Αρχείο κατηγορίας Θέματα Πανελληνίων

Λυμένα θέματα πανελληνίων εξετάσεων παρελθόντων ετών

Λύσεις Βιολογίας θετικού προσανατολισμού Πανελληνίων εξετάσεων 2017 – Ημερήσια

Βιολογία Ομάδας Θετικού Προσανατολισμού

ΘΕΜΑΤΑ 2017 ΗΜΕΡΗΣΙΑ ΓΕΛ

ΘΕΜΑ Α

Οι ζητούμενες απαντήσεις, είναι :

A1: δ , Α2 : δ , Α3 : β , Α4 : γ , Α5 : α

ΘΕΜΑ Β

B1

Ι → Α

Ι Ι → Ε

ΙΙΙ → ΣΤ

ΙVB

VZ

VI →Γ

VII → Δ

Β2

Η δοθείσα εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο.

Αιτιολόγηση : Γνωρίζουμε ότι στα προκαρυωτικά κύτταρα οι διαδικασίες της μεταγραφής ενός γονιδίου που κωδικοποιεί για μόριο mRNA και της μετάφρασης αυτού του μορίου mRNA, συμβαίνουν ταυτόχρονα. Δηλαδή, πριν ολοκληρωθεί η μεταγραφή, έχει ήδη ξεκινήσει η μετάφραση του νεοσυντιθέμενου μορίου mRNA καθώς είναι άμεσα δυνατή η πρόσδεση της μικρής ριβοσωμικής υπομονάδας στην 5′ αμετάφραστη περιοχή του mRNA. Αυτό είναι δυνατό καθώς τα βακτηριακά κύτταρα δεν διαθέτουν πυρηνική μεμβράνη και επομένως το μόριο DNA βρίσκεται στο κυτταρόπλασμα στην περιοχή του πυρηνοειδούς μαζί με τα ριβοσώματα, τα οποία είναι τα ειδικά σωματίδια του κυττάρου, που μαζί με άλλα μόρια (π.χ tRNA , rRNA κ.α ) και αρκετή ενέργεια πραγματοποιούν την διαδικασία της πρωτεϊνοσύνθεσης του κυττάρου.

Β3

Το ιδανικό φάρμακο είναι εκείνο που δεν επιφέρει καμία παρενέργεια στον οργανισμό ενώ ταυτόχρονα θεραπεύει αποτελεσματικά. Το ιδανικό φάρμακο είναι τα αντισώματα.

Τα αντισώματα είναι πρωτεϊνικά μόρια που παράγει ο οργανισμός των θηλαστικών (και των πτηνών) και έχουν την δυνατότητα να συνδέονται εκλεκτικά με ένα ορισμένο τμήμα ( αντιγονικός καθοριστής ) ενός ξένου προς τον οργανισμό σώματος (αντιγόνο).

Το αντιγόνο είναι ξένη προς τον οργανισμό ουσία που μπορεί να προκαλέσει ανοσολογική απόκριση, δηλαδή παραγωγή από τον οργανισμό ειδικών κυττάρων (λεμφοκυττάρων) και κυτταρικών προϊόντων ( π.χ αντισώματα) που θα δράσουν για την εξουδετέρωση του.

Τα αντισώματα παράγονται από τα Β-λεμφοκύτταρα του οργανισμού, κάθε διαφορετικό Β-λεμφοκύτταρο παράγει συγκεκριμένο διαφορετικό αντίσωμα, κατάλληλο για την αναγνώριση και την σύνδεση του μ’ έναν συγκεκριμένο αντιγονικό καθοριστή. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων είναι όλα όμοια μεταξύ τους και ονομάζονται μονοκλωνικά αντισώματα.

Τα μονοκλωνικά αντισώματα βρίσκουν πολλές εφαρμογές ως διαγνωστικά εργαλεία στην Βιολογία και την Ιατρική. Τα μονοκλωνικά αντισώματα δεν μπορούν να παραχθούν σε μεγάλες ποσότητες από τα Β-λεμφοκύτταρα όταν αυτά αναπτύσσονται σε κυτταροκαλλιέργειες in vitro καθώς τα φυσιολογικά Β – λεμφοκύτταρα (κυτταρική σειρά) δεν μπορούν να διαιρεθούν περισσότερες από 50 με 70 φορές, μιτωτικά, στην κυτταροκαλλιέργεια.

Προκειμένου λοιπόν να παραχθούν τα μονοκλωνικά αντισώματα που θέλουμε σε μεγάλες ποσότητες, πρέπει να συντηχθούν τα ειδικά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα (τα κύτταρα αυτά έχουν παραχθεί σε ένα ποντίκι εμβολιασμένο με τον επιθυμητό αντιγονικό καθοριστή, το οποιο πραγματοποιεί πρωτογενή ανοσοβιολογική απόκριση εναντίον αυτού του αντιγονικού καθοριστή) με καρκινικά Β-λεμφοκύτταρα ποντικού (μυέλωμα). Τα κύτταρα που προκύπτουν από την σύντηξη, ονομάζονται υβριδώματα και εμφανίζουν τις δύο ιδιότητες που θέλουμε, να παράγουν τα επιθυμητά αντισώματα και να διαιρούνται για πολύ περισσότερες φορές από 50-70 διαιρέσεις σε κυτταροκαλλιέργεια in vitro. Η τελευταία ιδιότητα είναι ιδιότητα των καρκινικών κυττάρων.

Έτσι προκειμένου να παράγουμε μονοκλωνικά αντισώματα που αναγνωρίζουν και συνδέονται με την χορειακή γοναδοτροπίνη του ανθρώπου ώστε να δημιουργήσουμε ένα ευαίσθητο διαγνωστικό έλεγχο για την εγκυμοσύνη στα πρώτα στάδια της, πρέπει :

α) Να χορηγήσουμε με ένεση σ’ ένα υγιές ποντίκι, ανθρώπινη χορειακή γοναδοτροπίνη, που έχουμε απομονώσει από γυναίκα που είναι έγκυος στα πρώτα στάδια της εγκυμοσύνης. Θεωρούμε δεδομένο ότι το ποντίκι δεν παράγει χορική γοναδοτροπίνη όμοια με του ανθρώπου, ώστε η ανθρώπινη ορμόνη να λειτουργήσει ως αντιγόνο σε αυτό. Επίσης, το ποντίκι που εμβολιάστηκε με την ανθρώπινη ορμόνη, ζει σε στείρο περιβάλλον ώστε να μην παράγει κατά το δυνατό αλλά αντισώματα, διαφορετικά από τα ζητούμενα, ώστε να διευκολυνθούμε στην απομόνωση των κατάλληλων Β-λεμφοκυττάρων

β) 15 μέρες μετά τον εμβολιασμό του, όταν έχει μεγιστοποιηθεί η ανοσολογική πρωτογενής αντίδραση του ποντικιού έναντι της ανθρώπινης ορμόνης, από το ποντίκι αφαιρείται ο σπλήνας του. Ο σπλήνας είναι δευτερογενές λεμφικό όργανο των θηλαστικών, στο οποίο πραγματοποιείται η ανοσολογική απόκριση .Επομένως, στον σπλήνα θα υπάρχουν πολλά Β-λεμφοκύτταρα του ποντικιού που παράγουν το επιθυμητό αντίσωμα.

γ) Από τον σπλήνα του ποντικιού απομακρύνονται τα επιθυμητά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα .

δ) Τα κατάλληλα Β-λεμφοκύτταρα του ποντικιού συντήκονται με καρκινικά Β-λεμφοκύτταρα ποντικιού που αναπτύσσονται σε κυτταροκαλλιέργεια (μυέλωμα). Τα προϊόντα της κυτταρικής σύντηξης ονομάζονται υβριδώματα. Τα Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντισωμα δίνουν στο υβρίδωμα τη δυνατότητα να παράγει το επιθυμητό αντισωμα και τα καρκινικά κύτταρα προσδίδουν αθανασία.

ε) Από τα υβριδώματα που παράγονται κάποια ευαισθητοποιούνται με την ανθρώπινη χορειακή γοναδοτροπίνη, όποτε κλωνοποιούνται (μιτωτικά) και στην συνέχεια κατά ένα μέρος τους διαφοροποιούνται σε πλασματοκύτταρα, τα οποία παραγάγουν και εκκρίνουν μεγάλες ποσότητες του επιθυμητού αντισώματος ενώ τα υπόλοιπα φυλάγονται στην κατάψυξη (-800C) για μεταγενέστερη χρήση.

Τα παραγόμενα από τα κατάλληλα υβριδώματα, μονοκλωνικά αντισώματα, που αναγνωρίζουν την ανθρώπινη χορειακή γοναδοτροπίνη, μπορούν τώρα να χρησιμοποιηθούν ως διαγωνιστικά εργαλεία για τον έλεγχο της ύπαρξης κύησης, κυρίως σε γυναίκες που βρίσκονται στα πρώτα στάδια της εγκυμοσύνης.

Η λήψη αίματος από μια γυναίκα που επιθυμεί να μάθει αν είναι έγκυος και η χρήση των μονοκλωνικών αντισωμάτων για τον ποσοτικό και ποιοτικό προσδιορισμό της χορειακής γοναδοτροπίνης της, μας επιτρέπει να γνωρίζουμε αν είναι έγκυος (εφόσον διαθέτει την ορμόνη στο αίμα της, ποιοτικός έλεγχος) και σε ποια αρχική εβδομάδα της κύησης βρίσκεται (ανάλογα με την ποσότητα της ορμόνης που εντοπίστηκε) .

Β4

Η τεχνολογία του ανασυνδυασμένου DNA έχει δώσει τη δυνατότητα δημιουργίας γονιδιωματικών βιβλιοθηκών των οργανισμών.

Η γονιδιωματική βιβλιοθήκη ενός οργανισμού είναι το σύνολο των βακτηρικών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό (με άγαρ) και κάθε κλώνος φέρει ενσωματωμένο σε ένα μόριο φορέα κλωνοποίησης (πλασμίδιο ή DNA λ-φάγου αντιστοίχως) ένα ορισμένο τμήμα από το DNA του οργανισμού, του οποίου δημιουργούμε την βιβλιοθήκη.

Αυτό το τμήμα του DNA του οργανισμού δότη του γενετικού υλικού (δηλαδή του οργανισμού του οποίου δημιουργούμε την γονιδιωματική βιβλιοθήκη), υπάρχει σε πολλαπλά αντίγραφα σε κάθε κλώνο της βιβλιοθήκης, δηλαδη, το DNA του οργανισμού δότη έχει κλωνοποιηθεί.

Το σύνολο των κλώνων της γονιδιωματικής βιβλιοθήκης φέρει το σύνολο του γονιδιώματος του οργανισμού δότη (συνήθως χωρίς το μιτοχόνδριακό ή/και το χλωροπλαστικό DNA -το τελευταίο μόνο σε περίπτωση φυτικού οργανισμού- αναφερόμενο σε ευκαρυωτικό οργανισμό) σε πολλά διαφορετικά τμήματα σε πολλά αντίγραφα το κάθε τμήμα. Γονιδιωματικές βιβλιοθήκες δημιουργούνται και για προκαρυωτικούς και για ευκαρυωτικούς οργανισμούς.

Γνωρίζουμε ότι τα κύτταρα ενός πολυκυτταρικού οργανισμού φέρουν όλα τα ίδιο γενετικό υλικό (εκείνο το DNA, του ζυγωτού του οργανισμού αυτού) αφού όλα είναι προϊόντα μίτωσης του πρώτου διπλοειδούς κυττάρου (ζυγωτό) αυτού του οργανισμού. ‘Έτσι όλα τα απόγονα κύτταρα από την μίτωση κυττάρων που διαιρούνται, ενός ζωικού οργανισμού, όπως είναι τα μυϊκά και τα ηπατικά, θα φέρουν το ίδιο DNA (θεωρούμε ότι δεν έχουν συμβεί καινοφανείς μεταλλάξεις στα όργανα αυτά).

Η δημιουργία της γονιδιωματικής βιβλιοθήκης ενός οργανισμού περιλαμβάνει τα εξής βήματα:

Α) Απομόνωση κυττάρων του οργανισμού π.χ μυϊκά ή/και ηπατικά.

Β) Απομόνωση του DNA των κυττάρων αυτών, με λύση των κυττάρων.

Γ) Πέψη του DNA των κυττάρων αυτών με μία ορισμένη περιοριστική ενδονουκλέαση π.χ EcoRI. H περιοριστική ενδονουκλέαση αναγνωρίζει και κόβει με συγκεκριμένη φορά, μία ορισμένη δίκλωνη αλληλουχία DNA μήκους 4-8 ζευγών βάσεων. Η EcoRI για παράδειγμα αναγνωρίζει την δίκλωνη αλληλουχία:

5’GAATΤC3’

3’CTTAAG5’

και κόβει μεταξύ του G και του Α με προσανατολισμό 5’→3’ αφήνοντας αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα). Κάθε περιοριστικό ένζυμο δημιουργεί τέτοια κολλώδη άκρα όπως αυτά προκύπτουν με βάση την αλληλουχία αναγνώρισης DNA που αναγνωρίζει αυτό το ένζυμο. Για την EcoRI:

 

5’G 3′           5′ AATΤC3’

3’CTTAA 5′           3′G5’

AATT : κολλώδες άκρο Ι

TTAA : κολλώδες άκρο ΙΙ

Τα κολλώδη άκρα Ι και ΙΙ είναι συμπληρωματικά. Κάθε περιοριστικό ένζυμο κόβει το δίκλωνο DNA σε δυο φωσφοδιεστερικούς δεσμούς 3’→5’ και το ανάλογο πλήθος δεσμών υδρογόνου, σύμφωνα με την αλληλουχία αναγνώρισης του. Η ΕcoRI σπάει 8 δεσμούς υδρογόνου μεταξύ των 4 ζευγών βάσεων Α και Τ.

Δ) Απομόνωση κατάλληλου φορέα κλωνοποίηση, πλασμίδιο ή DNA φαγού λ και πέψη του φορέα κλωνοποίησης με το ίδιο περιοριστικό ένζυμο που χρησιμοποιήθηκε στο προηγούμενο βήμα, ώστε να δημιουργηθούν συμπληρωματικά κολλώδη άκρα .

Ε) Ανάμιξη και ανασυνδυασμός των τμημάτων DNA του οργανισμού δότη και των κομμένων φορέων κλωνοποίησης με την προσθήκη DNA δεσμάσης για την ένθεση – δημιουργία δυο 3′->5′ φωσφοδιεστερικων δεσμών ανα σημειο συνδεσης- ενός τμήματος DNA του οργανισμού δότη σε έναν φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακους φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου της καλλιέργειας (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών, για την ανάπτυξη αποικιών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Εφόσον σύμφωνα με τα δεδομένα της εκφώνησης τα ένζυμα και οι τεχνικές που χρησιμοποιούνται είναι ίδια τόσο για τη δημιουργία της βιβλιοθήκης του ηπατικού όσο και του μυϊκού κυττάρου, οι δύο γονιδιωματικές βιβλιοθήκες θα είναι ίδιες, εφόσον δεν φέρουν τα κύτταρα που απομονώσαμε από αυτά τα όργανα μεταλλάξεις.

cDNA βιβλιοθήκη ενός κυτταρικού τύπου ενός ευκαρυωτικού οργανισμού είναι το σύνολο των βακτηριακών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό και φέρουν σε πολλαπλά αντίγραφα, το ολικό ώριμο mRNA του κυτταρικού τύπου με τη μορφή δίκλωνου DNA ενσωματωμένο σε φορείς κλωνοποίησης (πλασμίδια ή DNA λ-φάγου, αντιστοίχως).

Η διαδικασία δημιουργίας της cDNA βιβλιοθήκης ενός κυτταρικού τύπου εν συντομία, είναι:

Α) Απομόνωση κυττάρων του κυτταρικού τύπου του οργανισμού π.χ μυϊκά ή ηπατικά στο κατάλληλο αναπτυξιακό στάδιο στην επιθυμητή φάση του κυτταρικού κύκλου των κυττάρων, στις επιθυμητές συνθήκες για τον οργανισμό.

Β) Απομόνωση του ολικού ώριμου mRNA των κυττάρων αυτών με ήπια λύση των κυττάρων.

Γ) Χρήση του ολικού ωρίμου mRNA ως καλούπι για την σύνθεση cDNA με την βοήθεια της αντίστροφης μεταγραφάσης.

Δ) Δημιουργία δίκλωνου DNA από το cDNA με την βοήθεια της DNA πολυμεράσης.

Ε) Ένθεση του δίκλωνου DNA, μετά από κατάλληλη κατεργασία, σε φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακούς φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους αντιστοίχως.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Η cDNA βιβλιοθήκη ενός κυτταρικού τύπου διαφέρει ανάλογα με το αναπτυξιακό στάδιο του οργανισμού καθώς και την φάση των κυττάρων του οργανισμού δότη, που έγινε η απομόνωση του ολικού ώριμου mRNA των κυττάρων του, εξαιτίας του γεγονότος ότι, διαφορετικά γονίδια εκφράζονται σε κάθε χρονική στιγμή.

