προκύψει από την μεταγραφή του γονιδίου β΄(αλληλουχία ΙΙ) δεν θα είναι δυνατόν να μεταφραστεί.

Δ3

α) Η θέση έναρξη της αντιγραφής βρίσκεται στην θέση Υ

β) Συνεχώς αντιγράφεται η αλυσίδα Α.

Ασυνεχώς Αντιγράφεται η αλυσίδα Β.

γ) Το πρωταρχικό τμήμα iii (5’ΑCGCCA3’) συντίθεται πρώτο.

Δ4

Γνωρίζουμε ότι τα άτομα που φέρουν ένα φυσιολογικό β αλληλόμορφο του γονιδίου β που κωδικοποιεί για την πολυπεπετιδικη αλυσίδα β της HbA και ένα παθολογικό υπολειπόμενο β’ ονομάζονται φορείς της ασθένειας της β θαλασσαιμιας και είναι φαινοτυπικά υγιείς σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Επίσης, ετερόζυγα άτομα με γονότυπο ββς , είναι φορείς της δρεπανοκυτταρικής αναιμίας και είναι φαινοτυπικα υγειή άτομα σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Η β-θαλασσαιμία, όπως και η δρεπανοκυτταρική αναιμία είναι δύο ασθένειες που ελέγχονται από το ίδιο γενετικό τόπο που εδράζεται σε αυτοσωμικό χρωμόσωμα. Η κάθε μία από τις παραπάνω ασθένειες είναι υπολειπόμενες (χαμηλά υψόμετρα) και ελέγχονται από διαφορετικά παθολογικά αλληλόμορφα του γονιδίου β που ευθύνεται για την σύνθεση των φυσιολογικών β-αλυσίδων της ΗbA.

Έστω λοιπόν ο γενετικός τόπος ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων όπου εδράζεται το γονίδιο β με πολλαπλά αλληλόμορφα (πάνω από 300). Το γονίδιο β είναι φυσιολογικό και επικρατεί έναντι των παθολογικών υπολειπόμενων αλληλόμορφων του β’ και του βς. Το αλληλόμορφο β ελέγχει την σύνθεση της φυσιολογικής β πολυπεπτιδικής αλυσίδας της ΗbA, το παθολογικό υπολειπόμενο αλληλόμορφο β’ ελέγχει για την παντελή έλλειψη παραγωγής της β αλυσίδας της ΗbA ή για την μειωμένη παραγωγή της, ενώ το παθολογικό υπολειπόμενο βς ελέγχει για την σύνθεση των βς αλυσίδων της ΗbS που προκαλεί την δρεπανοκυταρική αναιμία. Το αλληλόμορφο β’ ευθύνεται για την β-θαλασσαιμία.

Δηλαδή άτομα με γονότυπο ββ είναι υγιή, άτομα με γονότυπο ββς και ββ’ είναι υγιή και ετερόζυγα (φορείς) της δρεπανοκυτταρικής αναιμίας και την β-θαλασσαιμία αντίστοιχα. Τέλος άτομα με το γονότυπο β΄βς νοσούν από μικροδρεπανοκυτταρική αναιμία και άτομα με γονότυπο β’β’ νοσούν από β- θαλασσαιμία

Έχουμε λοιπόν την διασταυρώση :

P: ββ’ x ββς

Γαμέτες : β, β΄ / β, βς

Oι γαμέτες προκύπτουν σύμφωνα με τον 10 νόμο Mendel δηλαδή το νόμο του διαχωρισμού των αλληλόμορφων γονιδίων, σύμφωνα με τον οποίο τα αλληλόμορφα ενός γονιδίου διαχωρίζονται κατά την πρώτη μειωτική διαίρεση και κατανέμονται τυχαία αλλά ισοπίθανα στους γαμέτες. Η γονιμοποίηση είναι τυχαίο γεγονός.

F1 : Οι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών και του τρόπου συνδυασμού τους σε μία διασταύρωση.

F1 :

γαμέτες/ γαμέτες

β

β΄

β

ββ

ββ’

βς

ββς

βςβ’

Γονοτυπική αναλογία F1 : ββ : ββ’ : ββς : βςβ’

Δηλαδή από την διασταύρωση αυτή προκύπτουν είτε άτομα με γονότυπο ββ είτε με ββ’ είτε με ββς είτε άτομο που φέρει και τα δύο παθολογικά αλληλόμορφα.

Από τον ιστότοπο βιολογίας: www.nikimargariti.com.

Διαγώνισμα Κεφάλαιο 6 Μεταλλάξεις Βιολογία Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

 Επιλέξτε την ορθή απάντηση:

  1. Πόσα αντίγραφα του γονίδιου των αλυσίδων δ διαθέτουμε φυσιολογικά στα χρωμοσώματα μας, σε ένα ευθροκύτταρο μας, που κυκλοφορεί στο αίμα μας:

α. 2 β. 4   γ. 6  δ. 12  ε.0

  1. Ένα ενήλικο ετερόζυγο άτομο με γονότυπο ββς έχει τις εξής αιμοσφαιρίνες:

α. HbA, HbS, HbF, HbA2

β. HbA, HbS, HbF, HbA2 και μπορει και HbAS

γ. HbA, HbS

δ. HbS, HbF

ε. HbA, HbS, HbA2

  1. Έμβρυο 18 εβδομάδων με γονότυπο ββς διαθέτει τις εξής πολυπεπτιδικές αλυσίδες για τις αιμοσφαιρίνες του.

α. α,β,γ,βς

β. α,γ,δ

γ. α,γ

δ. α,β,δ

ε. β,δ,γ

  1. Ένα άτομο με σύνδρομο Klinefelter, διαθέτει:

α. Φυσιολογικό πλήθος αλληλομόρφων γονίδιων.

β. Διπλάσιο πλήθος όλων των γονίδιων που εδράζουν στα φυλετικά χρωμοσώματα

γ. Δυο αντίγραφα για κάθε αυτοσωμικό γονίδιο, δυο αντίγραφα για το γονίδιο της αιμοροφίλιας και τρία αντίγραφα για κάθε γονίδιο που εδράζεται στην ομόλογη περιοχή των φυλετικών χρωμοσωμάτων.

δ. Τέσσερα γονίδια α, δυο γονίδια β, δυο γονίδια γ, δυο γονίδια δ στην φάση G1 του κυτταρικού κύκλου.

ε. Υψηλά επίπεδα HbF εάν έχει γονότυπο ομόζυγο για το γονίδιο βς και εμφανίζει ανθεκτικότητα στην προσβολή από το πλασμώδιο.

  1. Άτομο με γονότυπο ααααββςγγδδ, διαθέτει:

α. HbA 100%

β. HbS 100%

γ. ΗbS & HbA σε αναλογία 1:1

δ. Σε συνθήκες έλλειψης οξυγόνου όλα τα κύτταρα των ερυθρών αιμοσφαιρίων δρεπανώνονται.

ε. Οι δυο νόμοι του Μέντελ, ισχύουν για το σύνολο των αναφερόμενων γονίδιων.

Ζήτημα 2ο                                                                                   Μονάδες 25

  1. Μια γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που πραγματοποιήθηκε διαπιστώθηκε ότι διαθέτει 45 χρωμοσώματα καθώς απουσίαζε ένα φυλετικό χρωμόσωμα και διέθετε μόνο ένα Χ φυλετικό, ενώ εμφανίζει και φαινοτυπικά χαρακτηριστικά συνδρόμου Down.

α. Τι είδους μεταλλάξεις φέρει το έμβρυο; (2)

β. Ποιος από τους δυο γονείς μπορεί να ευθύνεται για το σύνδρομο τις μονοσωμίας; Με ποιο τρόπο μπορεί να προέκυψε ο μεταλλαγμένος γαμέτης; (1 + 5)

γ. Το έμβρυο εμφανίζει μειωμένα επίπεδα αιμοσφαιρινών. Δώστε μια πιθανή εξήγηση για την εμφάνιση του φαινομένου Down και των μειωμένων επιπέδων των αιμοσφαιρινών  στο έμβρυο. (7)

2. Ποιες μεταλλάξεις χαρακτηρίζονται ως διπλασιασμός; Αναφέρετε τρία παραδείγματα γονίδιων που ο διπλασιασμός αποτέλεσε στην μια περίπτωση θετικής μετάλλαξης και στις άλλες περιπτώσεις αρνητική μετάλλαξη. (2+3)

  1. Συγκρίνετε τους μηχανισμούς προστασίας από τις μεταλλάξεις μεταξύ των προκαρυωτικών και των ευκαρυωτικών κυττάρων. (5)

Ζήτημα 3ο                                                                                                                  Μονάδες 25

  1. Δίνεται η παρακάτω μεταλλαγμένη αλληλουχία της κωδικής αλυσίδας του γονιδίου β, των αλυσίδων β των αιμοσφαιρινών μας (αλληλόμορφο Const. Christine). Στην αλληλουχία των 95 νουκλεοτιδίων που δίνεται δεν εμφανίζεται κωδικόνιο λήξης, ούτε κάποιο εσώνιο.

GGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTGTTGGG…95 ΝΟΥΚΛΕΟΤΙΔΙΑ…ΑTGTTTAGTGATGGCCTGGCTGATCACCTGGA 3′

α. Σύμφωνα με τον γενετικό κώδικα, ποιο κωδικόνιο και ποιο αμινοξύ βρίσκεται και κωδικοποιείται  αντιστοίχως, ακριβώς μπροστά από τα 95 νουκλοτιδια; (3)

β. Προσδιορίστε την θέση του υποκινητή του μεταλλαγμένου γονιδίου β. (1) και γράψτε στο τετράδιο σας τις αλληλουχίες του γονιδίου που είναι εξονικες, αλλά δεν συνδέεται μαζί τους το ριβοσωμα. (2).

γ. Αυτό το μεταλλαγμένο αλληλόμορφο, φέρει μια σημειακή μετάλλαξη αντικατάστασης βάσης, σε σχέση με το αλληλόμορφο βς. Ποια είναι αυτή η αλλαγή; Ποιο αμινοξύ κωδικοποιείται ; (3)

δ. Προσδιορίστε το αμινοξύ που κωδικοποιείται από το κωδικόνιο που ακολουθεί την αλληλουχία των 95 νουκλεοτιδίων. (3)

2.

α. Σε ένα άτομο εληφθησαν δείγματα μυϊκού ιστού και πραγματοποιήθηκε καρυότυπος. Τα αποτελέσματα έδειξαν τρεις διαφορετικούς καρυοτύπους, σε τρία διαφορετικά κύτταρα του.

α. ΧΟ+44  β. ΧΥ+44    γ. ΧΥΥY+44.

Εξηγήστε πως είναι δυνατόν να υπάρξει τέτοιο άτομο. (7)

β. Σε ένα άτομο με γονότυπο βςβς, επιχειρήθηκε η ένθεση, με την βοήθεια κατάλληλου ιού φορέα, του φυσιολογικού γονιδίου β, στο γονιδίωμα των αιμοποιητικων κυττάρων του. Ποιος θα είναι ο φαινότυπος του ατόμου αυτού,

 

ως προς την δρεπανοκυτταρικη αναιμία, μετά την ένθεση του φυσιολογικού γονιδίου β, στο γονιδίωμα των αιμοποιητικων κυττάρων του (2); Αιτιολογήστε την απάντηση σας. (4)

 

 

Ζήτημα 4ο                                  Μονάδες 25

 

Α. Δίνεται το παρακάτω γενεαλογικό δένδρο:

2017 Κεφάλαιο 6 Μεταλλάξεις blog-01

 

Το ζευγάρι ΙΙΙ1 x ΙΙΙ2 απέκτησε τρία παιδία, τα οποία: Το πρώτο εμφανίζει ελαφριάς μορφής αναιμίας, το δεύτερο παιδί βαριά μορφή β-θαλασσαιμία και μικρό ποσοστό δρεπανοκυττάρων κατά τη δοκιμασία δρεπάνωσης, ενώ εμφανίζει και υψηλή συγκέντρωση HbF και τέλος το τρίτο παιδί  εμφάνισε στους πρώτους μήνες της ζωής του πολύ βαριά μορφής αναιμία, ενώ στις κυτταρολογικές εξετάσεις εμφανίστηκαν πολύ υψηλού επιπέδου ποσοστά δρεπανοκυττάρων.