Επίσης, η cNAD βιβλιοθήκες δύο διαφορετικών κυτταρικών τύπων του ίδιου οργανισμού, την ίδια χρονική στιγμή, διαφέρουν εξαιτίας της κυτταρικής διαφοροποίησης, δηλαδή της επιλεκτικής έκφρασης διαφορετικών γονιδίων από κάθε κύτταρο που ανήκει σε διαφορετικό κυτταρικό τύπο του ίδιου οργανισμού, όπως το ήπαρ και οι μύες, ώστε κάθε κύτταρο του κάθε κυτταρικού τύπου, να διαθέτει τις κατάλληλες πρωτεΐνες για την σωστή δομή και λειτουργία του, στο ορισμένο αναπτυξιακό στάδιο του οργανισμού και τις συνθήκες που επικρατούν στον οργανισμό και στο περιβάλλον του, έτσι ώστε να ανταποκριθούν καταλλήλως τα κύτταρα του κάθε κυτταρικού τύπου.

Βεβαίως κάθε κύτταρο ενός οργανισμού παράγει και πρωτεΐνες που είναι αναγκαίες για τις βασικές λειτουργίες του όπως π.χ τις λειτουργίες της μεταγραφής και της μετάφρασης καθώς και της αντιγραφής για τα μυϊκα και τα ηπατικά κύτταρα, τα οποία διαιρούνται. Επομένως, οι cDNA βιβλιοθήκες ενός ηπατικού και ενός μυϊκού κυττάρου αναμένεται να έχουν πολλούς διαφορετικούς κλώνους και ορισμένους κοινούς κλώνους.

ΘΕΜΑ Γ

Γ1

Θεωρούμε ότι η α1 αντιθρυψίνη που αναφέρεται στην εκφώνηση του ερωτήματος είναι η πρωτεΐνη του ανθρώπου που παράγεται στο ήπαρ και η έλλειψη της οδηγεί σε πνευμονικό εμφύσημα.

Γνωρίζουμε ότι μπορούμε σήμερα να δημιουργήσουμε διαγονιδιακά ζώα, δηλαδή ζώα, που με την τεχνολογία του ανασυνδυασμένου DNA, φέρουν ένα ετερόλογο γονίδιο, δηλαδή γονίδιο ενός άλλου είδους όπως παραδείγματος χάριν του ανθρώπου, στο γονιδίωμά τους. Τα ζώα αυτά χρησιμοποιούνται σήμερα ως εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών (gene farming) καθώς είναι δυνατή η έκφραση των ανθρώπινων γονιδίων από τα ζωικά κύτταρα.

Για να εκφράσει ένα γονίδιο πρέπει στα κύτταρα του κυτταρικού τύπου του ευκαρυωτικού οργανισμού οπου θα εκφράζεται αυτό το γονίδιο, να υπάρχουν οι κατάλληλοι μεταγραφικοί παράγοντες οι οποιοι αναγνωρίζουν και συνδέονται με τον υποκινητή του γονιδίου αυτού, δηλαδή του γονιδίου, που εκφράζεται. Μόνο όταν ο σωστός συνδυασμός μεταγραφικών παραγόντων έχει συνδεθεί στον υποκινητή του γονιδίου, είναι δυνατή η σύνδεση της RNA πολυμεράσης με τον υποκινητή του γονιδίου αυτού, ώστε να ξεκινήσει σωστά η μεταγραφή του.

Επίσης δεδομένου ότι ο γενετικός κώδικας είναι σχεδόν καθολικός, δηλαδή όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα και σε συνδυασμό με το γεγονός πως τα ριβοσώματα των οργανισμών μπορούν να χρησιμοποιηθούν ως θέσεις πρωτεινοσυνθεσης για οποιοδήποτε μόριο mRNA οποιουδήποτε οργανισμού ή ιού. Το ζωικό κύτταρο θα μπορεί να μεταφράσει το mRNA που θα προκύψει από την μεταγραφή του ανθρώπινου γονιδίου, το οποίο είναι ενσωματωμένο κατάλληλα στο γονιδίωμα του ζώου.

Ένα διαγονιδιακό ζώο που θέλουμε να παράγει την ανθρώπινη α1-αντιθρυψίνη στα μαστικά του κύτταρα, θα πρέπει να έχει δημιουργηθεί με τέτοιο τρόπο ώστε το ανθρώπινο γονίδιο που με μικροέγχυση έχει εισέλθει στο γονιμοποιημένο ωράριο του ζώου, να έχει τοποθετηθεί στο γονιδίωμα του ζώου με τέτοιο τρόπο, ώστε να βρίσκεται υπό τον έλεγχο του υποκινητή ενός γονιδίου του ζώου, το οποίο εκφράζεται αποκλειστικά στα μαστικά κύτταρα. Τέτοιο γονίδιο του ζώου, είναι το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος του ζώου.

Σύμφωνα με τα δεδομένα της εκφώνησης, το ανθρώπινο γονίδιο της α1-αντιθρυψίνη έχει τοποθετηθεί με το σωστό προσανατολισμό μέσα στο γονίδιο της καζεΐνης του γάλακτος του ζώου, δηλαδή η κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης έχει τοποθετηθεί με το 5’ άκρο της προς τον υποκινητή του γονιδίου της ζωικής καζεΐνης και συνεπώς η μη-κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης θα έχει το 3’άκρο της προς τον υποκινητή του γονιδίου της καζεΐνης του ζώου. Έτσι , κατά την μεταγραφή του γονιδίου της καζεΐνης του ζώου από την RNA πολυμεράση του ζώου, θα μεταγράφεται η μη κωδική αλυσίδα του γονιδίου της ανθρώπινης α1-αντιθρυψίνης. ‘Έτσι το ζωικό κύτταρο στη συνέχεια, μετά την μεταγραφή του γονιδίου της ανθρώπινης α1-αντιθρυψίνης, θα ωριμάσει αρχικά (αν το ανθρώπινο γονίδιο δεν έχει απομονωθεί από cDNA βιβλιοθήκη ανθρωπίνων ηπατικών κυττάρων) και θα μεταφράσει στη συνέχεια, το κατάλληλο mRNA για την παραγωγή της ανθρώπινης πρωτεΐνης σε πρόδρομη μορφή. Η λειτουργική πρωτεΐνη α1-αντιθρυψίνη του ανθρώπου, θα δημιουργηθεί από τους μετά-μεταφραστικούς μηχανισμούς του ζώου, που δεν διαφέρουν από εκεινους του ανθρώπου καθώς και τα δυο είδη είναι θηλαστικά.

Γ2

Μας δίνεται το δίκλωνο γραμμικό τμήμα DNA:

5’GAATTCCGCAAATTAA

3’CTTAAGGCGTTTAATT5’

To οποίο πέπτεται από το περιοριστικό ένζυμο ΕcoRI . Το περιοριστικό ένζυμο EcoRI αναγνωρίζει την δίκλωνη αλληλουχία

5’GAATTC3’

3’ CTTAAG5’

και κόβει με προσανατολισμό 5’→3’ μεταξύ του G και Α σπάζοντας τους φοσφωδιεστερικούς δεσμούς μεταξύ τους και ταυτόχρονα σπάει και τους 8 δεσμούς υδρογόνου μεταξύ των συμπληρωματικών ζευγών Α και Τ, αφήνοντας μονόκλωνες αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα).

Δηλαδή μετά την επίδραση της EcoRI το δοθέν τμήμα DNA πέπτεται ως εξής, εφόσον φέρει μοναδική θέση αναγνώρισης του περιοριστικού ενζύμου στα αριστερά.

ΕΙΚΟΝΑ Α

5’G3΄            5΄AATTCCGCAAATTAA

3’CTTAA5΄           3′ GGCGTTTAATT5’

3′ TTAA5’ KOΛΛΩΔΕΣ ΑΚΡΟ Ι

AATΤ ΚΟΛΛΩΔΕΣ ΑΚΡΟ ΙΙ

Η τεχνολογία του ανασυνδυασμένου DNA είναι το σύνολο των τεχνικών και των μεθόδων που μας επιτρέπουν την επέμβαση μας στο γενετικό υλικό των οργανισμών.

Μέσω της τεχνολογίας αυτής είναι δυνατή η ένθεση ενός γραμμικού δίκλωνου τμήματος DNA, που έχει κοπεί σε δύο σημεία με την ίδια περιοριστική ενδονουκλέαση, ώστε να φέρει στα δύο άκρα του συμπληρωματικά κολλώδη άκρα. Το τμήμα αυτό μπορεί να ενθεθει σ΄ ένα πλασμίδιο, όταν το πλασμίδιο έχει κοπεί σε μοναδικό σημείο από την ίδια περιοριστική ενδονουκλέαση ώστε να φέρει συμπληρωματικά κολλώδη άκρα στο σημείο τομής.

2017 Blog 8-9-01

Όπως προκύπτει από τις εικόνες Α και Β είναι αδύνατη η έκθεση του τμήματος που μας δίνεται σε πλασμίδιο που έχει κοπεί μία φορά με το ΕcoRI, καθώς το τμήμα που μας δίνεται διαθέτει μόνο μία φορά την αλληλουχία που αναγνωρίζεται από την ΕcoRI και επομένως φέρει ένα μονάχα κολλώδες άκρο στην μία ακριανή πλευρά του (εικόνα Α).

Η ένθεση του τμήματος που μας δίνεται θα ήταν εφικτή με το δοθέν πλασμίδιο, μονάχα αν ήταν δυνατό να προστεθεί το κατάλληλο κολλώδες άκρο, με την βοήθεια κατάλληλου ενζύμου, στο δεξιό άκρο του τμήματος μας.

Γ3

Σύμφωνα με τα δεδομένα της εκφώνησης έχουμε το παρακάτω γενεαλογικό δέντρο:

2017 Blog 8-9-01 extra 1

Η μελέτη της κληρονομικότητας στον άνθρωπο εμφανίζει πολλές δυσκολίες καθώς ο άνθρωπος δεν εμφανίζει τα χαρακτηριστικά του κατάλληλου οργανισμού μοντέλου για την Γενετική. Ο άνθρωπος έχει μεγάλο χρόνο γενεάς, αφήνει λίγους απογόνους και δεν επιδέχεται επιλεκτικές διασταυρώσεις. Επομένως, η μελέτη της Γενετικής του ανθρώπου γίνεται με την δημιουργία γενεαλογικών δέντρων, δηλαδή μιας διαγραμματικής απεικόνισης των γάμων και των γεννήσεων μιας οικογένειας για πολλές γενεές .

Σύμφωνα με τα δεδομένα της άσκησης μια γυναίκα (Γ1) παντρεύτηκε με δύο διαφορετικούς συζύγους στην διάρκεια της ζωής της και απέκτησε με τον καθένα από ένα παιδί .

Η γυναίκα έχει ομάδα αίματος 0, και ο ένας σύζυγος της έχει ομάδα αίματος ΑΒ (Σ1) ενώ ο άλλος έχει ομάδα αίματος Α (Σ2). Το παιδί Π1 έχει ομάδα αίματος 0 και το παιδί Π2 έχει ομάδα αίματος Β.

Γνωρίζουμε ότι η ταυτοποίηση των ομάδων αίματος του ανθρώπου μπορεί να γίνει με τη χρήση κατάλληλων διαγνωστικών εργαλείων, όπως είναι τα μονοκλωνικά αντισώματα.

Ένα άτομο με ομάδα αίματος 0 δεν εμφανίζει κανένα αντιγόνο ούτε Α, ούτε Β στην επιφάνεια των ερυθροκυττάρων του, επομένως κατά την ταυτοποίηση με αντι-Α-αντισώματα και αντί-Β-αντισώματα, δεν θα πραγματοποιηθεί ανοσολογική αντίδραση in vitro, μεταξύ των ερυθροκυττάρων του ατόμου και των αντί-Α και αντί-Β αντισωμάτων.

Ένα άτομο με ομάδα αίματος ΑΒ θα εμφανίζει στην επιφάνεια των ερυθροκυττάρων του και το αντιγόνο Α και το αντιγόνο Β και in vitro, θα εμφανίζει ανοσολογική αντίδραση με τα δυο διαφορετικά είδη αντισωμάτων που αναγνωρίζουν αυτά τα αντιγόνα. Ομοίως σκεπτόμενοι, άτομα με ομάδα αίματος Α αντιδρά ανοσολογικά μόνο με το αντι-Α-αντίσωμα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με τα αντί-Α-αντίσωματα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με το αντι-Β-αντίσωματα.

Γνωρίζουμε ότι το γονίδιο Ι που ελέγχει για τις ομάδες αίματος είναι αυτοσωμικό και έχει τρία πολλαπλά αλληλόμορφα τα ΙΑ, ΙΒ , και i . Τα ΙΑ και ΙΒ είναι συνεπικρατή μεταξύ τους και επικρατούν του i. Tο αλληλόμορφο ΙΑ κωδικοποιεί για μια πρωτεΐνη που μετατρέπει μια πρόδρομη ουσία σε αντιγόνο Α, το οποίο τοποθετείται στην επιφάνεια των ερυθροκυττάρων. Ομοίως το ΙΒ κωδικοποιεί την πρωτεΐνη που σχηματίζει το αντιγόνο Β, ενώ το αλληλόμορφο i δεν κωδικοποιεί για κάποια πρωτεΐνη. Έτσι άτομα με γονότυπο ΙΑ ΙΑ και ΙΑI έχουν φαινότυπο ομάδα αίματος Α. Τα άτομα με το γονότυπο ΙΒ ΙΒ ή ΙΒ i έχουν φαινότυπο ομάδα αίματος Β, άτομα γονότυπου ΙΑΙΒ έχουν φαινότυπο ομάδα αίματος ΑΒ και τέλος τα άτομα γονότυπου ii έχουν ομάδα αίματος 0.

Σύμφωνα με τα παραπάνω και με δεδομένο ότι κάθε γονέας κληροδοτέι ένα πλήρες απλοειδές γονιδίωμα σε κάθε απόγονο του σύμφωνα με τον 1ₒ νόμο του Μendel, ο οποίος αναφέρει ότι κατά τον σχηματισμό των γαμετών, τα αλληλόμορφα γονίδια διαχωρίζονται και κατανέμονται στους γαμέτες τυχαία μεν άλλα ισοπιθανα δε. Η γονιμοποίηση είναι τυχαίο γεγονός.

Έχουμε λοιπόν τις εξής δύο διασταυρώσεις :

  1. Ρ1 : Γ1 Χ Σ1

F1 : Παιδί Α

Δηλαδή : Ρ1 : ii × IA I B

γαμέτες : i, i / IA , IB

γαμέτες/ γαμέτες

IA

IB

i

IAi

IBi

i

IAi

IBi

Oι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών μιας διασταύρωσης και τρόπου συνδυασμού τους, μεταξύ τους.

Γονοτυπική αναλογία F1 γενεάς: IAi : IBi

Φαινοτυπική αναλογία F1 γενεάς: [ Α ] : [ B ]

Δηλαδή η γυναίκα αυτή μπορεί να αποκτήσει με τον σύζυγο 1, παιδιά με ομάδα αίματος Α ή με ομάδα αίματος Β. Δεν μπορεί να αποκτήσει παιδιά με ομάδα αίματος ΑΒ και παιδιά με ομάδα αίματος 0. Θεωρούμε ότι δεν εμφανίζονται νέες μεταλλάξεις και όλα συμβαίνουν φυσιολογικά.

Β) Ρ2 : Γ1 x Σ2

F1 : Παιδί Β

Δηλαδή : P2 : ii x IAIA ή P2 : ii x IA i

γαμέτες: i , i / IA , IA γαμέτες : i , i / IA , i

F1 :

γαμέτες/ γαμέτες

IA

IA

i

IAi

IAi

i

IAi

IAi

ή

F1 :

γαμέτες/ γαμέτες

IA

i

i

IAi

ii

i

IAi

ii

F1

Γονοτυπική αναλογία : 100% IAi                   ή                  Γονοτυπική αναλογία : ΙΑi : ii

Φαινοτυπική αναλογία : 100 % [A]                  ή                   Φαινοτυπική αναλογία : [Α] : [0]

Επομένως , αναλόγως με τον γονότυπο του συζύγου 2, η γυναίκα αυτή με τον άνδρα αυτό, μπορεί είτε να αποκτήσει μόνο παιδιά με ομάδα αίματος Α ή παιδιά με ομάδα αίματος Α και με ίση αναλογία παιδιά με ομάδα αίματος 0.

Επομένως, με βάση τις παραπάνω, το παιδί Π1 αφού έχει ομάδα αίματος 0 είναι παιδί του Σ2, ο οποίος θα έχει ομάδα αίματος Α και γονότυπο ΙΑi και το παιδί Π2, αφού έχει ομάδα αίματος Β είναι παιδί του Σ1.