Έγιναν μοριακές εξετάσεις τόσο για την β-θαλασσαιμία όσο και για την δρεπανοκυτταρική αναιμία. Τα αποτελέσματα φαίνονται στα παρακάτω πηκτώματα αγαρόζης.

Η απόσταση της θέσης  περιορισμού NhdI από την θέση περιορισμού MstII, είναι 20 ζεύγη βάσεων το οποίο δεν αποδίδεται στο σχήμα.

2017 Κεφάλαιο 6 Μεταλλάξεις blog-02

 

Οι μοριακές εξετάσεις έγιναν για το γονίδιο της δρεπανοκκυτταρικής αναιμίας. Χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση MstII, η οποία κόβει το παθολογικό αλληλόμορφο.

Για την β θαλασσαιμία χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση  NhdI, η οποία πέπτει το φυσιολογικό αλληλόμορφο εντός της 5’ αμετάφραστης περιοχής του γονίδιου και αφήνει ανέπαφο το παθολογικό αλληλόμορφο. Η επιλογή της NhdI, έγινε δεδομένου ότι το άτομο ΙΙ1 έπασχε από πολύ βαριά μορφή β-θαλασσαιμίας και είχαν ελεγχθεί σε προγενέστερο μοριακό έλεγχο, τα υπεύθυνα  γονίδια του. Κανένα άτομο της γενεαλογίας δεν εμφάνισε α-θαλασσαιμία.

1. Με βάση τα αποτελέσματα του μοριακού έλεγχου προσδιορίστε τους γονότυπους των ατόμων του δένδρου που ελέγχθηκαν με μοριακές εξετάσεις ως προς την HbA. (5)

  1. Προσδιορίστε την πιθανότητα εμφάνισης που είχε το άτομο IV2. (3)

3. Εξηγήστε πως μπορεί να προέκυψε το άτομο IV3, τι είδους μεταλλάξεις συνέβησαν.(4)

4. Προσδιορίστε τον γονότυπο των ατόμων ΙΙΙ1 και ΙΙΙ2 ως προς τα γονίδια των αιμοσφαιρίνων  HbA2, HbF. Γνωρίζετε ότι το άτομο IV1 εμφανίζει ελαφριά μορφή αναιμίας, παρόλο που είναι ετερόζυγο, επειδή σε περαιτέρω βιοχημικές αναλύσεις διαπιστώθηκε ότι δεν ανιχνεύεται HbA2. (2)

5. Ποιο θα είναι το πρότυπο των ζωνών του γονίδιου βς στο πήκτωμα αγαρόζης, όταν αυτό πέπτεται ταυτοχρόνως με τις περιοριστικές ενδονουκλεάσες MstII & NhdI ;(3)

6. Γνωρίζουμε ότι τα ώριμα ερυθρά αιμοσφαίρια δεν διαθέτουν πυρήνα, διαθέτουν όμως ριβοσωμάτα. Είναι τα ώριμα ερυθρά αιμοσφαίρια ζωντανά κύτταρα; (3)

Β. Παρακάτω δίνεται τμήμα του 1ου εξωνίου του γονιδίου για τη β-αλυσίδα της αιμοσφαιρίνης HbA. Κάθε τμήμα προέρχεται από διαφορετικό αλληλόμορφο.

Γονίδιο βi

AGGCTTATGGTGCACCTTACGCCAGAGGAG

TCCGAATTACCACGTGGAATGCGGTCTCCTC

Γονίδιο βii

AGGCTTATGGTGCACCTTACGCCAGTGGAG

TCCGAATACCACGTGGAATGCGGTCACCTC

Γονίδιο βiii

AGGCTTATGGTGCACCTTACGCCAGTAGGAG

TCCGAATACCACGTGGAATGCGGTCATCCTC

Γονίδιο βiv

AGGCTTATCGGTGCACCTTACGCCAGAGGAG

TCCGAATAGCCACGTGGAATGCGGTCTCCTC

Να βρεθεί το είδος της γονιδιακής μετάλλαξης για τα  παθολογικά αλληλόμορφα γονίδια.

Ποιό είναι το γονίδιο βς ; (4+1)

Διαγώνισμα Προσομοίωσης Βιολογίας Θετικού Προσανατολισμού 2017

Ζήτημα.                                                                                                                         μονάδες 25

1.Τα χρωμοσώματα των ευκαρυωτικών οργανισμών είναι ουδέτερα τόσο χημικά όσο και ηλεκτρικά, αυτό σημαίνει ότι:

Α. οι ιστόνες είναι θετικά φορτισμένες και όξινες

Β. οι ιστόνες είναι αρνητικά φορτισμένες και όξινες

Γ. οι ιστόνες είναι θετικά φορτισμένες και βασικές

Δ. οι ιστόνες είναι αρνητικά φορτισμένες και βασικές

Ε. τίποτα από τα παραπάνω

Στ. όλα τα παραπάνω είναι δυνατά.

2. Στο εργαστήριο απομονώθηκαν παγκρεατικά κύτταρα και μυικά  κύτταρα ποντικού. Μέτα από κατάλληλα πειράματα προέκυψαν υβριδικά κύτταρα, στα οποία όταν δημιουργήθηκε η cDNA βιβλιοθήκη τους σε δυο διαφορετικές χρονικές στιγμές, πήραμε ώριμα mRNA που κωδικοποιούν  για ινσουλίνη και ώριμα mRNA που κωδικοποιούν για μυοσίνη την πρώτη φορά και ώριμα mRNA που κωδικοποιούν  κατά κύριο λόγο μόνο μυοσινη τη δεύτερη φορά.

Α. Τα υβριδικά κύτταρα μπορεί να προέκυψαν από την σύντηξη πυρήνων.

Β. τα υβριδικά κύτταρα μπορεί να προέκυψαν από απομάκρυνση του πυρήνα του παγκρεατικού κυτταρου και τοποθέτηση του πυρήνα του μυϊκού κυττάρου στο απύρηνο παγκρεατικό κύτταρο.

Γ. τα υβριδικά κύτταρα μπορεί να προέκυψαν από μεταφορά πρωτεϊνών μυϊκών κυττάρων σε παγκρεατικά.

Δ. τα υβριδικά κύτταρα εκφράζουν τα ίδια γονίδια κάθε χρονική στιγμή

Ε. το α ή το β

Στ. το γ ή το δ.

3. Δημιουργήθηκε ένας σύνθετος βακτηριοφάγος με πρωτεϊνικό καψίδιο του Τ4 και γενετικό υλικό του λ φάγου. Οι σύνθετοι αυτοί ιοί χρησιμοποιήθηκαν για την δημιουργία γονιδιωματικής βιβλιοθήκης του βακτηρίου A. tumefaciens. Η γονιδιωματική βιβλιοθήκη αποτελείται από:

Α. λ φάγους το DNA των οποίων είναι ανασυνδυασμένο με τμήμα από Ti πλασμίδιο και το χρωμόσωμα του βακτηρίου.

Β. Τ4 φάγους το γενετικό υλικό των οποίων είναι ανασυνδυασμένο με τμήματα από το ολικό DNA του βακτηρίου.

Γ. λ φάγους που φέρουν ανασυνδυασμένο γενετικό υλικό του Τ4 με τμήμα από το DNA του βακτηρίου δότη.

Δ. Τ4 φάγους και λ φάγους ο κάθε ιός με το δικό του DNA ανασυνδυασμένο με τμήμα από το γενετικό υλικό του βακτηρίου .

Ε. τίποτα από τα παραπάνω.

Στ. οποιοδήποτε από τα παραπάνω είναι μπορεί να είναι σωστό.

4. Δίνεται το ολιγόπεπτιδίο :

met-lys-pro-arg-ser-arg-ile-phe-glu-met

Το συνεχές γονίδιο που το κωδικοποιεί πέπτεται από την EcoRI. To μεταφράσιμο τμήμα της κωδικής αλυσίδας είναι:

Α. 5’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG3’

B  5.’ ATG-GAA-TTC-ATT-AGG-TCC-AGG-CCC-AAA-ATG3’

Γ. 5’ ATG-AAG-CTT-TTA-GGA-CCT-GGA-CCC-AAA-ATG3’

Δ. 3’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG5’

E. καμιά από τις παραπάνω επιλογές.

Στ. οποιαδήποτε από τις παραπάνω επιλογές.

5. Τα αντισώματα είναι πρωτεΐνες με τεταρτοταγή δομή αποτελούνται από 4 πολυπεπτιδικές αλυσίδες ανά δυο όμοιες. Δυο βαριές και δυο ελαφριές. Τα μη μονοκλωνικά αντισώματα είναι διαφορετικά μεταξύ τους μόνο σε ένα μικρό ακραίο τμήμα τόσο των βαρίων όσο και των ελαφριών αλυσίδων τους. Ο ανθρωπινός οργανισμός μπορεί να συνθέσει εκατομμύρια διαφορετικά αντισώματα. Τα μονοκλωνικά αντισώματα παράγονται με τεχνολογία υβριδωμάτων και όχι με γενετική μηχανική από γενετικά τροποποιημένα βακτήρια ή ευκαρυωτικά κύτταρα, διότι:

α. είναι πιθανόν αδύνατη η απομόνωση των δυο διαφορετικών ωρίμων mRNA από ένα β λεμφοκύτταρο που απαιτούνται για την cDNA βιβλιοθήκη.

Β. είναι πιθανόν αδύνατη η εκτέλεση των πολύπλοκων μετά-μεταφραστικών τροποποιήσεων που απαιτούνται από τα βακτήρια καθώς και η in vitro εκτέλεση τους.

Γ. για να γίνει η απομόνωση ωρίμων mRNA πρέπει να γνωρίζουμε τα γονίδια που τα κωδικοποιούν και αυτά δεν είναι μέχρι σήμερα γνωστά.

Δ. τίποτα από τα παραπάνω.

Ζήτημα 2.                                                                                                                     Μονάδες 25 

1. Από πρόδρομα ερυθρά αιμοσφαίρια απομονώνουμε mRNA  που κωδικοποιεί τη β αλυσίδα της αιμοσφαιρίνης Α και το βάζουμε σε εκχύλισμα βακτηριακών κυττάρων. Παρατηρούμε σύνθεση πρόδρομων β αλυσίδων της αιμοσφαιρίνης Α;  (μονάδες 2)              Αιτιολογήστε την απάντηση σας. (μονάδες 5)

2. Θα μπορούσε να αναπτυχθεί η τεχνολογία του ανασυνδυασμένου DNA αν ο γενετικός κώδικας δεν ήταν καθολικός; (μονάδες 7)

3.  Δώστε τον ορισμό της βιοτεχνολογίας. (μονάδες 6)

4. Δίνεται ο παρακάτω πινάκας, να γίνουν οι σωστές αντιστοιχήσεις. (μονάδες 5)

2017 Προσομοίωση πίνακας

Ζήτημα 3.                                                                                                                        Μονάδες 25

Σε μια προσπάθεια γεωπόνων βιοτεχνολόγων για την παραγωγή άνθεων με εντονότερο χρώμα, το δίκλωνο DNA που κωδικοποιεί την συνθετάση της χαλκόνης (ένζυμο υπεύθυνο για την παραγωγή μοβ χρωστικής των άνθεων της πετούνιας), τέθηκε υπό τον έλεγχο του πολύ ισχυρού υποκινητή 35S του ιού της μωσαϊκωσης (ιογενής ασθένεια) της πετούνιας, ο οποίος είχε ενθεθεί στο Ti. Στη συνεχεία, με τη βοήθεια του Ti πλασμίδιου και του βακτηρίου A. tumefanciens, το γονίδιο της συνθετάσης, μαζί με τον υποκινητή του ιού μεταφέρθηκε σε φυτά πετούνιας μοβ χρώματος. Το πλασμίδιο Ti, περιείχε γονίδιο ανθεκτικότητας στην καναμυκινή, για την επιλογή των φυτών που δέχθηκαν το ανασυνδυασμένο Ti. Το Ti έφερε μια θέση αναγνώρισης για το περιοριστικό ένζυμο EcoRI εντός του γονιδίου της ανθεκτικότητας στην καναμυκίνη.