Δηλαδή το γενεαλογικό δέντρο είναι :

2017 Blog 8-9-01 extra 2

Γ4

Γνωρίζουμε ότι όλοι οι μικροοργανισμοί όπως και όλα τα έμβια όντα απαιτούν για την ανάπτυξη τους πηγή άνθρακα (C) στο περιβάλλον τους σε κατάλληλες ποσότητες, αφού όλα τα βιολογικά μακρομόρια που δομούν τα κύτταρα (πρωτεΐνες, DNA, RNA, λιπίδια και υδατάνθρακες) αποτελούνται από C. Οι ετερότροφοι μικροοργανισμοί προμηθεύονται από τo περιβάλλον τους τον C, με μορφή οργανικών ενώσεων, ενώ οι αυτότροφοι προμηθεύονται από τον C από τον CO2 της ατμόσφαιρας.

Το βακτήριο E.coli είναι ετερότροφο και απαιτεί ως πηγή άνθρακα είτε γλυκόζη (κατά προτίμηση), είτε λακτόζη, είτε κάποιον άλλον υδατάνθρακα που θα μπορεί να τον μεταβολίσει. Οι Γάλλοι επιστήμονες, Jacob και Monod απέδειξαν ότι το βακτήριο E. coli μπορεί να μεταβολίζει την λακτόζη (δισακχαρίτης αποτελούμενος από γλυκόζη και γαλακτόζη) χάρη στην ύπαρξη στο γονιδίωμα του, του οπερονίου της λακτόζης.

Το οπερόνιο της λακτόζης, απέδειξαν οι Γάλλοι επιστήμονες, ότι αποτελείται από τρία γονίδια που ονομάζονται δομικά ( με τη σειρά: Ζ,Υ,Α) τα οποία βρίσκονται υπό τον έλεγχο του ίδιου υποκινητή. Την έκφραση των δομικών γονιδίων του οπερονίου ελέγχουν δύο ρυθμιστικές αλληλουχίες του. Η μία ονομάζεται χειριστής και βρίσκεται μεταξύ της αλληλουχίας του υποκινητή του οπερονίου, και του πρώτου δομικού γονιδίου Ζ του οπερονίου.

Η άλλη ρυθμιστική αλληλουχία της έκφρασης των δομικών γονιδίων του οπερονίου της λακτόζης, ονομάζεται ρυθμιστικό γονίδιο και βρίσκεται μπροστά από τον υποκινητή του οπερονίου. Το ρυθμιστικό γονίδιο διαθέτει τον δικό του υποκινητή και τις δικές του αλληλουχίες λήξης της μεταγραφής.

Το ρυθμιστικό γονίδιο εκφράζεται συνεχώς και κωδικοποιεί λίγα μόρια μιας πρωτεΐνης, που ονομάζεται πρωτεΐνη καταστολεας. Η πρωτεΐνη αυτή έχει τέτοια στερεοδιάταξη ώστε να αναγνωρίζει την αλληλουχία του χείριστη και να συνδέεται με αυτήν. Η σύνδεση του καταστολέα με τον χειριστή παρεμποδίζει την μεταγραφή των δομικών γονιδίων του οπερονίου της λακτόζης.

΄Όμως, όταν εντός του βακτηρικού κυττάρου υπάρχει λακτόζη, τότε ο ίδιος ο διασακχαρίτης συνδέεται με την πρωτεΐνη καταστολέα σε κατάλληλο σημείο της. Η συνδεση αυτή οδηγεί σε αλλαγή στην στερεοδιάταξη της πρωτεΐνης καταστολέα ώστε αυτή τώρα να μην μπορεί να συνδέεται πλέον με τον χειριστή του οπερονίου. Οπότε, η ίδια η λακτόζη λειτουργεί ως επαγωγέας της έκφρασης των δομικών γονιδίων του οπερονίου, που την καταβολίζει. Δηλαδή, όταν το βακτήριο αναπτύσσεται σε περιβάλλον με μόνη πηγή άνθρακα λακτόζη, εκφράζεται το οπερόνιο της λακτόζης, δηλαδή μεταγράφεται και μεταφράζεται. Με την μεταγραφή του παράγεται ένα μόριο mRNA που φέρει τρεις πληροφορίες για την σύνθεση τριών διαφορετικών πρωτεϊνών (με τη σειρά β-γαλακτοζιδάση, περμεάση, τρανσακετυλάση) κατά την μετάφρασή του, οι οποίες συμμετέχουν στον καταβολισμό της λακτόζης.

Σύμφωνα λοιπόν με τα παραπάνω μπορούμε να ερμηνεύσουμε το δοθέν διάγραμμα, με βάση το οποίο, λίγο πριν την χρονική στιγμή t1, η πηγή άνθρακα του θρεπτικού υλικού έχει εξαντληθεί. Τη χρονική στιγμή t1 προστίθεται λακτόζη στο θρεπτικό υλικό. Μέτα την προσθήκη λακτόζης παρατηρείται σιγμοειδής αύξηση (παρατηρήθηκε εκθετική αύξηση στην παραγόμενη από τα κύτταρα ποσότητα mRNA, μέχρι μία ορισμένη μέγιστη τιμή πέρα από την οποία η ποσότητα του mRNA/βακτήριο δεν αυξάνεται άλλο) στην καμπύλη μεταβολής της συνάρτησης mRNA ανά κύτταρο =f(t).

Μετά την προσθήκη της λακτόζης στην καλλιέργεια την χρονική στιγμή t1, το βακτήριο E.coli άρχισε να εκφράζει το οπερόνιο της λακτόζης και να παράγει το mRNA από την μεταγραφή του, ενώ ταυτόχρονα, επειδή το κύτταρο διαθέτει πλέον πηγή C και επομένως ενέργεια και υλικά για την κάλυψη των αναγκών του και για την σύνθεση των βιολογικών μακρομορίων του, εκφράζει εκτός από το οπερόνιο της λακτόζης και τα υπόλοιπα γονίδια που σχετίζονται με την ανάπτυξη κάθε βακτηρίου για το δεδομένο περιβάλλον όπου αναπτύσσεται. Η παραγωγή των μορίων mRNA θα φτάσει κάποια χρονική στιγμή την μέγιστη δυνατή τιμή πέρα από την οποία δεν μπορεί να αυξηθεί άλλο, αφού αυτές είναι οι μέγιστες ενδογενείς δυνατότητες των βακτηρίων της καλλιέργειας σε αυτό το δεδομένο περιβάλλον.

ΘΕΜΑ Δ

Δ1

Στο φυσιολογικό γονίδιο της αλυσίδας β της αιμοσφαιρίνης Α (HbA) αντιστοιχεί η αλληλουχία ΙΙΙ της δοθείσας εικόνας 4. Στο παθολογικό γονίδιο βς αντιστοιχεί η αλληλουχία Ι της εικόνας 4.

Αιτιολόγηση: Γνωρίζουμε ότι η αιμοσφαιρίνη Α (ΗbA) είναι μία πρωτεΐνη των ερυθρών αιμοσφαιρίων μας, υπεύθυνη για την μεταφορά του οξυγόνου (02 )στους ιστούς. Η αιμοσφαιρίνη Α αποτελείται από 4 πολυπεπτιδικές αλυσίδες 2α και 2β.

Οι αλυσίδες β της ΗbA κωδικοποιούνται από ένα αυτοσωμικό γονίδιο, το γονίδιο β, στο οποίο έχουν βρεθεί περισσότερα από 300 πολλαπλά παθολογικά αλληλόμορφα. Ένα παθολογικό αλληλόμορφο του γονιδίου β είναι το γονίδιο βς το οποίο κωδικοποιεί για τις αλυσίδες βς που συνδεόμενες ανά 2, με 2 αλυσίδες α, δίνουν την μεταλλαγμένη αιμοσφαιρίνη ΗbS, αιτία της ασθένειας της δρεπανοκυτταρικής αναιμίας μίας σοβαρής αυτοσωμικής υπολειπόμενης νόσου.

Η διαφορά της πολυπεπτιδικής αλυσίδας β (φυσιολογική) από της βς (παθολογική ) είναι το 6ο αμινοξύ των πολυπεπτιδίων όπου η β φέρει ως αμινοξύ γλουταμινικό οξύ και η βς φέρει βαλίνη.

Γνωρίζουμε ότι η μεταφορά της γενετικής πληροφορίας από το γονίδιο στην πολυπεπτιδική αλυσίδα γίνεται μέσω της μεταφοράς της πληροφορίας από την μία αλυσίδα του γονιδίου στο κινητό αντίγραφο της γενετικής πληροφορίας, που είναι ένα μονόκλωνο μόριo mRNA, μέσω της διαδικασίας μεταγραφής του γονιδίου. Αντίγραφό λοιπόν της κωδικής αλυσίδας του γονιδίου (που φέρει άμεσα την γενετική πληροφορία του γονιδίου) είναι ένα μόριο mRNA, το οποίο μεταφέρεται στα ριβοσώματα για την παραγωγή του πολυπεπτιδίου, μέσω ενός κώδικα αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών (γενετικός κώδικας) χάρη στα μόρια tRNA.

O Γενετικός κώδικας είναι:

α) Τρίλεπτας, τρία νουκλεοτίδια του mRNA κωδικοποιούν ένα αμινοξύ (κωδικόνιο).

β) Συνεχής , κατά την μετάφραση δεν παραλείπεται κανένα νουκλεοτίδιο.

γ) Μη επικαλυπτόμενος, κάθε νουκλεοτίδιο του mRNA που μεταφράζεται ανήκει μόνο σ ένα κωδικόνιο.

δ) Έχει κωδικόνιο έναρξης της μετάφρασης (ΑUG) και κωδικόνιο λήξης της μετάφρασης ένα εκ των (5΄’UAG3 , 5’UAA3, , UGA). Η μετάφραση σταματάει στα κωδικόνια λήξης καθώς δεν υπάρχουν μόρια tRNA με συμπληρωματικά αντικωδικόνια για αυτά τα κωδικόνια.

Σύμφωνα με την διαδικασία της μεταγραφής, το παραγόμενο μονόκλωνο μόριο mRNA, είναι όμοιο σε αλληλουχία και προσανατολισμό, αποτελούμενο βεβαίως από ριβονουκλεοτίδια, με τον ένα από τους δυο κλώνους του γονιδίου. Ο κλώνος αυτός του γονιδίου, ονομάζεται κωδικός και είναι αυτός που φέρει την γενετική πληροφορία όπως και το κινητό αντίγραφο του, το μόριο mRNA. Το μεταγράφημα (mRNA) προέκυψε από την μεταγραφή της συμπληρωματικής προς τον κωδικό κλώνο αλυσίδας του γονιδίου του κυττάρου, η αλυσίδα αυτή ονομάζεται μη κωδική και είναι αυτός ο κλώνος του γονιδίου που χρησιμοποιήθηκε από το ένζυμο της μεταγραφής δηλαδή, την RNA πολυμεράση ως καλούπι για την σύνθεση του mRNA. O κλώνος αυτός δεν φέρει κωδικόνια.

Η RNA πολυμεράση, κατά την μεταγραφή, συνδέεται στον υποκινητή του γονιδίου με την βοήθεια των κατάλληλων μεταγραφικών παραγόντων και ξετυλίγοντας την διπλή έλικα συνθέτει το μόριο RNA με καλούπι της, τη μη κωδική αλυσίδα του γονιδίου. Δημιουργείται έτσι ένα μόριο RNA με προσανατολισμό 5’→3’ , αφού το ένζυμο συνδέει τα ριβονουκλεοτίδια στο αναπτυσσόμενο RNA, με 3’→5’ φωσφοδιεστερικό δεσμό. Επομένως το mRNA που παράγεται κατά την μεταγραφή, έχει προσανατολισμό 5’→3’ με το 5’ άκρο του προς τον υποκινητή του γονιδίου, που μεταγράφεται. Όμοιο προσανατολισμό, έχει και η κωδική αλυσίδα του γονιδίου. Η μη-κωδική αλυσίδα του γονιδίου έχει αντιπαράλληλο προσανατολισμό.

Το αμινοξυ. γλουταμινικο οξύ, κωδικοποιείται απο το κωδικονιο 5’GAG3’ ενώ η βαλινη κωδικοποιείται από το κωδικόνιο 5’GTG3’.

Επομένως στις δοθείσες αλληλουχίες Ι , ΙΙ ,ΙΙΙ της εικόνας 4, προκειμένου να βρούμε την αλληλουχία του φυσιολογικού αλληλόμορφου β και του μεταλλαγμένου αλληλόμορφου βς θα αναζητήσουμε το κωδικόνιο έναρξης 5’ΑΤG3’ σ’ έναν από τους δύο κλώνους, της κάθε αλληλουχίας και για το γονίδιο β θα αναζητήσουμε και ως έβδομο κωδικόνιο το 5’GΑG3’ , ενώ για το παθολογικό αλληλομορφο βς ως έβδομο κωδικόνιο το 5’GTG3’. Γνωρίζουμε ότι κατά την μετα-μεταφραστική τροποποίηση που υφίσταται το παραγόμενο από τη μετάφραση πολυπεπτίδιο του συγκεκριμένου γονιδίου, αφαιρείται η αρχική μεθειονίνη από το αρχικό αμινικό άκρο, δηλαδή το έκτο αμινοξύ, τόσο στο λειτουργικό πολυπεπτίδιο β όσο και στο παθολογικό βς κωδικοποιήθηκε από το έβδομο κωδικόνιο στo mRNA.

Σύμφωνα λοιπόν με τα παραπάνω και τις δοθείσες αλληλουχίες I,II,III της εικόνας 4 παρατηρούμε ότι κωδικονιο έναρξης 5’ΑTG3’ υπάρχει μόνο στην πάνω αλυσίδα, στις αλληλουχίες Ι και ΙΙΙ και στην Ι αλληλουχία το 70 κωδικόνιο είναι το 5’GTG3’ άρα πρόκειται για το γονίδιο βς ενώ στην αλληλουχία ΙΙΙ το 70 κωδικόνιο είναι το GAG3’. Επομένως πρόκειται για το φυσιολογικό γονίδιο β.

Δ2

Η αλληλουχία της εικόνας 4 που απομένει είναι η αλληλουχία ΙΙ και θα μπορούσε να αντιστοιχεί σε γονίδιο που προκαλεί την β-θαλασσαιμία.

Αιτιολόγηση:

Γνωρίζουμε ότι ο γενετικός τόπος του γονιδίου β εμφανίζει περισσότερα από 300 πολλαπλά αλληλόμορφα. Εκείνα τα αλληλόμορφα που φέρουν τέτοια μετάλλαξη, η οποία έχει ως συνέπεια την παντελή έλλειψη της πολυπεπτιδικής αλυσίδας β, είτε έχει ως συνέπεια την μειωμένη παραγωγή της, τα αλληλόμορφα αυτά του γονιδίου β ευθύνονται για την β-θαλασσαιμία μια ασθένεια που εμφανίζει ετερογένεια συμπτωμάτων και προκαλείται από την απουσία ή την μειωμένη παρουσία της ΗbA στα ερυθροκυτταρα του ανθρωπου.

Ένα γονίδιο δεν εκφράζεται όταν δεν είναι δυνατή είτε η μεταγραφή είτε η μετάφραση του. Όταν ένα γονίδιο έχει υποστεί τέτοια μετάλλαξη (μόνιμη αλλαγή στην αλληλουχία του DNA του) που δεν φέρει κωδικόνιο έναρξης 5’ΑΤG3’ , τότε δεν μεταφράζεται το μόριο mRNA που προκύπτει από το γονίδιο αυτό, το οποίο μόριο mRNA αντιστοιχεί στην κωδική αλυσίδα του γονιδίου, όπως αποδείχθηκε στο προηγούμενο ερώτημα.

Παρατηρούμε ότι η αλληλουχία ΙΙ δεν φέρει τριπλέτα 5’ΑΤG3 στον πάνω κλώνο παρά μόνο στον κάτω. Ωστόσο, ο κάτω κλώνος δεν είναι η κωδική αλυσίδα του γονιδίου β, όπως αποδείχθηκε στο προηγούμενο ερώτημα. Συνεπώς, το παραγόμενο κατά την μεταγραφή μόριο mRNA αδυνατεί, να μεταφρασθεί για να παραχθεί το πολυπεπτίδιο β. Συνεπώς, η αλληλουχία β μπορεί να αντιστοιχεί σε ένα παθολογικό αλληλόμορφο γονίδιο β΄ του γονιδίου β, το οποίο παθολογικό β΄ ευθύνεται για την β-θαλασσαιμία.

Παρατηρούμε ότι οι τρεις αλληλουχίες Ι,ΙΙ,ΙΙΙ που μας δίνονται στην εικόνα 4 είναι πολλαπλά αλληλόμορφα του ίδιου γενετικού τόπου. Το αλληλόμορφο β΄( αλληλουχία ΙΙ) εμφανίζει σημειακή μετάλλαξη προσθήκης ενός ζεύγους βάσης ανάμεσα στο 8ο φυσιολογικό ζεύγος βάσεων και στο 90 ζεύγος βάσεων από αριστερά προς τα δεξιά, όπου το ζεύγος C-G έχει προστεθεί στην αλληλουχία ΙΙ .