Η υπερέκφραση του ενζύμου της συνθετάσης της χαλκόνης στην πετούνια, είχε ως αποτέλεσμα, όχι απαραιτήτως την παραγωγή άνθεων με βαθύτερο χρώμα, όπως θα περιμέναμε, αλλά και φυτών που έφεραν λευκά άνθη. Για να διαπιστωθεί το πρότυπο της κληρονόμησης  του ετερόλογου γονιδίου, έγινε ανάδρομη διασταύρωση των λευκών διαγονιδιακών απόγονων με το πατρικό φυτό, που έφερε ομοιόμορφα μοβ άνθη. Παραγόταν φυτά μοβ με ποσοστό 50% και φυτά λευκά κατά 50%. Ενώ από την διασταύρωση φυτών με βαθύ μοβ χρώμα και φυσιολογικών μοβ πήραμε 50% φυσιολογικά και 50% διαγονιδιακά μοβ.

Σημείωση: θεωρούμε ότι κάθε κύτταρο λαμβάνει από ένα πλασμίδιο Τi.

α. Περιγράψτε την διαδικασία με την οποία οι επιστήμονες δημιούργησαν διαγονιδιακά φυτά πετούνιας ξεκινώντας από την δημιουργία cDNA βιβλιοθήκης. (μονάδες 10)

β. Για ποιο λόγο το δίκλωνο ετερόλογο γονίδιο τέθηκε υπό τον έλεγχο του υποκινητή 35S του ιού της μωσαϊκώσης της πετούνιας όταν ενθέθηκε στο Ti πλασμίδιο, για ποιο λόγο δεν επιλέχθηκε ο υποκινητής του γονιδίου της χαλκόνης; (μονάδες 5)

γ. Δώστε την ερμηνεία για την μη αναμενόμενη εμφάνιση φαινοτύπων στα διαγονιδιακά φυτά. (μονάδες 10)

Ζήτημα 4.                                                                                                                Μονάδες 25

Δίνεται το παρακάτω γενεαλογικό δένδρο το οποίο αφορά την κληρονόμηση δυο ασθενειών στον άνθρωπο. Την ασθένεια του υποφυσιακού νανισμού και την συνδυασμένη εγκεφαλομυοπάθεια.

2017 Προσομοίωση-02

Προκείμενου να βρεθεί ο τρόπος κληρονόμησης της συνδυασμένης εγκεφαλομυοπάθειας πάρθηκε μυϊκός ιστός από το άτομο ΙΙΙ6, στον οποίο πραγματοποιήθηκε βιοψία και μοριακές αναλύσεις. Γνωρίζουμε ότι σύμφωνα με τις βιοψίες η ασθένεια της μυοπάθειας δεν εμφανίζει κανένα από τα γνωστά πρότυπα, ωστόσο, εμφανίζει τροποποιημένα μιτοχόνδρια, έτσι έγινε PCR ενίσχυση και πέψη με περιοριστικές ενδονουκλεάσες για τα γονίδια ND1 και ND6 του mtDNA.

Το φυσιολογικό ND1 γονίδιο δεν πέπτεται από την EcoRI, ενώ το παθολογικό αλληλόμορφο πέπτεται σε ένα σημείο. Η ίδια περιοριστική ενδονουκλεάση πέπτει το φυσιολογικό ανθρωπινό mtDNA σε ένα ακόμη σημείο.

Το φυσιολογικό αλληλόμορφο ND6 του mtDNA, πέπτεται από την PstI, ενώ το παθολογικό αλληλόμορφο όχι.

Στο ακόλουθο σχήμα δίνεται ο χάρτης περιορισμού του ανθρώπινου mtDNA, το οποίο έχει μέγεθος 17.000 ζ.β.

Δίνεται η θέση αναγνώρισης της PstI:

5’ CTGCAG3’

3’ GACGTC5’

2017 Προσομοίωση-03

Πάρθηκαν δείγματα από τα εξής άτομα της γενεαλογίας :

Ι1, Ι2, ΙΙ1, ΙΙ3, ΙΙ5, ΙΙΙ5, ΙΙΙ6, ΙΙΙ7

To mtDNA, κάθε ατόμου πέπτεται με EcoRI και PstI, ταυτόχρονα και πήραμε τα ακόλουθα αποτελέσματα. Το κυκλικό μόριο δεν εμφανίζεται.

2017 Προσομοίωση-04

Από περαιτέρω γενετικές μελέτες που έγιναν αποκλείστηκε οποιαδήποτε σχέση αυτόσωμικών γονιδίων με την μυοπάθεια.

α.Με ποιο τρόπο κληρονομείται η ασθένεια του υποφυσιακού νανισμού σύμφωνα με το γενεαλογικό δένδρο ποια διασταύρωση αποδεικνύει αυτόν τον τρόπο κληρονόμησης;      ( μονάδες 2)

β. προτείνεται ένα τρόπο κληρονόμησης ή εμφάνισης της μυοπάθειας στο άτομο που εμφανίζει τη νόσο (μονάδες 8). Με ποια πιθανότητα ένα επόμενο παιδί των ΙΙ5 και ΙΙ6 θα νοσεί (μονάδες 2);

γ. Σχεδιάστε τον περιοριστικό χάρτη του mtDNA του ατόμου Ι1 και του ατόμου Ι2 (μονάδες 3).