C

III

G

Η μετάλλαξη αυτή οδηγεί στην κατάργηση του κωδικόνιου έναρξης, που υπάρχει φυσιολογικά στο γονίδιο β, μετά από έξι συνεχόμενες αδενινες, διαβάζοντας από τα αριστερά προς τα δεξιά τον πάνω κλώνο (κωδικό) στις αλληλουχίες Ι και ΙΙΙ που μας έχουν δοθεί και αντιστοιχούν σε τμήμα του 1ου εξωνίου του γονιδίου β της HbA. Αρα το mRNA μόριο που θα προκύψει από την μεταγραφή του γονιδίου β΄(αλληλουχία ΙΙ) δεν θα είναι δυνατόν να μεταφραστεί.

Δ3

α) Η θέση έναρξη της αντιγραφής βρίσκεται στην θέση Υ

β) Συνεχώς αντιγράφεται η αλυσίδα Α.

Ασυνεχώς Αντιγράφεται η αλυσίδα Β.

γ) Το πρωταρχικό τμήμα iii (5’ΑCGCCA3’) συντίθεται πρώτο.

Δ4

Γνωρίζουμε ότι τα άτομα που φέρουν ένα φυσιολογικό β αλληλόμορφο του γονιδίου β που κωδικοποιεί για την πολυπεπετιδικη αλυσίδα β της HbA και ένα παθολογικό υπολειπόμενο β’ ονομάζονται φορείς της ασθένειας της β θαλασσαιμιας και είναι φαινοτυπικά υγιείς σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Επίσης, ετερόζυγα άτομα με γονότυπο ββς , είναι φορείς της δρεπανοκυτταρικής αναιμίας και είναι φαινοτυπικα υγειή άτομα σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Η β-θαλασσαιμία, όπως και η δρεπανοκυτταρική αναιμία είναι δύο ασθένειες που ελέγχονται από το ίδιο γενετικό τόπο που εδράζεται σε αυτοσωμικό χρωμόσωμα. Η κάθε μία από τις παραπάνω ασθένειες είναι υπολειπόμενες (χαμηλά υψόμετρα) και ελέγχονται από διαφορετικά παθολογικά αλληλόμορφα του γονιδίου β που ευθύνεται για την σύνθεση των φυσιολογικών β-αλυσίδων της ΗbA.

Έστω λοιπόν ο γενετικός τόπος ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων όπου εδράζεται το γονίδιο β με πολλαπλά αλληλόμορφα (πάνω από 300). Το γονίδιο β είναι φυσιολογικό και επικρατεί έναντι των παθολογικών υπολειπόμενων αλληλόμορφων του β’ και του βς. Το αλληλόμορφο β ελέγχει την σύνθεση της φυσιολογικής β πολυπεπτιδικής αλυσίδας της ΗbA, το παθολογικό υπολειπόμενο αλληλόμορφο β’ ελέγχει για την παντελή έλλειψη παραγωγής της β αλυσίδας της ΗbA ή για την μειωμένη παραγωγή της, ενώ το παθολογικό υπολειπόμενο βς ελέγχει για την σύνθεση των βς αλυσίδων της ΗbS που προκαλεί την δρεπανοκυταρική αναιμία. Το αλληλόμορφο β’ ευθύνεται για την β-θαλασσαιμία.

Δηλαδή άτομα με γονότυπο ββ είναι υγιή, άτομα με γονότυπο ββς και ββ’ είναι υγιή και ετερόζυγα (φορείς) της δρεπανοκυτταρικής αναιμίας και την β-θαλασσαιμία αντίστοιχα. Τέλος άτομα με το γονότυπο β΄βς νοσούν από μικροδρεπανοκυτταρική αναιμία και άτομα με γονότυπο β’β’ νοσούν από β- θαλασσαιμία

Έχουμε λοιπόν την διασταυρώση :

P: ββ’ x ββς

Γαμέτες : β, β΄ / β, βς

Oι γαμέτες προκύπτουν σύμφωνα με τον 10 νόμο Mendel δηλαδή το νόμο του διαχωρισμού των αλληλόμορφων γονιδίων, σύμφωνα με τον οποίο τα αλληλόμορφα ενός γονιδίου διαχωρίζονται κατά την πρώτη μειωτική διαίρεση και κατανέμονται τυχαία αλλά ισοπίθανα στους γαμέτες. Η γονιμοποίηση είναι τυχαίο γεγονός.

F1 : Οι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών και του τρόπου συνδυασμού τους σε μία διασταύρωση.

F1 :

γαμέτες/ γαμέτες

β

β΄

β

ββ

ββ’

βς

ββς

βςβ’

Γονοτυπική αναλογία F1 : ββ : ββ’ : ββς : βςβ’

Δηλαδή από την διασταύρωση αυτή προκύπτουν είτε άτομα με γονότυπο ββ είτε με ββ’ είτε με ββς είτε άτομο που φέρει και τα δύο παθολογικά αλληλόμορφα.

Από τον ιστότοπο βιολογίας: www.nikimargariti.com.

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑ 1ο
Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως
5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την
ημιτελή πρόταση.
1. Η διπλή έλικα του DNA ξετυλίγεται κατά τη μεταγραφή από το ένζυμο
α. RNA πολυμεράση
β. DNA πολυμεράση
γ. DNA ελικάση
δ. DNA δεσμάση.
Μονάδες 5
2. Οι ιστόνες είναι
α. DNA
β. RNA
γ. πρωτεΐνες
δ. υδατάνθρακες.
Μονάδες 5
3. Ασθένεια που μπορεί να διαγνωστεί με καρυότυπο είναι
α. η φαινυλκετονουρία
β. η δρεπανοκυτταρική αναιμία
γ. η β-θαλασσαιμία
δ. το σύνδρομο Cri du chat.
Μονάδες 5
4. Σύνδεση κωδικονίου με αντικωδικόνιο πραγματοποιείται κατά την
α. αντιγραφή
β. μετάφραση
γ. μεταγραφή
δ. αντίστροφη μεταγραφή.
Μονάδες 5
5. Ο αλφισμός οφείλεται σε γονίδιο
α. αυτοσωμικό επικρατές
β. φυλοσύνδετο επικρατές
γ. αυτοσωμικό υπολειπόμενο
δ. φυλοσύνδετο υπολειπόμενο.
Μονάδες 5
ΘΕΜΑ 2ο
Να απαντήσετε στις παρακάτω ερωτήσεις:
1. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα για την επιλογή οργάνων συμβατών στις μεταμοσχεύσεις;
Μονάδες 6
2. Να περιγράψετε τη διαδικασία κλωνοποίησης με την οποία δημιουργήθηκε το πρόβατο Dolly.
Μονάδες 7
3. Πού οφείλεται η αυξημένη συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β-θαλασσαιμία σε χώρες όπου εμφανιζόταν ελονοσία;
Μονάδες 6
4. Να αναφέρετε ποια θρεπτικά συστατικά είναι απαραίτητα για να αναπτυχθεί ένας μικροοργανισμός σε μια καλλιέργεια.
Μονάδες 6
ΘΕΜΑ 3ο
Να απαντήσετε στα παρακάτω:
1. Μια αρσενική μύγα Drosophila με λευκά μάτια διασταυρώθηκε με μια θηλυκή με κόκκινα μάτια. Από τη διασταύρωση αυτή πήραμε 280 απογόνους στην F1 γενιά που είχαν όλοι κόκκινα μάτια. Διασταυρώνοντας δύο άτομα από την F1 γενιά προκύπτουν 319 απόγονοι στην F2 γενιά. Μια ανάλυση των απογόνων της F2 γενιάς έδειξε ότι υπάρχουν: 159 θηλυκά με κόκκινα μάτια, 82 αρσενικά με κόκκινα μάτια και 78 αρσενικά με λευκά μάτια. Με βάση τα δεδομένα να εξηγήσετε τον τρόπο με τον οποίο κληρονομείται το παραπάνω γνώρισμα.
Για τα άτομα που διασταυρώθηκαν δίνεται ότι τα θηλυκά έχουν ένα ζευγάρι X χρωμοσωμάτων (ΧΧ) και τα αρσενικά έχουν ένα Χ και ένα Υ χρωμόσωμα (ΧΥ). Να μη ληφθεί υπόψη η περίπτωση μετάλλαξης.
Μονάδες 5
Δίνεται το παρακάτω γενεαλογικό δέντρο, όπου απεικονίζεται ο τρόπος με τον οποίο κληρονομείται μια μονογονιδιακή ασθένεια. Τα άτομα ΙΙ2, ΙΙ3, ΙΙΙ3, και ΙV3 πάσχουν από την ασθένεια αυτή. Για όλα τα παρακάτω ερωτήματα να μη ληφθεί υπόψη η περίπτωση μετάλλαξης.
2012_1
2. Με βάση τα δεδομένα του γενεαλογικού δένδρου να εξηγήσετε τον τρόπο με τον οποίο κληρονομείται η ασθένεια.
Μονάδες 6
3. Να προσδιορίσετε την πιθανότητα το ζευγάρι ΙΙΙ1, III2 να αποκτήσει αγόρι που θα πάσχει
(μονάδα 1).
Να αιτιολογήσετε την απάντησή σας (μονάδες 7).
Μονάδες 8
4. Αν τα άτομα Ι1 και Ι4 πάσχουν από μια ασθένεια που οφείλεται σε γονίδιο μιτοχονδριακού DNA, να αναφέρετε ποια άτομα του γενεαλογικού δένδρου θα κληρονομήσουν το γονίδιο αυτό (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4).
Μονάδες 6
ΘΕΜΑ 4ο
Δίνεται το παρακάτω τμήμα βακτηριακού DNA, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο.
Αλυσίδα 1: G T T G A A T T C T T A G C T T A A G T C G G G C A T G A A T T C T C
Αλυσίδα 2: C A A C T T A A G A A T C G A A T T C A G C C C G T A C T T A A G A G
1. Να προσδιορίσετε την κωδική και τη μη κωδική αλυσίδα του παραπάνω τμήματος DNA, επισημαίνοντας τα 5΄ και 3΄ άκρα των αλυσίδων του (μονάδες 1).
Να αιτιολογήσετε την απάντησή σας (μονάδες 5).
Μονάδες 6
2. Το παραπάνω τμήμα DNA αντιγράφεται, και κατά τη διαδικασία της αντιγραφής δημιουρ-
γούνται τα παρακάτω πρωταρχικά τμήματα:
i) 5΄- G A G A A U U C -3΄
ii) 5΄- U U A A G C U A -3΄
iii) 5΄- G U U G A A U U -3΄
Να προσδιορίσετε ποια αλυσίδα αντιγράφεται, με συνεχή και ποια με ασυνεχή τρόπο
(μονάδες 1).
Να αιτιολογήσετε την απάντησή σας (μονάδες 5).
Μονάδες 6
3. To παραπάνω τμήμα DNA κόβεται με το ένζυμο EcoRI, προκειμένου να ενσωματωθεί σε ένα από τα δύο πλασμίδια Α και Β που δίνονται παρακάτω.
2012_2
Ποιο από τα δύο πλασμίδια θα επιλέξετε για τη δημιουργία ανασυνδυασμένου πλασμιδίου (μονάδα 1);
Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Πόσοι φωσφοδιεστερικοί δεσμοί θα διασπαστούν στο πλασμίδιο που επιλέξατε και πόσοι θα δημιουργηθούν κατά το σχηματισμό του ανασυνδυασμένου πλασμιδίου (μονάδες 2);
Μονάδες 7

4. Από τη μύγα Drosophila απομονώθηκαν τρία διαφορετικά φυσιολογικά κύτταρα στα οποία προσδιορίστηκε το μέγεθος του γονιδιώματος σε ζεύγη βάσεων. Στο πρώτο κύτταρο το μέγεθος του γονιδιώματος υπολογίστηκε σε 3,2 x108 ζεύγη βάσεων, στο δεύτερο κύτταρο σε 1,6 x 108 ζεύγη βάσεων και στο τρίτο κύτταρο σε 6,4 x 108 ζεύγη βάσεων. Να δικαιολογήσετε γιατί υπάρχουν οι διαφορές αυτές στο μέγεθος του γονιδιώματος των τριών κυττάρων.
Μονάδες 6

ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2012
ΘΕΜΑ 1o
Οι σωστές απαντήσεις είναι:
1. α
2. γ
3. δ
4. β
5. γ
ΘΕΜΑ 2o
1. Κάθε είδος αντισώματος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται από μια ομάδα όμοιων Β-λεμφοκυττάρων, που αποτελούν έναν κλώνο. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων ονομάζονται μονοκλωνικά. Τα μονοκλωνικά αντισώματα είναι πολύ σημαντικά στην Ιατρική, για την επιλογή οργάνων συμβατών για μεταμόσχευση. Τα κύτταρα των οργάνων έχουν στην επιφάνειά τους ειδικά αντιγόνα επιφανείας, που αναγνωρίζονται από ειδικά μονοκλωνικά αντισώματα. Με τα μονοκλωνικά αντισώματα μπορεί να γίνει έλεγχος των οργάνων δωρητών, για να διαπιστωθεί αν ταιριάζουν ανοσολογικά με τα αντίστοιχα των ασθενών. Έτσι, είναι δυνατόν να αποφευχθεί η απόρριψη και οι μεταμοσχεύσεις να είναι επιτυχείς.
2. Το πρόβατο Dolly δημιουργήθηκε, όταν ο πυρήνας ενός κυττάρου του μαστικού αδένα ενός εξάχρονου πρόβατου τοποθετήθηκε στο ωάριο ενός άλλου πρόβατου. Από το ωάριο είχε προηγουμένως αφαιρεθεί ο πυρήνας. Το έμβρυο το οποίο δημιουργήθηκε ύστερα από 3-4 διαιρέσεις εμφυτεύτηκε στη μήτρα θετής μητέρας-προβατίνας, η οποία γέννησε τη Dolly.
3. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β-θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής Αφρικής και της Ν. Α. Ασίας, όπου εμφανιζόταν ελονοσία. Η αυξημένη συχνότητα οφείλεται στην ανθεκτικότητα των φορέων στην προσβολή από το πλασμώδιο (πρωτόζωο) που προκαλεί την ελονοσία, επειδή τα ερυθροκύτταρά τους δεν ευνοούν τον πολλαπλασιασμό του. Συνεπώς, η προστασία που προσδίδει η μετάλλαξη ως προς την ελονοσία αποτελεί ένα πλεονέκτημα, που τους παρέχει αυξημένη πιθανότητα επιβίωσης και δυνατότητα αναπαραγωγής.
4. Όπως όλοι οι υπόλοιποι οργανισμοί, για να αναπτυχθεί ένας μικροοργανισμός είναι απαραίτητο να μπορεί να προμηθεύεται από το περιβάλλον στο οποίο αναπτύσσεται μια σειρά θρεπτικών συστατικών. Σ’ αυτά περιλαμβάνονται ο άνθρακας, το άζωτο, διάφορα μεταλλικά ιόντα και το νερό. Η πηγή άνθρακα για τους αυτότροφους μικροοργανισμούς είναι το CΟ2 της ατμόσφαιρας, ενώ για τους ετερότροφους διάφορες οργανικές ενώσεις όπως οι υδατάνθρακες. Η πηγή αζώτου για τους περισσότερους μικροοργανισμούς είναι τα αμμωνιακά ή τα νιτρικά ιόντα (ΝΟ3 -). Σήμερα οι μικροοργανισμοί οι οποίοι χρησιμοποιούνται για την παραγωγή χρήσιμων προϊόντων, όπως αντιβιοτικά ή ένζυμα, μπορούν να αναπτυχθούν στο εργαστήριο και σε μεγάλη κλίμακα στις βιομηχανικές μονάδες κάτω από αυστηρά ελεγχόμενες συνθήκες καλλιέργειας. Για την ανάπτυξή τους χρησιμοποιούνται τεχνητά θρεπτικά υλικά. Αυτά πρέπει να περιέχουν πηγή άνθρακα, πηγή αζώτου και ιόντα. Στην περίπτωση αερόβιων μικροοργανισμών, είναι απαραίτητη η παρουσία οξυγόνου. Τα θρεπτικά υλικά που χρησιμοποιούνται για την ανάπτυξη των μικροοργανισμών στο εργαστήριο μπορεί να είναι υγρά ή στερεά. Τα υγρά θρεπτικά υλικά περιέχουν όλα τα θρεπτικά συστατικά που αναφέρθηκαν προηγουμένως διαλυμένα σε νερό. Τα στερεά θρεπτικά υλικά παρασκευάζονται με ανάμιξη του υγρού θρεπτικού υλικού με έναν πολυσακχαρίτη που προέρχεται από φύκη, το άγαρ.

Προτεινόμενες απαντήσεις για τα θέματα των πανελλήνιων εξετάσεων στην βιολογία γενικής παιδείας ημερήσιων λυκείων 2012

ΘΕΜΑ Α

  1. β
  2. δ
  3. δ
  4. β
  5. α

ΘΕΜΑ Β

Β1. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.11 και κυρίως 18 του σχολικού βιβλίου.