δ.Εξηγήστε ποια είναι η κωδική και η μη κωδική αλυσίδα των γονιδίων ND1 και ND6. Να προσδιοριστεί ο προσανατολισμός των κλώνων των δυο γονιδίων (μονάδες 6).

2017 Προσομοίωση-05

ε.Τι είδους μετάλλαξη φέρει το παθολογικό γονίδιο ND1 (μονάδες 1).

στ. Προσδιορίστε τον προσανατολισμό του μορίου mtDNA του ανθρώπου στο σημείο Α (εκατέρωθεν αυτού) (μονάδες 1).

ζ.Οι ασθένειες που μελετώνται έχουν τις προϋποθέσεις για την θεραπεία τους μέσω γονιδιακής θεραπείας (μονάδες 2);

Πρoστατευμένο: Διαγώνισμα κεφαλαίου 7 Βιολογίας Θετικού Προσανατολισμού

Αυτό το περιεχόμενο είναι προστατευμένο με συνθηματικό. Για να το δείτε εισάγετε το συνθηματικό σας παρακάτω:

Διαγώνισμα βιολογίας θετικού προσανατολισμού. Κεφάλαια: 1-2-4-7

Ζήτημα 1.                                                                                                   Μονάδες 25

  1. Δίνεται το παρακάτω σχήμα που αναπαριστά ένα χρωμόσωμα.

 

Επαναληπτικό 1-2-4-7-01

Το τμήμα Α θέλουμε να κλωνοποιηθεί in vitro.  Η αντιγραφή τελειώνει κάθε φορά στο τέλος του μητρικού κλώνου που λειτουργεί ως καλούπι.

Μετά από πόσους κύκλους αντιγραφής θα υπάρχει στον δοκιμαστικό σωλήνα για πρώτη φορά το επιθυμητό τμήμα Α.

α. Νo x 2κ

β. 2κ

γ. κ

δ.2

ε. 3

  1. Το τμήμα Α αποτελεί γονίδιο. Το προϊόν της μεταγραφής διαθέτει 70% πουρίνες, από αυτές το 30% δημιουργεί δυο δεσμούς υδρογόνου σε δίκλωνο μόριο. Γνωρίζετε ακόμη ότι η πουρίνη που σχηματίζει δυο δεσμούς υδρογόνου και συμμετέχει στο μεταγράψιμο τμήμα, του γονιδίου Α στην μη κωδική αλυσίδα, αποτελεί το 20% του κλώνου αυτού, στο γονίδιο Α.

Ο λόγος A+T/G+C του γονιδίου Α είναι (στον μη κωδικό κλώνο) στο τμήμα που αντιπροσωπεύεται στο προϊόν της μεταγραφής, μετά την ολοκλήρωση της διαδικασίας.

α. περίπου 7/3

β.1

γ. περίπου ½

δ. περίπου 2/3

ε. Δεν υπολογίζεται

  1. Για την μεταγραφή αυτού του γονιδίου απαιτήθηκε να ξετυλιχθούν 14 νουκλεοσώματα, στα οποία συμπεριλαμβάνονται και εκείνα στα σημεία Μ και Ν, που φαίνονται στην εικόνα 1. Το μήκος του RNA που παράχθηκε αποτελείται από 2746 νουκλεοτίδια. Το χρωμόσωμα έχει μήκος 2 χ 106 ζ.β. και ξεκινάει και τελειώνει με νουκλεόσωμα.  Ποιο είναι το πλήθος των ιστόνων που απαιτούνται για το πακετάρισμα του;

α.  περίπου 2 χ 104

β. περίπου 16 χ 104

γ. περίπου 8 χ 104

δ. 32 χ 104

ε. περίπου 106

  1. Το μεταφράσιμο τμήμα του γονιδίου Α αποτελείται από 600 κωδικόνια. Η 5’ αμετάφραστη περιοχή του, προκαλεί τη δημιουργία συμπλόκου έναρξης με τέτοιο ρυθμό ώστε το αμέσως προηγούμενο ριβόσωμα να έχει ήδη μεταφράσει 10 κωδικόνια μέχρι να συνδεθεί το επόμενο μόριο tRNA σε αυτό . Πόσα   πλήρη ριβοσώματα θα αποτελούν το πολύσωμα του mRNA του γονιδίου Α όταν το πρώτο ριβόσωμα έχει ολοκληρώσει την πολυπεπτιδική αλυσίδα;

α. 60

β.65

γ. 66

δ. 59

ε. 66,6

  1. Η θέση Ε που φαίνεται στο σχήμα έχει την αλληλουχία:

5’ ——————–GGAATTCC——————-3’

3’———————CCTTAAGG——————5’

Α. Υπάρχει η περιοριστική ενδονουλεάση MdI, η οποία αναγνωρίζει την παραπάνω αλληλουχία οκτώ νουκλεοτιδίων και πέμπτει τους φωσφοδιεστερικούς δεσμούς 5’-G-G-3’ καθώς και τους 14 δεσμούς υδρογόνου μεταξύ των παρεμβαλλόμενων ζευγών βάσεων. Πάσα διαφορετικά τμήματα που περιέχουν το γονίδιο Α προκύπτουν μετά την πέψη του χρωμοσώματος με τα ένζυμα EcoRI και MdI, ταυτόχρονα;

α. 1

β.2

γ. 3

δ. 4

ε. Κανένα.

Β. Το διπλανό πλασμίδιο χρησιμοποιήθηκε ως φορέας κλωνοποίησης του τμήματος Α. Πόσα διαφορετικά ανασυνδυασμένα πλασμίδια μπορούν να προκύψουν;

Δίνεται ο φορέας κλωνοποίησης  που θα χρησιμοποιηθεί.

Επαναληπτικό 1-2-4-7-02

 

α. 1

β. 2

γ. 3

δ.4

ε. Κανένα.

Ζήτημα 2.                                                                                           Μονάδες 25

  1. Να αναφέρετε τους λόγους για τους οποίους το βακτήριο Ε. coli χρησιμοποιείται ως οργανισμός μοντέλο της Μοριακής Βιολογίας. (μόρια 4)
  2. Εξηγήστε για ποιο λόγο προσθέτουμε αζωτούχες και φωσφορικές ενώσεις στις πετρελαιοκηλίδες που πρόκειται να «καθαριστούν» με την δράση μικροοργανισμών οι οποίοι μεταβολίζουν το πετρέλαιο.  (μόρια 5)
  3. Κατατάξτε τα γονίδια των οργανισμών ως προς τη θέση τους στο κύτταρο και ως προς τη θέση του γενετικού τους τόπου. (μόρια 5)
  4. Στην εικόνα 1 φαίνεται ένα μέρος μιας βιολογικής διαδικασίας που βρίσκεται σε εξέλιξη.

CUCUUTCT

GAGAAACATGCATACGAC                    Εικόνα 1

α. Να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας.               (μόρια 2)

β. Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1. (μόρια 3)

γ. Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού.              (μόρια 1)

  1. Τα παρακάτω βήματα περιγράφουν μια εργαστηριακή καλλιέργεια μικροοργανισμών. Να τοποθετήσετε τα βήματα στη σωστή σειρά, γράφοντας μόνο τον αντίστοιχο αριθμό. α.προετοιμασία κατάλληλων θρεπτικών υλικών β. εμβολιασμός μικρής ποσότητας του μικροοργανισμού γ. απομόνωση οργανισμού στο εργαστήριο δ. ανάπτυξη καλλιέργειας σε κατάλληλες συνθήκες ε. αποστείρωση θρεπτικών υλικών και μέσων.           (μόρια 5)

Ζήτημα 3.                                                                                                    Μονάδες 25

  1. Δίνονται τα παρακάτω τρία σχήματα, δυο από αυτά αφορούν ακριβώς το ίδιο τμήμα ενός κλώνου ενός μορίου DNA σε διαφορετικές χρονικές στιγμές του κυτταρικού κύκλου ενός ευκαρυωτικού κυττάρου, στο οποίο ανήκει αυτός ο κλώνος DNA. Το τρίτο σχήμα αφορά την ίδια ακριβώς διαδικασία με μια από τις δυο διαδικασίες in vivo που δίνονται. Η διαδικασία που παριστάνεται στο τρίτο σχήμα πραγματοποιείται in vitro.

 

Επαναληπτικό 1-2-4-7-03

Α. Ποιες διαδικασίες αφορούν τα σχήματα 1, 2 και 3;

Β. Να ονομάσετε τις πρωτεΐνες α,β,γ,δ και ε.

Γ. Ποια είναι η λειτουργία του σημείου 1 στο μόριο του DNA;

Ποιες διαφορές γνωρίζετε μεταξύ των σημείων 1 στο μόριο του DNA ανάμεσα στους προκαρυωτικούς και τους ευκαρυωτικούς οργανισμούς;

Υπάρχουν διαφορές μεταξύ των δυο κατηγοριών οργανισμών που αναφέρθηκαν και για τις πρωτεΐνες α, που αναγνωρίζουν τα σημεία όπως το 1;

Δ. Τι είδους βιολογικά μακρομόρια είναι οι κλώνοι ι και ιι καθώς και ιιι;

Ποια δομική διαφορά εντοπίζεται μεταξύ των κλώνων ι και ιιι;

Ε. Ποιες πρωτεΐνες έδρασαν και ποιες πρόκειται να δράσουν ακόμη εκατέρωθεν του σημείου 2;

ΣΤ. πόσες πρωτεΐνες έδρασαν στο σημείο 3; Ονομάστε τις πρωτεΐνες αυτές.

Ζ. Ποιες από τις πρωτεΐνες που εμφανίζονται στα σχήματα εκτελούν εργασίες που έχουν το ίδιο τελικό αποτέλεσμα;

Η. Σε ποιο από τα τρία σχήματα γνωρίζετε ότι ένα προκαρυωτικό ένζυμο  «διαβάζει» ευκαρυωτικό γενετικό υλικό;

Θ. Ποια από τις διαδικασίες που φαίνονται στα σχήματα εκτελείται μια φορά στο δεδομένο τμήμα DNA, στην ζωή του κυττάρου;

Ι. Εξηγήστε τις πρακτικές εφαρμογές που βρίσκει η διαδικασία η οποία εκτελείται in vitro.                                                                                         (μόρια 1.5, 1.5, 1, 2, 2, 1, 2, 1, 1, 1)

  1. Σε ένα εργαστήριο Μοριακής Βιολογίας, επαναλήφθηκαν τα πειράματα που απέδειξαν τον μετασχηματισμό των προκαρυωτικών κυττάρων.

Οι οργανισμοί μελετήθηκαν με σύγχρονα μέσα και τεχνικές που μας παρέχει η τεχνολογία του ανασυνδυασμένου DNA.

Οι επιστήμονες δημιούργησαν την γονιδιωματική βιβλιοθήκη των δυο στελεχών του βακτηρίου D. pneumoniae και απομόνωσαν το γονίδιο που κωδικοποιεί για την πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος στα λεία στελέχη.

Στην συνέχεια με τεχνικές Γενετικής Μηχανικής μετασχημάτισαν ένα πληθυσμό από αδρά στελέχη του βακτηρίου. Από τον πληθυσμό που μετασχηματίστηκε και τον αρχικό πληθυσμό των λείων βακτηρίων, λήφθηκε δείγμα κυττάρων, στο οποίο πραγματοποιήθηκε PCR για την ενίσχυση του γονιδίου που ελέγχει για το κάλυμμα, από το γονιδίωμα των βακτηρίων. Τα αποτελέσματα αναλύθηκαν και πήραμε τα εξής:

Επαναληπτικό 1-2-4-7-04

 

Α. Ποιο από τα βακτηρία που αναλύθηκαν είναι το αδρό , ποιο το λείο και ποιο το μετασχηματισμένο αδρό σε λείο;                                                                         (μόρια 1,5)

Β. Δίνεται ο ένας από τους δύο κλώνους του γονιδίου που ενισχύθηκε και δυο μόρια tRNA που μετείχαν στην μετάφραση του.