Μεταξύ των παθογόνων μικροοργανισμών συγκαταλέγονται  και οι ιοί, που αποτελούν ακυτταρικές μη αυτοτελείς μορφές ζωής.

Η πολιομυελίτιδα είναι μια σοβαρή νόσος που προκαλείται από ιο, ο οποίος προσβάλλει τα νευρικά κύτταρα του νωτιαίου μυελού.

Οι πληροφορίες για την απάντηση αντλούνται από την σελ.39 του σχολικού βιβλίου.

« το εμβόλιο, όπως…μνήμης.»  Συνεπώς ένα άτομο εμβολιασμένο για τον ιο της πολιομυελίτιδας, την δεύτερη και κάθε επόμενη φορά που θα μολυνθεί από τον ιο αυτό, θα αντιδράσει με δευτερογενή ανοσοβιολογική απόκριση. « Στην περίπτωση…ότι  μολύνθηκε.»

Β2. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.104 και κυρίως 85 του σχολικού βιβλίου.

« Οι αυξανόμενες ενεργειακές ανάγκες… κλίμα του πλανήτη.»

Υπολογίζεται ότι η ποσότητα του διοξειδίου του άνθρακα που προστίθεται στην ατμόσφαιρα αυξάνεται με ρυθμό 0,3% το χρόνο με συνέπεια να εντείνεται το φαινόμενο του θερμοκηπίου.

Β3. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.47 του σχολικού βιβλίου.

« Ο ΗΙV… έλυτρο.»

Β5. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.48 του σχολικού βιβλίου.

«Αυτές είναι…σεξουαλική επαφή.»

ΘΕΜΑ Γ

Γ1. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.126 κυρίως, αλλά και από την  129 του σχολικού βιβλίου.

Οι δυο πληθυσμοί εμφανίζουν διαφορές στα χαρακτηριστικά τους εξαιτίας της δράσης της Φυσικής Επιλογής  σε αυτούς καθόλη την χρονική περίοδο που αυτοί επιβιώνουν και διαιωνίζονται σε διαφορετικά περιβάλλοντα (στις δυο μικρότερες λίμνες που προέκυψαν μετά το γεωλογικό γεγονός που έλαβε χώρα και που υποθέτουμε ότι οι δυο αυτές νέες λίμνες δεν επιτρέπουν με κανένα τρόπο την επικοινωνία των δυο πληθυσμών που καταμερίστηκαν σε αυτές).

Σύμφωνα με την θεωρία της Φυσικής Επιλογής του Δαρβίνου, η οποία αποτελεί την διαδικασία με την οποία οι οργανισμοί που είναι περισσότερο προσαρμοσμένοι στο περιβάλλον τους επιβιώνουν και αναπαράγονται περισσότερο από τους λιγότερο προσαρμοσμένους, γνωρίζουμε ότι ισχύει:

Συμπέρασμα 1. «Μεταξύ των οργανισμών …επιβίωσης.»

Παρατήρηση 3. « Τα άτομα…μελών τους.»

Παρατήρηση 4. «Τα περισσότερα…απογόνων τους.»

Συνεπώς οδηγούμαστε στο Συμπέρασμα 2. «Η επιτυχία…χαρακτηριστικά.»

« Επειδή οι διαφορές…περιβάλλον.»

Σύμφωνα με τα παραπάνω λοιπόν, καθώς τα άτομα του αρχικού πληθυσμού, ο οποίος μετά το γεωλογικό γεγονός που συνέβη κατανεμήθηκαν, όσα επιβίωσαν, στις μικρότερες, χωρίς να επικοινωνούν μεταξύ τους, νέες λίμνες, εμφάνιζαν ποικιλότητα σε πολλά χαρακτηριστικά τους, πολλά μάλιστα από τα οποία ήταν και κληρονομήσιμα και με δεδομένο ότι στην καθεμιά από τις δυο λίμνες επικρατούσαν διαφορετικές συνθήκες (πιέσεις περιβάλλοντος) που επέτρεπαν διαφορετικές ευκαιρίες επιβίωσης, θα πρέπει διαφορετικοί οργανισμοί (άτομα του πληθυσμού κάθε λίμνης) να επιλεγόταν από την Φυσική Επιλογή ως οι πιο κατάλληλα προσαρμοσμένοι στο εκάστοτε δεδομένο περιβάλλον (χώρο –χρονικά) κάθε λίμνης από τις δυο.

Ανάλογα με τις περιβαλλοντικές πιέσεις που ασκούνταν σε κάθε λίμνη από τις δυο, διαφορετικά άτομα του κάθε  πληθυσμού που βρισκόταν  σε αυτές μπορούσαν να επιβιώσουν ή /και να αναπαραχθούν. Τα άτομα που επιβίωναν και είχαν την δυνατότητα να διαιωνισθούν ήταν εκείνα που στον δεδομένο χρόνο στην κάθε λίμνη έφεραν εκείνα τα χαρακτηριστικά που αποδεικνύονταν περισσότερο προσαρμοστικά για το εκάστοτε περιβάλλον της κάθε λίμνης σε δεδομένο χρόνο. Καθώς όμως διέφεραν οι περιβαλλοντικές πιέσεις από λίμνη σε λίμνη διέφεραν και τα προσαρμοστικά χαρακτηριστικά των ατόμων των δυο πληθυσμών σε κάθε λίμνη στην ίδια χρονική στιγμή.

Γ2.  Οι πληροφορίες για την απάντηση αντλούνται από την σελ.126 και 129 του σχολικού βιβλίου.

Σύμφωνα με την δαρβινική θεωρία για την εξέλιξη των ειδών στον πλανήτη, ισχύει ότι:

Συμπέρασμα 3. «Τα ευνοϊκά…νέου είδους.»

Γνωρίζουμε ότι η φυσική επιλογή δρα επί του πληθυσμού καθώς η συσσώρευση πολλών νέων κληρονομήσιμων χαρακτηριστικών που έχουν εδραιωθεί σε έναν πληθυσμό μέσω διαδοχικών γενεών μπορεί να οδηγήσει τελικά στην εμφάνιση ενός νέου είδους.

Έτσι είναι δυνατόν σε κάθε μια από τις δυο λίμνες να εμφανιστεί ενα νέο είδος, τα δυο αυτά νεα είδη (ένα στην μια λίμνη και ένα στην άλλη), έχουν ως κοινούς προγόνους τα άτομα του αρχικού πληθυσμού που υπήρχε στην λίμνη πριν την γεωλογική δράση που δημιούργησε τις δυο ξεχωριστές λίμνες, στις οποίες κατανεμήθηκαν όσα από τα άτομα του αρχικού πληθυσμού επιβίωσαν αυτού του γεωλογικού γεγονότος.

Γ3.  Οι πληροφορίες για την απάντηση αντλούνται από την σελ. 73 του σχολικού βιβλίου.

Το οικοσύστημα της λίμνης Α καθώς εμφανίζει μεγαλύτερη ποικιλότητα (15 διαφορετικά είδη ψαριών) σε σχέση με το «οικοσύστημα» της λίμνης Β (3 διαφορετικά είδη ψαριών) αναμένεται να είναι περισσότερο ισορροπημένο καθώς γνωρίζουμε ότι «όσο μεγαλύτερη…τρέφονται από αυτό.»

ΘΕΜΑ Δ

Δ1. Σχόλιο: Στο συγκεκριμένο θέμα οι ερμηνείες που αφορούν τις καμπύλες Α και Β εξαρτώνται από δεδομένα που δεν εμφανίζονται στο δοθέν διάγραμμα ούτε διευκρινίζονται στο κείμενο της εκφώνησης του ερωτήματος. Τα δεδομένα αυτά είναι:

Α. Τα επίπεδα των ποσοτήτων των αποικοδομητών και του διαλυμένου οξυγόνου στη λίμνη πριν από την απόρριψη των λυμάτων του ξενοδοχείου. Το δεδομένο αυτό είναι απαραίτητο προκειμένου να είναι δυνατή η αξιόπιστη εκτίμηση των μεταβολών των δυο αυτών ποσοτήτων μετά από την απόρριψη των λυμάτων.

Β. Δεν προσδιορίζεται η απόσταση από το σημείο της απόρριψης των λυμάτων σε σχέση με τη μεταβολή των δυο ποσοτήτων που εξετάζονται, οπότε δεν είναι δυνατόν από τις δοθείσες καμπύλες να εξαχθούν ασφαλή συμπεράσματα καθώς φαίνεται να μένει σταθερά μειωμένη η τιμή της μιας μεταβλητής και σταθερά αυξημένη η τιμή της άλλης μεταβλητής, όσο αυξάνεται η απόσταση απομάκρυνσης από σημείο απόρριψης των λυμάτων. Είναι ωστόσο λογικό να αναμένεται μείωση των ποσοτήτων των λυμάτων αυξανόμενης της απόστασης από το σημείο απόρριψης τους, οπότε θα πρέπει το φαινόμενο της ρύπανσης των υδάτων να εξασθενεί με την απόσταση και να αποκαθίσταται σταδιακά η αρχική ισορροπία που υπήρχε πριν από το σημείο απόρριψης των λυμάτων.

Συνεπώς με βάση τα παραπάνω δεν υπάρχει μονοσήμαντη απάντηση στο ερώτημα ποια καμπύλη εκφράζει την μεταβολή ποιας μεταβλητής.

1η ερμηνεία: Η καμπύλη Α εκφράζει την μεταβολή στην ποσότητα των αποικοδομητών.

Η καμπύλη Β εκφράζει την μεταβολή στην ποσότητα του διαλυμένου οξυγόνου στο ποτάμι.

Αιτιολόγηση: Τα λύματα του ξενοδοχείου που απορρίπτονται στο ποτάμι συνιστούν αστικά λύματα καθώς περιέχουν ουσίες καθημερινής χρήσης όπως π.χ. απορρυπαντικά κ.ά καθώς και παραπροϊόντα του ανθρώπινου μεταβολισμού όπως περιττώματα κ.ά. Τα λύματα αυτά αυξάνουν το μικροβιακό φορτίο στο σημείο απόρριψης τους στο ποτάμι και σε κοντινή απόσταση από αυτό και επομένως αναμένεται εμφάνιση του φαινομένου του ευτροφισμού. « Όσον αφορά το φαινόμενο …ολοένα μικρότερη.» Σελ. 108-109 σχολικό βιβλίο.

2η ερμηνεία: Η καμπύλη Α εκφράζει την μεταβολή στην ποσότητα του διαλυμένου οξυγόνου στο ποτάμι.

Η καμπύλη Β εκφράζει την μεταβολή στην ποσότητα των αποικοδομητών.

Αιτιολόγηση: Στο σημείο του ποταμού όπου απορρίπτονται τα λύματα του ξενοδοχείου  η καμπύλη Α μπορεί να απεικονίζει την ποσότητα του διαλυμένου οξυγόνου που θα πρέπει να είναι μειωμένη σε αυτό το σημείο και κοντά σε αυτό λόγω της υψηλής ποσότητας του μικροβιακού φορτίου των λυμάτων και των αποικοδομητών που αυξάνονται καθώς υπάρχει αρκετή διαθέσιμη τροφή για αυτούς από το περιεχόμενο των λυμάτων. Το  διαλυμένο οξυγόνο όμως πρέπει να αυξάνεται καθώς απομακρυνόμαστε από το σημείο απόρριψης των λυμάτων λόγω αραίωσης των αστικών λυμάτων. Αντίστοιχα η καμπύλη Β μπορεί  απεικονίζει την ποσότητα των αποικοδομητών η οποία θα πρέπει να είναι αυξημένη στο σημείο απόρριψης των αστικών λυμάτων για τους λόγους που αναφέρθηκαν και να μειώνεται στο φυσιολογικό καθώς απομακρυνόμαστε από αυτό.

Δ2.Οι πληροφορίες για την απάντηση αντλούνται από την σελ. 105 του σχολικού βιβλίου.

Η καμπύλη Α εκφράζει την μεταβολή της συγκέντρωσης των οξείδιων του αζώτου, τα οποία συνιστούν πρωτογενείς ρύπους.

Η καμπύλη Β εκφράζει την μεταβολή της συγκέντρωσης του όζοντος στα χαμηλά στρώματα της ατμόσφαιρας οπού συνιστά δευτερογενή ρύπο.

Αιτιολόγηση: «Στην ατμόσφαιρα της Αθηνάς…όζον.»

Για την δημιουργία των δευτερογενών ρύπων όπως είναι και το όζον απαιτείται η παρουσία στην ατμόσφαιρα των πρωτογενών ρύπων όπως είναι τα οξείδια του αζώτου και ηλιοφάνεια ώστε να είναι δυνατή η πραγματοποίηση της αντίδρασης:

πρωτογενείς ρύποι + οξυγόνο της ατμόσφαιρας——–> δευτερογενείς ρύποι.

Λόγω των παραπάνω, παρατηρείται πρώτα αύξηση των οξειδίων του αζώτου (με μέγιστη τιμή περίπου στις 8 πμ που σε μια πόλη όπως είναι η Αθήνα, παρατηρείται αυξημένη κίνηση αυτοκινήτων και παράλληλα έχει ξεκινήσει η λειτουργιά των μηχανών των εργοστασίων) ενώ έπεται η συνακόλουθη αύξηση του όζοντος, που ως προϊόν της αντίδρασης των οξειδίων του αζώτου με το οξυγόνο της ατμόσφαιρας παρουσία της ηλιακής ακτινοβολίας, εμφανίζει μέγιστη τιμή περί τις 4 μμ, οπότε έχει προηγηθεί η μέγιστη τιμή των πρωτογενών ρύπων και η μέγιστη ηλιοφάνεια της ημέρας που σημειώνεται το μεσημέρι.

Δ3.Οι πληροφορίες για την απάντηση αντλούνται από την σελ. 105 του σχολικού βιβλίου.

« τα οξείδια του αζώτου προκαλούν καταστροφές…πρόκληση εμφυσήματος.»

Τα φετινά θέματα της Βιολογίας γενικής παιδείας εμφανίζουν διαβαθμισμένη δυσκολία και απαιτούν από τον μαθητή σφαιρική γνώση της εξεταζόμενης ύλης καθώς και κριτική-συνδυαστική σκέψη, το οποίο πρέπει να είναι άλλωστε και το ζητούμενο των εξετάσεων. Η διατύπωση ορισμένων ερωτημάτων που εγείρει πολλαπλές ερμηνείες έχει ιδιαίτερο ενδιαφέρον καθώς θα πρέπει ο μαθητής να μην σκεφτεί μονοσήμαντα αλλά να σκεφτεί λαμβάνοντας υπόψιν του όλες τις πιθανές ερμηνείες.

Εύχομαι επιτυχία στην συνέχεια των φετινών εξετάσεων σε όλους τους υποψηφίους.

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2000

ΒΙΟΛΟΓΙΑΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑ 1o

Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

1. Σε μια συνεχή καλλιέργεια η ανάπτυξη των μικροοργανισμών βρίσκεται διαρκώς σε:

α. λανθάνουσα φάση

β. στατική φάση

γ. εκθετική φάση

δ. φάση θανάτου

Mονάδες 5

2. Το πλασμίδιο Ti χρησιμοποιείται στη διαδικασία:

α. δημιουργίας διαγονιδιακών ζώων

β. δημιουργίας διαγονιδιακών φυτών

γ. παραγωγής ιντερφερόνης

δ. παραγωγής ινσουλίνης

Mονάδες 5

3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

α. γραμμικό δίκλωνο DNA

β. γραμμικό μονόκλωνο DNA

γ. κυκλικό δίκλωνο DNA

δ. κυκλικό μονόκλωνο DNA

Mονάδες 5

4. Στη μικροέγχυση χρησιμοποιούνται:

α. Τ-λεμφοκύτταρα

β. μετασχηματισμένα βακτήρια

γ. γονιμοποιημένα ωάρια ζώων

δ. καρκινικά κύτταρα

Mονάδες 5

5. Οι περιοριστικές ενδονουκλεάσες:

α. συμμετέχουν στην ωρίμανση του RNA

β. είναι απαραίτητες για την έναρξη της αντιγραφής

γ. συμμετέχουν στη μεταγραφή του DNA

δ. κόβουν το DNA σε καθορισμένες θέσεις

Mονάδες 5

ΘΕΜΑ 2o

Να απαντήσετε στις παρακάτω ερωτήσεις:

Α. Η διαδικασία της αντιγραφής του DNA χαρακτηρίζεται από μεγάλη ταχύτητα και ακρίβεια, που οφείλεται κυρίως στη δράση ενζύμων και συμπλόκων ενζύμων.

1. Ποια από τα παρακάτω συμμετέχουν στην αντιγραφή του DNA: DNA πολυμεράσες, DNA ελικάσες, περιοριστικές ενδονουκλεάσες, πριμόσωμα, επιδιορθωτικά ένζυμα, DNA δεσμάση;

Mονάδες 5

2. Να γράψετε ονομαστικά τα ένζυμα που παίρνουν μέρος στην επιδιόρθωση του DNA.

Mονάδες 5

B.

1. Πότε ένας μικροοργανισμός χαρακτηρίζεται υποχρεωτικά αερόβιος;

Mονάδες 5

2. Τι είναι το πολύσωμα;

Mονάδες 5

3. Ποια κωδικόνια ονομάζονται συνώνυμα;

Mονάδες 5

ΘΕΜΑ 3o

Η Βιοτεχνολογία συμβάλλει αποτελεσματικά στην έγκαιρη διάγνωση, πρόληψη και θεραπεία διαφόρων ασθενειών.

1. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Mονάδες 9

2. Να γράψετε τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Mονάδες 9

3. Να περιγράψετε τη διαδικασία παραγωγής των εμβολίων υπομονάδων.

Mονάδες 7

Ένα ανθρώπινο σωματικό κύτταρο έχει 46 χρωμοσώματα.

Α. 1. Πόσα μόρια DNA συνολικά υπάρχουν στα χρωμοσώματα του συγκεκριμένου κυττάρου, στα στάδια της μετάφασης της μίτωσης;

Mονάδες 2

2. Να δικαιολογήσετε την απάντησή σας.

Mονάδες 4

Β. Να περιγράψετε τις χαρακτηριστικές μορφές, με τις οποίες εμφανίζεται το γενετικό υλικό ενός ευκαρυωτικού κυττάρου, ανάλογα με το στάδιο του κυτταρικού κύκλου που βρίσκεται.

Mονάδες 9

Γ. Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων:

5΄ TCA CGG AAT TTC TAG CAT 3΄

1. Με δεδομένο ότι δε μεσολαβεί στάδιο ωρίμανσης, να γράψετε το m-RNA που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος DNA, σημειώνοντας ταυτόχρονα τη θέση του 5΄ και 3΄ άκρου του m-RNA.

Mονάδες 3

2. Nα γραφούν τα αντικωδικόνια των t-RNA με τη σειρά που συμμετέχουν στη μετάφραση του παραπάνω m-RNA.

Mονάδες 7

 

ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2000

ΘΕΜΑ 1o

Οι σωστές απαντήσεις είναι:

1. γ

Σημείωση: Η συνεχής καλλιέργεια μικροοργανισμών εμφανίζει συνήθως στην αρχή

λανθάνουσα φάση και κατόπιν ακολουθεί η εκθετική φάση.

2. β

3. γ

4. γ

5. δ

Σημείωση: Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν και κόβουν καθορισμένες δίκλωνες αλληλουχίες DNA τεσσάρων με οκτώ ζευγών νουκλεοτιδίων.

ΘΕΜΑ 2o

Α. 1. Όλα εκτός από τις περιοριστικές ενδονουκλεάσες. Η διαδικασία της αντιγραφής, όπως υποδηλώνεται από τη δομή της διπλής έλικας και τον ημισυντηρητικό μηχανισμό, φαίνεται απλή. Όμως, ύστερα από πολύχρονη ερευνητική μελέτη, διαπιστώθηκε ότι η διαδικασία στην πραγματικότητα είναι ιδιαίτερα πολύπλοκη. Τα κύτταρα διαθέτουν ένα σημαντικό «οπλοστάσιο» εξειδικευμένων ενζύμων και άλλων πρωτεϊνών, που λειτουργούν ταυτόχρονα και καταλύουν τις χημικές αντιδράσεις της αντιγραφής με μεγάλη ταχύτητα και με εκπληκτική ακρίβεια. Η αντιγραφή του DNA αρχίζει από καθορισμένα σημεία που ονομάζονται θέσεις έναρξης της αντιγραφής. Για να αρχίσει η αντιγραφή του DNA, είναι απαραίτητο να ξετυλιχθούν στις θέσεις έναρξης της αντιγραφής οι δύο αλυσίδες. Αυτό επιτυγχάνεται με τη βοήθεια ειδικών ενζύμων, που σπάζουν τους δεσμούς υδρογόνου μεταξύ των δύο αλυσίδων. Τα ένζυμα αυτά ονομάζονται DNA ελικάσες. Όταν ανοίξει η διπλή έλικα, δημιουργείται μια «θηλιά» η οποία αυξάνεται και προς τις δύο κατευθύνσεις. Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA ονομάζονται DNA πολυμεράσες. Επειδή τα ένζυμα αυτά δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. DNA πολυμεράσες επιμηκύνουν τα πρωταρχικά τμήματα, τοποθετώντας συμπληρωματικά δεοξυριβονουκλεοτίδια απέναντι από τις μητρικές αλυσίδες του DNA. DNA πολυμεράσες επιδιορθώνουν επίσης λάθη που συμβαίνουν κατά τη διάρκεια της αντιγραφής. Μπορούν, δηλαδή, να «βλέπουν» και να απομακρύνουν νουκλεοτίδια που οι ίδιες τοποθετούν, κατά παράβαση του κανόνα της συμπληρωματικότητας, και να τοποθετούν τα σωστά. Ταυτόχρονα DNA πολυμεράσες απομακρύνουν τα πρωταρχικά τμήματα RNA και τα αντικαθιστούν με τμήματα DNA. Kάθε νεοσυντιθέμενη αλυσίδα θα έχει προσανατολισμό 5΄→3΄. Έτσι, σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες θα είναι αντιπαράλληλες. Για να ακολουθηθεί αυτός ο κανόνας σε κάθε τμήμα DNA που γίνεται η αντιγραφή, η σύνθεση του DNA είναι συνεχής στη μια αλυσίδα και ασυνεχής στην άλλη. Τα κομμάτια της ασυνεχούς αλυσίδας συνδέονται μεταξύ τους με τη βοήθεια ενός ενζύμου, που ονομάζεται DNA δεσμάση. Το ίδιο ένζυμο συνδέει και όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής. Η αντιγραφή του DNA είναι απίστευτα ακριβής, μόνο ένα νουκλεοτίδιο στα 100.000 μπορεί να ενσωματωθεί λάθος. Τα λάθη που δεν επιδιορθώνονται από τις DNA πολυμεράσες, επιδιορθώνονται σε μεγάλο ποσοστό από ειδικά επιδιορθωτικά ένζυμα. Έτσι ο αριθμός των λαθών περιορίζεται στους ευκαρυωτικούς οργανισμούς στο ένα στα 1010!

Οι περιοριστικές ενδονουκλεάσες παράγονται από βακτήρια και ο φυσιολογικός τους ρόλος είναι να τα προστατεύουν από την εισβολή «ξένου» DNA. Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν και κόβουν σε συγκεκριμένες θέσεις ειδικές αλληλουχίες 4-8 νουκλεοτιδίων στο δίκλωνο DNA.

2. Τα ένζυμα που παίρνουν μέρος στην επιδιόρθωση του DNA είναι οι DNA πολυμεράσες και τα ειδικά επιδιορθωτικά ένζυμα.

Β. 1. Ο ρυθμός ανάπτυξης ενός πληθυσμού μικροοργανισμών, δηλαδή ο ρυθμός με τον οποίο διαιρούνται τα κύτταρα του, καθορίζεται από το χρόνο διπλασιασμού. Κάθε είδος μικροοργανισμού έχει χαρακτηριστικό χρόνο διπλασιασμού. Οι παράγοντες που επηρεάζουν το χρόνο διπλασιασμού και συνεπώς το ρυθμό ανάπτυξης των μικροοργανισμών, είναι η διαθεσιμότητα των θρεπτικών συστατικών, το pH, το Ο2 και η θερμοκρασία. Η παρουσία ή απουσία O2 μπορεί να βοηθήσει ή να αναστείλει την ανάπτυξη των μικροοργανισμών. Υπάρχουν μικροοργανισμοί που για την ανάπτυξή τους απαιτούν υψηλή συγκέντρωση O2 (υποχρεωτικά αερόβιοι) όπως τα βακτήρια του γένους Mycobacterium.

2. Η μετάφραση του mRNA, δηλαδή η αντιστοίχιση των κωδικονίων σε αμινοξέα και η διαδοχική σύνδεση των αμινοξέων σε πολυπεπτιδική αλυσίδα, πραγματοποιείται στα ριβοσώματα με τη βοήθεια των tRNA και τη συμμετοχή αρκετών πρωτεϊνών και ενέργειας. Ένα από τα στάδια της ρύθμισης της έκφρασης της γενετικής πληροφορίας σε επίπεδο μετάφρασης, είναι ότι πολλά ριβοσώματα μπορούν να μεταφράζουν ταυτόχρονα ένα mRNA, το καθένα σε διαφορετικό σημείο κατά μήκος του μορίου. Αμέσως μόλις το ριβόσωμα έχει μεταφράσει τα πρώτα κωδικόνια, η θέση έναρξης του mRNA είναι ελεύθερη για την πρόσδεση ενός άλλου ριβοσώματος. Το σύμπλεγμα των ριβοσωμάτων με το mRNA ονομάζεται πολύσωμα. Έτσι, η πρωτεϊνοσύνθεση είναι μία «οικονομική διαδικασία». Ένα κύτταρο μπορεί να παραγάγει μεγάλα ποσά μιας πρωτεΐνης από ένα ή από δύο αντίγραφα ενός γονιδίου.

3. Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο mRNA με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η αλληλουχία των βάσεων του mRNA καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση ένα κώδικα αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. Ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος. Με εξαίρεση δύο αμινοξέα (μεθειονίνη και τρυπτοφάνη) τα υπόλοιπα 18 κωδικοποιούνται από δύο μέχρι και έξι διαφορετικά κωδικόνια. Τα κωδικόνια που κωδικοποιούν το ίδιο αμινοξύ ονομάζονται συνώνυμα.

ΘΕΜΑ 3o

1. Τα αντισώματα είναι πρωτεϊνικά μόρια, που παράγονται από τα Β-λεμφοκύτταρα του ανοσοποιητικού μας συστήματος, όταν ένα αντιγόνο (παθογόνος μικροοργανισμός, ιός ή ξένο υλικό) προσβάλλει τον οργανισμό. Τα αντισώματα αντιδρούν με το αντιγόνο και το εξουδετερώνουν.

Ο οργανισμός μας είναι ικανός να παράγει αντισώματα εναντίον κάθε ξένου αντιγόνου. Στην πραγματικότητα, ένα αντίσωμα αναγνωρίζει μόνο μία περιοχή του αντιγόνου, η οποία ονομάζεται αντιγονικός καθοριστής. Ένα μεγάλο αντιγόνο, π.χ. ένας μικροοργανισμός, έχει πολλούς αντιγονικούς καθοριστές γι’ αυτό παράγονται πολλά είδη αντισωμάτων εναντίον του.

Κάθε είδος αντισώματος που αναγνωρίζει ένα αντιγονικό καθοριστή παράγεται από μία ομάδα όμοιων Β-λεμφοκυττάρων, που αποτελούν ένα κλώνο. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων ονομάζονται μονοκλωνικά.

Τα μονοκλωνικά αντισώματα είναι πολύ σημαντικά στην Ιατρική και χρησιμοποιούνται ως διαγνωστικά για την ανίχνευση ασθενειών ή ως εξειδικευμένα φάρμακα εναντίον παθογόνων μικροοργανισμών ή ακόμη εναντίον καρκινικών κυττάρων. Ήταν, επομένως σημαντικό να γίνει δυνατή η παραγωγή τους στο εργαστήριο σε μεγάλες ποσότητες. Όμως τα Β-λεμφοκύτταρα δεν επιβιώνουν για πολύ έξω από το σώμα και δε μπορούν να διατηρηθούν σε κυτταροκαλλιέργειες. Την ιδιότητα αυτή την αποκτούν ύστερα από σύντηξη με καρκινικά κύτταρα. Τα υβριδικά κύτταρα που παράγονται ονομάζονται υβριδώματα και μπορούν να παράγουν μεγάλες ποσότητες ενός μονοκλωνικού αντισώματος. Η τεχνική της παραγωγής μονοκλωνικών αντισωμάτων αναπτύχθηκε το 1975 και ακολουθεί την εξής διαδικασία: Ένα επιλεγμένο αντιγόνο χορηγείται με ένεση σε ποντίκι και προκαλεί ανοσολογική αντίδραση με αποτέλεσμα να αρχίσει η παραγωγή αντισωμάτων από εξειδικευμένα Β-λεμφοκύτταρα. Ύστερα από δύο εβδομάδες αφαιρείται ο σπλήνας και απομονώνονται τα Β-λεμφοκύτταρα. Τα κύτταρα αυτά συντήκονται με καρκινικά κύτταρα και παράγονται τα υβριδώματα που παράγουν μονοκλωνικά αντισώματα. Τα υβριδώματα μπορούν να φυλάσσονται για μεγάλα χρονικά διαστήματα στην κατάψυξη (-80ο C) και να παράγουν οποιαδήποτε στιγμή το συγκεκριμένο μονοκλωνικό αντίσωμα σε μεγάλες ποσότητες.

2. Τα ζώα που έχουν υποστεί γενετική αλλαγή με τη χρήση μεθόδων της Γενετικής Μηχανικής ονομάζονται διαγονιδιακά. Τα διαγονιδιακά ζώα χρησιμοποιούνται για την παραγωγή χρήσιμων φαρμακευτικών πρωτεϊνών σε μεγάλη ποσότητα. Σήμερα είναι δυνατή η παραγωγή πρωτεϊνών, όπως η ινσουλίνη και η ανθρώπινη αυξητική ορμόνη, από βακτήρια. Οι πρωτεΐνες αυτές χρησιμοποιούνται για τη θεραπεία διαφόρων ασθενειών. Στις περισσότερες όμως περιπτώσεις οι πρωτεΐνες αυτές δεν είναι ακριβώς ίδιες με τις πρωτεΐνες του ανθρώπου, επειδή τα βακτήρια δε διαθέτουν τους μηχανισμούς τροποποίησης των πρωτεϊνών που διαθέτουν οι ευκαρυωτικοί οργανισμοί. Μια πολλά υποσχόμενη ιδέα είναι η παραγωγή φαρμακευτικών πρωτεϊνών από κύτταρα των μαστικών αδένων των ζώων, για παράδειγμα των προβάτων και των αγελάδων. Με αυτό τον τρόπο θα είναι δυνατή η συλλογή της πρωτεΐνης από το γάλα των ζώων. Αυτός ο τρόπος παραγωγής ονομάζεται παραγωγή φαρμακευτικών πρωτεϊνών από διαγονιδιακά ζώα (gene pharming). Συνοπτικά, θα μπορούσαμε να αναφέρουμε ότι τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο είναι τα παρακάτω:

• Απομόνωση του ανθρώπινου γονιδίου που κωδικοποιεί τη φαρμακευτική πρωτεΐνη που μας ενδιαφέρει.

• Μικροέγχυση του γονιδίου στον πυρήνα ενός γονιμοποιημένου ωαρίου του ζώου.

• Τοποθέτηση του γενετικά τροποποιημένου ζυγωτού στη μήτρα ενήλικου ζώου για κυοφορία.

• Γέννηση του διαγονιδιακού ζώου.

• Διασταυρώσεις με σκοπό να περάσει η τροποποιημένη γενετική πληροφορία στους απογόνους.

• Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

3. Εκτός σημερινής εξεταστέας ύλης. Εντούτοις, το θέμα απαντάται στη σελ. 121 του σχολικού βιβλίου: “Η παραγωγή των εμβολίων-υπομονάδων … ως εμβόλιο.”.

ΘΕΜΑ 4o

Α. 1. Στο στάδιο της μετάφασης της μίτωσης θα υπάρχουν 92 μόρια DNA, σε ένα ανθρώπινο σωματικό κύτταρο που διαιρείται.

2. Στο στάδιο της μετάφασης της μίτωσης καθένα από τα 46 χρωμοσώματα του ανθρώπινου κυττάρου αποτελείται από δύο αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο. Καθεμία από τις δύο αδελφές χρωματίδες του χρωμοσώματος συνιστά ένα μόριο DNA, όπως και κάθε ινίδιο χρωματίνης κατά τη μεσόφαση του κυτταρικού κύκλου αποτελεί ένα μόριο DNA. Όμως τα ινίδια της χρωματίνης διπλασιάζονται στη μεσόφαση κατά τη διάρκεια της αντιγραφής του DNA, συσπειρώνονται και εμφανίζονται ως αδελφές χρωματίδες των χρωμοσωμάτων στη μίτωση. Επομένως, στη μετάφαση το κάθε χρωμόσωμα αποτελείται από δύο μόρια DNA. Άρα στα 46 χρωμοσώματα συνολικά υπάρχουν 92 μόρια DNA.

Β. Αν παρατηρήσουμε το γενετικό υλικό ενός ευκαρυωτικού σωματικού κυττάρου, βλέπουμε ότι εμφανίζεται με διαφορετικές χαρακτηριστικές μορφές, ανάλογα με το στάδιο του κυτταρικού κύκλου. Κατά τη μεσόφαση το γενετικό υλικό έχει μικρό βαθμό συσπείρωσης και σχηματίζει δίκτυο ινιδίων χρωματίνης. Κατά συνέπεια τα ινίδια χρωματίνης δεν είναι ορατά ως μεμονωμένες δομές, με το οπτικό μικροσκόπιο. Με το τέλος της αντιγραφής κάθε ινίδιο χρωματίνης έχει διπλασιαστεί. Τα δύο αντίγραφα κάθε ινιδίου συνδέονται μεταξύ τους με μια δομή που ονομάζεται κεντρομερίδιο.