5′ …TCAATTAGTGTACCCTTTATGATCACCTGGGTACATTGATTAGAT…3′

3′ UUA5′ και 5′ GUA 3′  τα αντικωδικόνια των δυο μορίων tRNA .

Ο κλώνος που δίνεται είναι ο κωδικός ή ο μη κωδικός του γονιδίου;

Αιτιολογήστε την απάντηση σας.                                                                           (μόρια 1 και 1,5)

Γ. Γνωρίζετε ότι μεταξύ της αλληλουχίας αναγνώρισης του mRNA από την μικρή ριβοσωμική υπομονάδα και του κωδικονίου έναρξης υπάρχουν τέσσερα νουκλεοτίδια της 5′ αμετάφραστης περιοχής. Ποια θα είναι η αλληλουχία της κωδικής αλυσίδας του γονιδίου rRNA που θα συνδέεται με το μόριο mRNA το οποίο θα προκύπτει κατά την μεταγραφή του δοθέντος γονιδίου;                                                                                                                  (μόρια 1)

Δ. Τα αδρά στελέχη του D. pneumoniae,  που χρησιμοποιήθηκαν για να μετασχηματιστούν δεν διαθέτουν πλασμίδια και είναι ανθεκτικά στο αντιβιοτικό τετρακυκλίνη (tet). Οι ερευνητές είχαν στην διάθεσή τους, τους παρακάτω φορείς κλωνοποίησης.

Ποιον  μπορούν επιλέξουν για να επιτύχουν τον μετασχηματισμό;

Αιτιολογείστε την απάντηση σας.                                                                            (μόρια 1 και 2,5)

 

Επαναληπτικό 1-2-4-7-05

Όπου: Polilynker: Πολλές, διαδοχικές, αλληλεπικαλυπτόμενες, μοναδικές θέσεις αναγνώρισης περιοριστικών ενδονουκλεασών. Τουλάχιστον μια από αυτές είναι κατάλληλη για την ένθεση του επιθυμητού γονιδίου.

Ε. Τα ανασυνδυασμένα βακτήρια καλλιεργήθηκαν στο εργαστήριο και πήραμε τις παρακάτω καμπύλες: Βιομάζα = f(t) και Πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος = f(t).

Επαναληπτικό 1-2-4-7-06

 

Γνωρίζουμε ότι το γονίδιο του λείου πνευμονιόκοκκου που ανασυνδυάστηκε, διαθέτει μια θέση περιορισμού NdeI, εντός του μεταφράσιμου τμήματος του. Μια καλλιέργεια,  όπως η παραπάνω (διάγραμμα 2), παρουσίασε την εξής εικόνα ως προς την παραγωγή της ετερόλογης πρωτεΐνης από τα μετασχηματισμένα αδρά στελέχη.

Μέτα από την απομόνωση των κυττάρων της καλλιέργειας και στη συνέχεια την απομόνωση των γονιδίων από τους πλασμιδιακούς φορείς κλωνοποίησης και στην  περαιτέρω πορεία πέψης του γονιδίου που ευθύνεται για το κάλυμμα των λείων στελεχών του πνευμονιόκοκκου από την NdeI, έδειξε ότι τα μισά γονίδια μπορούσαν να κοπούν και τα άλλα μισά όχι. Εξηγήστε σύντομα το φαινόμενο. Είναι γνωστό ότι  η καλλιέργεια δεν εκτέθηκε σε κανέναν  εξωγενή μεταλλαξιγόνο παράγοντα και  θεωρούμε ότι σε κάθε κύτταρο ξενιστή εισέρχεται μόνο ένα πλασμίδιο φορέας κλωνοποίησης, το οποίο αντιγράφεται μόνο μια φορά εντός του ξενιστή του.                                                    (μόρια 2,5)

Ζήτημα 4ο                                                                                                   Μονάδες 25

  1. Ένα στέλεχος E. coli, μετασχηματίζεται με το γονίδιο που ευθύνεται για το κάλυμμα (κάψα) του λείου στελέχους του πνευμονόκοκκου. Για τον μετασχηματισμό χρησιμοποιήθηκαν τρεις διαφορετικοί φορείς κλωνοποίησης, όπως φαίνονται παρακάτω και δημιουργηθηκαν τρεις διαφορετικες υγρες καλλιεργειες των μετασχηματισμενων κυτταρων που η καθεμιά έχει μετασχηματιστεί με διαφορετικό  φορέα κλωνοποίησης. Οι καλλιέργειες αναπτύσσονται αρχικά σε γλυκόζη και μετά την εξάντληση της, η αύξηση της κάθε καλλιέργειας συνεχίζεται με λακτόζη. Σε ποια χρονική στιγμή αναμένεται να εκφράζεται η ετερόλογη πρωτεΐνη σε καθεμιά από τις τρεις καλλιέργειες;

Επαναληπτικό 1-2-4-7-08

2.

Επαναληπτικό 1-2-4-7-07

2. Δίνονται οι παραπάνω καμπύλες α, β, γ που αφορούν τρεις διαφορετικές υγρές καλλιέργειες. Ποια από αυτές αντιστοιχεί στην αύξηση της καλλιέργειας E. coli, σε υγρό θρεπτικό υλικό με πηγή άνθρακα  λακτόζη, ποια με γλυκόζη και ποια με γαλακτόζη. Γνωρίζεται ότι σε κάθε μια από τις καλλιέργειες η πηγή άνθρακα βρίσκεται σε ίσες συγκεντρώσεις  με τις υπόλοιπες καλλιέργειες που εξετάζονται;

Δίνεται ακόμη ότι το βακτήριο E. coli, μπορεί να προσλάβει και να μεταβολίσει την γαλακτόζη. Η γαλακτόζη εντός του κυττάρου μετατρέπεται μετά από τρία μεταβολικά βήματα σε 6-φωσφόρο-γλυκόζη που αποτελεί το προϊόν και του πρώτου μεταβολικού βήματος της καταβολικής οδού διάσπασης της γλυκόζης στο κύτταρο.