Ο όρος αδελφές χρωματίδες χρησιμοποιείται για να περιγράψει τα διπλασιασμένα χρωμοσώματα κατά το χρονικό διάστημα που είναι συνδεδεμένα στο κεντρομερίδιο. Στην κυτταρική διαίρεση οι αδελφές χρωματίδες συσπειρώνονται και, κατά το στάδιο της μετάφασης, αποκτούν μέγιστο βαθμό συσπείρωσης. Στο στάδιο αυτό ο υψηλός βαθμός συσπείρωσης καθιστά τα μεταφασικά χρωμοσώματα ευδιάκριτα και έτσι είναι εύκολο να παρατηρηθούν με το οπτικό μικροσκόπιο. Στο τέλος της κυτταρικής διαίρεσης προκύπτουν δύο νέα κύτταρα, γενετικά όμοια μεταξύ τους και με το αρχικό, αφού το καθένα περιέχει τη μία από τις δύο «πρώην» αδελφές χρωματίδες από κάθε χρωμόσωμα.

Θα μπορούσαμε να πούμε ότι τα ινίδια της χρωματίνης, τα χρωμοσώματα και οι χρωματίδες αποτελούν «διαφορετικές όψεις του ίδιου νομίσματος». Τα ινίδια της χρωματίνης διπλασιάζονται στη μεσόφαση και «μετατρέπονται» σε αδελφές χρωματίδες, οι οποίες γίνονται ευδιάκριτες στην κυτταρική διαίρεση. Κατά το τέλος της κυτταρικής διαίρεσης αποχωρίζονται πλήρως, αποσυσπειρώνονται σταδιακά και «μετατρέπονται» πάλι σε ινίδια χρωματίνης στο μεσοφασικό πυρήνα των νέων κυττάρων κ.ο.κ. Παρ’όλες όμως τις μορφολογικές αυτές μεταβολές η χημική σύσταση του γενετικού υλικού παραμένει αμετάβλητη.

Γ. 1. Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο RNA με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η μεταγραφή του DNA σε mRNA γίνεται για τα γονίδια που κωδικοποιούν για πεπτίδια και πραγματοποιείται με προσανατολισμό 5΄→3΄, καθώς η RNA πολυμεράση συνθέτει το mRNA δημιουργώντας 3΄→5΄ φωσφοδιεστερικό δεσμό μεταξύ του τελευταίου ριβονουκλεοτιδίου του αναπτυσσόμενου mRNA και του επόμενου ριβονουκλεοτιδίου που πρόκειται να συνδεθεί με αυτό όπως καθορίζεται από τον κανόνα της συμπληρωματικότητας με τον μεταγραφόμενο (μη κωδικό) κλώνο του γονιδίου. Ο κλώνος λοιπόν του mRNA που παράγεται είναι αντιπαράλληλος με το μεταγραφόμενο κλώνο του DNA, εφόσον ο κλώνος του mRNA συντίθεται με προσανατολισμό 5΄→3΄, ο μεταγραφόμενος κλώνος του DNA “διαβάζεται” με προσανατολισμό από 3΄ προς το 5΄ άκρο ως προς τον υποκινητή του γονιδίου. Ξαναγράφουμε το τμήμα του μεταγραφόμενου κλώνου του DNA που δίνεται, από το άκρο 3΄ προς το άκρο 5΄.

DNA: 3΄ …TAC GAT CTT TAA GGC ACT… 5΄

Επομένως η αλληλουχία του παραγόμενου mRNA είναι:

mRNA: 5΄…AUG CUA GAA AUU CCG UGA… 3΄

(Παρατηρούμε το κωδικόνιο έναρξης 5΄AUG3΄ στη θέση της 1ης τριπλέτας και το κωδικόνιο λήξης 5΄UGA3΄ στη θέση της τελευταίας τριπλέτας).

2. Με τη μετάφραση του mRNA πραγματοποιείται αντιστοίχιση των κωδικονίων σε αμινοξέα και διαδοχική σύνδεση των αμινοξέων σε πεπτιδική αλυσίδα. Η μετάφραση πραγματοποιείται στα ριβοσώματα με τη βοήθεια των tRNA και τη συμμετοχή αρκετών πρωτεϊνών και ενεργείας. Κάθε μόριο tRNA που συμμετέχουν στη μετάφραση του συγκεκριμένου mRNA έχει μια ειδική τριπλέτα νουκλεοτιδίων, το αντικωδικόνιο, με την οποία προσδένεται, λόγω συμπληρωματικότητας, με το αντίστοιχο κωδικόνιο του mRNA.

Κάθε κωδικόνιο του mRNA έχει ένα συμπληρωματικό αντικωδικόνιο εκτός από το κωδικόνιο λήξης για το οποίο δεν υπάρχει αντικωδικόνιο και συνεπώς tRNA. Επομένως, τα αντικωδικόνια των tRNA που συμμετέχουν στη μετάφραση του συγκεκριμένου mRNA θα είναι (με τη σειρά των κωδικονίων του mRNA που αναγράφονται παραπάνω):

3΄UAC5΄, 3΄GAU5΄, 3΄CUU5΄, 3΄UAA5΄, 3΄GGC5΄

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2008 – ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑ 1ο

Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

1. Ο πνευμονιόκοκκος, τα δύο στελέχη του οποίου χρησιμοποίησε ο Griffith στο γνωστό πείραμα, είναι:

α. μύκητας.

β. βακτήριο.

γ. ιός.

δ. πρωτόζωο.

Μονάδες 5

2. Η ομάδα αίματος του ανθρώπου ελέγχεται από:

α. πολλαπλά αλληλόμορφα, όλα ισοεπικρατή.

β. δύο αλληλόμορφα με σχέση υποτελούς-επικρατούς.

γ. δύο υπολειπόμενα και ένα επικρατές.

δ. δύο συνεπικρατή γονίδια και ένα υπολειπόμενο.

Μονάδες 5

3. Η μεταγραφή στα προκαρυωτικά κύτταρα πραγματοποιείται:

α. στον πυρήνα.

β. στο κυτταρόπλασμα.

γ. στα μιτοχόνδρια.

δ. στο κυτταρικό τοίχωμα.

Μονάδες 5

4. Οι περιοριστικές ενδονουκλεάσες:

α. είναι απαραίτητες για την έναρξη της μεταγραφής.

β. κόβουν τις πολυνουκλεοτιδικές αλυσίδες του RNA σε ειδικές θέσεις.

γ. περιορίζουν τη μεταγραφή του DNA.

δ. κόβουν το DNA σε ειδικές θέσεις.

Μονάδες 5

5. Τα ζώα, που έχουν υποστεί γενετική τροποποίηση λέγονται:

α. πολυγενετικά.

β. διαγονιδιακά.

γ. πολυπλοειδικά.

δ. πολυγονικά.

Μονάδες 5

ΘΕΜΑ 2ο

Να απαντήσετε στις παρακάτω ερωτήσεις:

1. Πώς αναστέλλεται η δράση των ογκοκατασταλτικών γονιδίων; Να αναφέρετε ένα χαρακτηριστικό παράδειγμα.

Μονάδες 5

2. Πώς ονομάζεται η αλλαγή που παρουσιάζεται στον καρυότυπο ενός ανθρώπου, όταν εμφανίζεται ένα επιπλέον χρωμόσωμα 21 και πώς προκύπτει αυτό;

Μονάδες 8

3. Πώς συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος στη μελέτη της εξέλιξής του και στη μαζική παραγωγή προϊόντων;

Μονάδες 7

4. Πώς χρησιμοποιείται ο όρος αδελφές χρωματίδες, σε ποιο στάδιο της κυτταρικής διαίρεσης εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και πώς μοιράζονται στα δύο νέα κύτταρα;

Μονάδες 5

ΘΕΜΑ 3ο

Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία με την οποία ένα γονίδιο ενεργοποιείται για να παραγάγει μία πρωτεΐνη.

1. Πού αποσκοπεί κυρίως η ρύθμιση αυτή στην περίπτωση των βακτηρίων;

Μονάδες 5

2. Τα κύτταρα ενός ευκαρυωτικού πολύπλοκου οργανισμού, όπως τα νευρικά και τα μυϊκά, αν και έχουν το ίδιο γενετικό υλικό, διαφέρουν στη μορφή και τη λειτουργία. Πώς ονομάζεται αυτή η διαδικασία εξειδίκευσης και τι κάνει τα κύτταρα να διαφέρουν τόσο πολύ;

Μονάδες 8

3. Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Ποια είναι τα ρυθμιστικά στοιχεία της μεταγραφής του DNA, ποιο το ένζυμο που καταλύει τη μεταγραφή και πώς λειτουργεί αυτό κατά τη γονιδιακή ρύθμιση στο επίπεδο της μεταγραφής των ευκαρυωτικών οργανισμών;

Μονάδες 12

ΘΕΜΑ 4ο

Σε μια θέση τμήματος μορίου DNA με κλώνους Α και Β, έχει ξεκινήσει η αντιγραφή, όπως φαίνεται στο παρακάτω σχήμα.

Η DNA-δεσμάση εκτός του ότι συνδέει όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής, δρα κατά την αντιγραφή του κλώνου Β. Σε κάθε κλώνο να συμπληρώσετε τον προσανατολισμό της αντιγραφής και να χαρακτηρίσετε τον τρόπο σύνθεσης των νέων αλυσίδων DNA (Μονάδες 4). Ποιά ένζυμα τοποθετούν τα συμπληρωματικά νουκλεοτίδια και ποιους άλλους ρόλους έχουν; (Μονάδες 7).

Στην κωδική αλυσίδα Α το γονίδιο, που είναι υπεύθυνο για την παραγωγή ενός πεπτιδίου, έχει την εξής αλληλουχία βάσεων:

5΄… ATG CCA TGC AAA CCG AAA TGA …3΄

Να γράψετε την αλληλουχία του mRNA που προκύπτει (Μονάδες 2).

Κάποια αλλαγή που συνέβη στην παραπάνω κωδική αλυσίδα του DNA, έχει ως αποτέλεσμα το 4ο κωδικόνιο στο μεταγραφόμενο mRNA να έχει τις βάσεις UAA και ο αριθμός των κωδικονίων να παραμένει σταθερός. Αφού γράψετε το νέο mRNA που προκύπτει, να εξηγήσετε ποια είναι η συγκεκριμένη αλλαγή που συνέβη και τι συνέπειες μπορεί να έχει για το πεπτίδιο; (Μονάδες 8).

Γιατί η πρωτεϊνοσύνθεση στους ευκαρυωτικούς οργανισμούς είναι μια «οικονομική διαδικασία»; (Μονάδες 4).

Μονάδες 25

 

 

ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2008

ΘΕΜΑ 1o

Οι σωστές απαντήσεις είναι:

1. β

2. δ

3. β

4. δ

Σημείωση: Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν και κόβουν δίκλωνες αλ-

ληλουχίες DNA.

5. β

ΘΕΜΑ 2o

1. Τα γονίδια αποτελούν τις λειτουργικές μονάδες της κληρονομικότητας. Στα γονίδια περιέχονται οι γενετικές πληροφορίες που καθορίζουν όλα τα χαρακτηριστικά ενός οργανισμού.

Τα γονίδια αποτελούν τμήματα του DNA του οργανισμού με συγκεκριμένη ακολουθία νουκλεοτιδίων.

Ο καρκίνος χαρακτηρίζεται από τον ανεξέλεγκτο πολλαπλασιασμό των κυττάρων ενός ιστού. Αυτά σχηματίζουν μάζες κυττάρων (καρκινικοί όγκοι) ή μεταναστεύουν στο αίμα όπως στις διάφορες μορφές λευχαιμιών. Αποτελέσματα μελετών έχουν οδηγήσει στο συμπέρασμα ότι σχεδόν όλες οι περιπτώσεις καρκίνου προέρχονται από μεταλλάξεις γονιδίων σωματικών κυττάρων.

Υπάρχουν δύο τύποι γονιδίων που σχετίζονται με την εμφάνιση καρκίνου. Τα ογκογονίδια και τα ογκοκατασταλτικά γονίδια. Σχετικές έρευνες οδηγούν στο συμπέρασμα ότι ο καρκίνος σε γενετικό επίπεδο είναι το αποτέλεσμα:

• Μετατροπής πρωτο-ογκογονιδίων σε ογκογονίδια.

• Απουσίας λειτουργικότητας των ογκοκατασταλτικών γονιδίων και

• Αδρανοποίησης των μηχανισμών επιδιόρθωσης του DNA.

Τα ογκοκατασταλτικά γονίδια είναι γονίδια που ελέγχουν την κυτταρική διαίρεση, καταστέλλοντάς την, όποτε είναι απαραίτητο. Η αναστολή της δράσης τους που είναι συνήθως αποτέλεσμα μετάλλαξης, κυρίως έλλειψης γονιδίου, αφαιρεί από το κύτταρο τη δυνατότητα ελέγχου του πολλαπλασιασμού και οδηγεί σε καρκινογένεση. Χαρακτηριστικό παράδειγμα αποτελεί ο καρκίνος του αμφιβληστροειδούς (ρετινοβλάστωμα) που είναι αποτέλεσμα έλλειψης ενός ογκοκατασταλτικού γονιδίου.

2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών χρωμοσωμάτων ενός είδους κατά ελλατώμενο μέγεθος, δεδομένου ότι τα μεταφασικά χρωμοσώματα ενός κυττάρου ενός οργανισμού διαφέρουν μεταξύ τους ως προς το μέγεθος και ως προς τη θέση του κεντρομεριδίου. Ο αριθμός και η μορφολογία των χρωμοσωμάτων είναι ιδιαίτερο χαρακτηριστικό κάθε είδους.

Οι μεταλλάξεις είναι αλλαγές στην ακολουθία και στον αριθμό των βάσεων στο γονιδίωμα ενός οργανισμού. Οι μεγάλες σε έκταση αλλαγές αποτελούν τις χρωμοσωμικές ανωμαλίες.

Η ανάλυση των χρωμοσωμικών ανωμαλιών έγινε δυνατή μετά την ανάπτυξη τεχνικών που επιτρέπουν την παρατήρηση και τη λεπτομερή μελέτη των χρωμοσωμάτων. Οι αλλαγές στον αριθμό των χρωμοσωμάτων ονομάζονται αριθμητικές χρωμοσωμικές ανωμαλίες, ενώ οι αλλαγές στη δομή αποτελούν τις δομικές χρωμοσωμικές ανωμαλίες. Οι αλλαγές αυτές έχουν συνήθως ως αποτέλεσμα την τροποποίηση του φαινοτύπου του ατόμου.

Αν κατά τη διάρκεια της μειωτικής διαίρεσης δεν πραγματοποιηθεί φυσιολογικά ο διαχωρισμός των ομόλογων χρωμοσωμάτων ή αδελφών χρωματίδων, ένα φαινόμενο που ονομάζεται μη-διαχωρισμός, τότε δημιουργούνται γαμέτες με αριθμό χρωμοσωμάτων μεγαλύτερο ή μικρότερο του φυσιολογικού. Η γονιμοποίηση των μη φυσιολογικών γαμετών, που προκύπτουν, με φυσιολογικό γαμέτη έχει ως αποτέλεσμα τη δημιουργία ζυγωτού με «λανθασμένη» ποσότητα γενετικού υλικού, το οποίο δεν αναπτύσσεται φυσιολογικά. Τα άτομα που προκύπτουν και έχουν περίσσεια ή έλλειψη μικρού αριθμού χρωμοσωμάτων ονομάζονται ανευπλοειδή. Η απουσία ενός μόνο χρωμοσώματος ονομάζεται μονοσωμία, ενώ η ύπαρξη ενός επιπλέον τρισωμία. Η μονοσωμία είναι συνήθως θανατηφόρος για τον οργανισμό, διότι τα χρωμοσώματα με τα γονίδια που περιέχουν, με εξαίρεση τα φυλετικά, πρέπει να υπάρχουν σε δύο «δόσεις», για να εξασφαλιστεί η σωστή ανάπτυξη του ζυγωτού.

Οι αριθμητικές χρωμοσωμικές ανωμαλίες δημιουργούνται στα αυτοσωμικά ή στα φυλετικά χρωμοσώματα.

Το σύνδρομο Down είναι η πιο κοινή αριθμητική χρωμοσωμική ανωμαλία. Τα άτομα που πάσχουν από σύνδρομο Down παρουσιάζουν καθυστέρηση στην ανάπτυξη, χαρακτηριστικές δυσμορφίες στο πρόσωπο και διανοητική καθυστέρηση. Στον καρυότυπο των ατόμων που πάσχουν, σε όλες σχεδόν τις περιπτώσεις, εμφανίζεται ένα επιπλέον χρωμόσωμα 21. Η ύπαρξη του επιπλέον χρωμοσώματος είναι αποτέλεσμα μη διαχωρισμού των χρωμοσωμάτων του 21ου ζεύγους ή μη διαχωρισμού των αδελφών χρωματίδων ενός τουλάχιστον 21ου χρωμοσώματος κατά το σχηματισμό των γαμετών στη μείωση. Με αυτό τον τρόπο δημιουργείται ωάριο, και σε σχετικά λιγότερες περιπτώσεις σπερματοζωάριο, με δύο χρωμοσώματα 21. Γονιμοποίηση του γαμέτη που έχει το επιπλέον χρωμόσωμα 21 με ένα φυσιολογικό θα δημιουργήσει στο ζυγωτό τρισωμία 21. Η πιθανότητα γέννησης παιδιού με σύνδρομο Down σχετίζεται με την ηλικία της μητέρας. Μελέτες δείχνουν ότι μια μέλλουσα μητέρα ηλικίας 45 ετών έχει πολύ μεγαλύτερη πιθανότητα να αποκτήσει παιδί με σύνδρομο Down σε σχέση με μια μέλλουσα μητέρα ηλικίας 19 ετών.

3. Το γενετικό υλικό ενός κυττάρου αποτελεί το γονιδίωμά του. Το ανθρώπινο γονιδίωμα σε ένα απλοειδές κύτταρο (γαμέτη) αποτελείται από περίπου 3 x 109 ζεύγη βάσεων DNA που είναι οργανωμένα σε 23 χρωμοσώματα.

Η αποκρυπτογράφηση της αλληλουχίας βάσεων του DNA πιστεύεται ότι θα μας βοηθήσει να κατανοήσουμε πώς έχει «κατασκευαστεί» και λειτουργεί ο ανθρώπινος οργανισμός. Για το σκοπό αυτό το 1986 ξεκίνησε μια διεθνής συνεργασία με σκοπό τη χαρτογράφηση, δηλαδή τον εντοπισμό της θέσης των γονιδίων στα χρωμοσώματα, και τον προσδιορισμό της αλληλουχίας των βάσεων του DNA στο ανθρώπινο γονιδίωμα. Το πρόγραμμα, που φυσικά απαιτούσε τη συμβολή πολλών ερευνητών και γενναία χρηματοδότηση, ξεκίνησε το 1990 υπό την αιγίδα του Εθνικού Ινστιτούτου Υγείας και του Τμήματος Ατομικής Ενέργειας των ΗΠΑ. Αρχικά υπήρχε η εκτίμηση ότι το πρόγραμμα θα ολοκληρωνόταν το 2005, όμως, χάρη στην αυτοματοποίηση των εργαστηριακών μεθόδων και την ανάπτυξη της πληροφορικής, ολοκληρώθηκε το 2001.

Η ανάλυση του ανθρώπινου γονιδιώματος θα συμβάλλει εκτός από τη μελέτη της οργάνωσης και λειτουργίας του ανθρώπινου γονιδιώματος (εύρεση ποσοστού δομικών και ρυθμιστικών γονιδίων, ποσοστού επαναλαμβανόμενων αλληλουχιών, εύρεση του συνόλου των γονιδίων και της χαρτογράφησής τους καθώς και τον προσδιορισμό της λειτουργίας τους κ.ά.) και τον προσδιορισμό των γονιδίων που σχετίζονται με ασθένειες, στη μαζική παραγωγή προϊόντων και στη μελέτη της εξέλιξης του ανθρώπινου γονιδιώματος.

Πιο συγκεκριμένα όσον αφορά τους δύο τελευταίους στόχους, το πρόγραμμα του ανθρώπινου γονιδιώματος σε συνδυασμό με άλλα προγράμματα προσδιορισμού της αλληλουχίας άλλων ειδών οργανισμών και προγραμμάτων σύγκρισης γονιδιωμάτων διαφορετικών ομάδων πληθυσμών που βρίσκονται σε εξέλιξη, θα συμβάλλει στην αποκάλυψη των εξελικτικών σχέσεων που υπάρχουν μεταξύ των ειδών. Σήμερα βρίσκονται σε εξέλιξη προγράμματα χαρτογράφησης γονιδιωμάτων οργανισμών, όπως είναι το πρόβατο, ο σκύλος, η αγελάδα, διάφορα έντομα, ο γεωσκώληκας καθώς και πολλοί μικροοργανισμοί.

Επίσης το πρόγραμμα του ανθρωπίνου γονιδιώματος θα συμβάλλει στη μαζική παραγωγή προϊόντων με τις μεθόδους που χρησιμοποιεί η Βιοτεχνολογία, μετά την απομόνωση των γονιδίων, τα οποία είναι χρήσιμα στη φαρμακοβιομηχανία, στη βιομηχανία, στη γεωργία και την κτηνοτροφία.

4. Το συνολικό DNA που υπάρχει σε κάθε ευκαρυωτικό κύτταρο δεν είναι ένα ενιαίο μόριο, αλλά αποτελείται από πολλά γραμμικά μόρια, ο αριθμός και το μήκος των οποίων είναι χαρακτηριστικά για τα διάφορα είδη των οργανισμών.

Αν παρατηρήσουμε το γενετικό υλικό ενός ευκαρυωτικού σωματικού κυττάρου, βλέπουμε ότι εμφανίζεται με διαφορετικές χαρακτηριστικές μορφές, ανάλογα με το στάδιο του κυτταρικού κύκλου. Κατά τη μεσόφαση το γενετικό υλικό έχει μικρό βαθμό συσπείρωσης και σχηματίζει δίκτυο ινιδίων χρωματίνης. Κατά συνέπεια τα ινίδια χρωματίνης δεν είναι ορατά ως μεμονωμένες δομές, με το οπτικό μικροσκόπιο. Με το τέλος της αντιγραφής κάθε ινίδιο χρωματίνης έχει διπλασιαστεί. Τα δύο αντίγραφα κάθε ινιδίου συνδέονται μεταξύ τους με μια δομή που ονομάζεται κεντρομερίδιο.

Ο όρος αδελφές χρωματίδες χρησιμοποιείται για να περιγράψει τα διπλασιασμένα χρωμοσώματα κατά το χρονικό διάστημα που είναι συνδεδεμένα στο κεντρομερίδιο. Στην κυτταρική διαίρεση οι αδελφές χρωματίδες συσπειρώνονται και, κατά το στάδιο της μετάφασης, αποκτούν μέγιστο βαθμό συσπείρωσης. Στο στάδιο αυτό ο υψηλός βαθμός συσπείρωσης καθιστά τα μεταφασικά χρωμοσώματα ευδιάκριτα και έτσι είναι εύκολο να παρατηρηθούν με το οπτικό μικροσκόπιο. Στο τέλος της κυτταρικής διαίρεσης προκύπτουν δύο νέα κύτταρα, γενετικά όμοια μεταξύ τους και με το αρχικό, αφού το καθένα περιέχει τη μία από τις δύο «πρώην» αδελφές χρωματίδες από κάθε χρωμόσωμα.

Σημείωση: Ο όρος διπλασιασμένα χρωμοσώματα, όπως χρησιμοποιείται εδώ από το σχολικό βιβλίο είναι ανακριβής καθώς χρωμόσωμα συνιστούν οι ενωμένες στο κεντρομερίδιο αδελφές χρωματίδες. Το χρωμόσωμα με τη μορφή αδελφών χρωματίδων ενωμένων στο κεντρομερίδιο έχει προκύψει από το διπλασιασμό του χρωμοσώματος όταν αυτό ήταν με τη μορφή ινιδίου χρωματίνης.

ΘΕΜΑ 3o

1. Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία με την οποία ένα γονίδιο ενεργοποιείται, για να παράγει μια πρωτεΐνη. Όμως σε κάθε κύτταρο δεν παράγονται όλες οι πρωτεΐνες σε κάθε χρονική στιγμή. Επιπλέον, επειδή το κύτταρο χρειάζεται κάθε πρωτεΐνη σε συγκεκριμένη ποσότητα, οι πρωτεΐνες ενός κυττάρου δεν παράγονται σε ίσες ποσότητες. Αν λοιπόν όλα τα γονίδια δούλευαν με τον ίδιο ρυθμό, ορισμένες πρωτεΐνες θα παράγονταν σε μεγάλες ποσότητες και άλλες σε ποσότητες που δε θα επαρκούσαν. Έτσι, είναι απαραίτητη η ύπαρξη και η λειτουργία ενός προγράμματος ρύθμισης της γονιδιακής έκφρασης, που παρέχει τις οδηγίες για το είδος και την ποσότητα των πρωτεϊνών οι οποίες πρέπει να παραχθούν σε κάθε συγκεκριμένη χρονική στιγμή.

Στα βακτήρια η ρύθμιση της γονιδιακής έκφρασης αποσκοπεί κυρίως στην προσαρμογή του οργανισμού στις εναλλαγές του περιβάλλοντος, έτσι ώστε να εξασφαλίζονται οι καλύτερες συνθήκες για τη βασική λειτουργία του που είναι η αύξηση και η διαίρεση.

Ένα βακτηριακό κύτταρο E.coli έχει περισσότερα από 4.000 γονίδια. Μερικά γονίδια μεταγράφονται συνεχώς και κωδικοποιούν πρωτεΐνες, που χρειάζονται για τις βασικές λειτουργίες του κυττάρου. Άλλα γονίδια μεταγράφονται μόνο όταν το κύτταρο αναπτύσσεται σε ειδικές περιβαλλοντικές συνθήκες, επειδή τα προϊόντα των γονιδίων αυτών είναι απαραίτητα για την επιβίωση του κυττάρου στις συνθήκες αυτές.

2. Τα κύτταρα ενός πολυκύτταρου οργανισμού, σε αντίθεση με τα κύτταρα που ανήκουν σε ένα βακτηριακό στέλεχος και είναι πανομοιότυπα μεταξύ τους, διαφέρουν στη δομή και στη λειτουργία τους. Η ζωή αρχίζει, όταν ένα γονιμοποιημένο ωάριο διαιρείται με μίτωση και παράγει τρισεκατομμύρια κύτταρα, που έχουν τα ίδια γονίδια. Στα αρχικά στάδια της εμβρυογένεσης, τα κύτταρα εξειδικεύονται για να εκτελέσουν επιμέρους λειτουργίες και η διαδικασία αυτή ονομάζεται κυτταρική διαφοροποίηση. Τα κύτταρα ενός πολύπλοκου πολυκύτταρου οργανισμού, όπως τα νευρικά, τα μυϊκά, τα ηπατικά, διαφέρουν στη μορφή και στη λειτουργία τους, αλλά έχουν όλα το ίδιο γενετικό υλικό, άρα και τα ίδια γονίδια. Τι τα κάνει τότε να διαφέρουν τόσο πολύ; Μολονότι όλα τα κύτταρα έχουν τις ίδιες γενετικές οδηγίες, έχουν αναπτύξει μηχανισμούς που τους επιτρέπουν να εκφράζουν τη γενετική τους πληροφορία επιλεκτικά και να ακολουθούν μόνο τις οδηγίες που χρειάζονται κάθε χρονική στιγμή. Κάθε κυτταρικός τύπος έχει εξειδικευμένη λειτουργία και πρέπει να υπάρχει πλήρης συντονισμός των λειτουργιών όλων των κυττάρων. Γι’ αυτό, η τελειοποίηση των συστημάτων ελέγχου είναι αναγκαία και λόγω της μεγαλύτερης πολυπλοκότητας των ευκαρυωτικών κυττάρων, αλλά και επειδή πρέπει να ελεγχθεί προσεκτικά η ανάπτυξη των πολυκύτταρων οργανισμών. Κατά συνέπεια, η ρύθμιση των γονιδίων στα ευκαρυωτικά κύτταρα γίνεται σε πολλά επίπεδα.

Συγκεκριμένα στα ευκαρυωτικά κύτταρα η γονιδιακή έκφραση ρυθμίζεται σε τέσσερα επίπεδα: Στο επίπεδο της μεταγραφής, στο επίπεδο μετά τη μεταγραφή, στο επίπεδο της μετάφρασης και στο επίπεδο μετά τη μετάφραση.

3. Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Η μεταγραφή καταλύεται από ένα ένζυμο, την RNA πολυμεράση (στους ευκαρυωτικούς οργανισμούς υπάρχουν τρία είδη RNA πολυμερασών).

Η RNA πολυμεράση προσδένεται σε ειδικές περιοχές του DNA, που ονομάζονται υποκινητές, με τη βοήθεια πρωτεϊνών που ονομάζονται μεταγραφικοί παράγοντες. Οι υποκινητές και οι μεταγραφικοί παράγοντες αποτελούν τα ρυθμιστικά στοιχεία της μεταγραφής του DNA και επιτρέπουν στην RNA πολυμεράση να αρχίσει σωστά τη μεταγραφή. Οι υποκινητές βρίσκονται πάντοτε πριν από την αρχή κάθε γονιδίου.

Κατά την έναρξη της μεταγραφής ενός γονιδίου η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA.

Η μεταγραφή καθορίζει ποια γονίδια θα εκφράσουν, σε ποιους ιστούς (στους πολυκύτταρους ευκαρυωτικούς οργανισμούς), και σε ποια στάδια της ανάπτυξης.

Ένας αριθμός μηχανισμών ελέγχει ποια γονίδια θα μεταγραφούν ή/και με ποια ταχύτητα θα γίνει η μεταγραφή. Το DNA των ευκαρυωτικών κυττάρων δεν οργανώνεται σε οπερόνια αλλά κάθε γονίδιο έχει το δικό του υποκινητή και μεταγράφεται αυτόνομα. Η RNA πολυμεράση λειτουργεί (όπως και στους προκαρυωτικούς οργανισμούς) με τη βοήθεια πρωτεϊνών, που ονομάζονται μεταγραφικοί παράγοντες. Μόνο που στους ευκαρυωτικούς οργανισμούς οι μεταγραφικοί παράγοντες παρουσιάζουν τεράστια ποικιλία. Κάθε κυτταρικός τύπος περιέχει διαφορετικά είδη μεταγραφικών παραγόντων. Διαφορετικός συνδυασμός μεταγραφικών παραγόντων ρυθμίζει τη μεταγραφή κάθε γονιδίου. Μόνο όταν ο σωστός συνδυασμός των μεταγραφικών παραγόντων προσδεθεί στον υποκινητή ενός γονιδίου, αρχίζει η RNA πολυμεράση τη μεταγραφή αυτού του γονιδίου.

ΘΕΜΑ 4o

Η διαδικασία της αντιγραφής, όπως υποδηλώνεται από τη δομή της διπλής έλικας και τον ημισυντηρητικό μηχανισμό, φαίνεται απλή. Όμως, ύστερα από πολύχρονη ερευνητική μελέτη, διαπιστώθηκε ότι η διαδικασία στην πραγματικότητα είναι ιδιαίτερα πολύπλοκη. Τα κύτταρα διαθέτουν ένα σημαντικό «οπλοστάσιο» εξειδικευμένων ενζύμων και άλλων πρωτεϊνών, που λειτουργούν ταυτόχρονα και καταλύουν τις χημικές αντιδράσεις της αντιγραφής με μεγάλη ταχύτητα και με εκπληκτική ακρίβεια.

Τα βασικά στάδια του μηχανισμού της αντιγραφής παρουσιάζουν σημαντικές ομοιότητες μεταξύ προκαρυωτικών και ευκαρυωτικών κυττάρων.

Η αντιγραφή του DNA αρχίζει από καθορισμένα σημεία που ονομάζονται θέσεις έναρξης της αντιγραφής. Το βακτηριακό DNA που είναι κυκλικό έχει μόνο μία θέση έναρξης της αντιγραφής.

Στα ευκαρυωτικά κύτταρα πριν την αντιγραφή, το DNA κάθε χρωμοσώματος είναι ένα μακρύ γραμμικό μόριο, το οποίο έχει πολυάριθμες θέσεις έναρξης της αντιγραφής. Έτσι το DNA των ευκαρυωτικών κυττάρων αντιγράφεται ταυτόχρονα από εκατοντάδες σημεία σε όλο το μήκος του και στη συνέχεια τα τμήματα που δημιουργούνται ενώνονται μεταξύ τους.

Για να αρχίσει η αντιγραφή του DNA, είναι απαραίτητο να ξετυλιχθούν στις θέσεις έναρξης της αντιγραφής οι δύο αλυσίδες. Αυτό επιτυγχάνεται με τη βοήθεια ειδικών ενζύμων, που σπάζουν τους δεσμούς υδρογόνου μεταξύ των δύο αλυσίδων. Τα ένζυμα αυτά ονομάζονται DNA ελικάσες. Όταν ανοίξει η διπλή έλικα, δημιουργείται μια «θηλιά», η οποία αυξάνεται και προς τις δύο κατευθύνσεις.

Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA ονομάζονται DNA πολυμεράσες. Επειδή τα ένζυμα αυτά δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. DNA πολυμεράσες επιμηκύνουν τα πρωταρχικά τμήματα, τοποθετώντας συμπληρωματικά δεοξυριβονουκλεοτίδια απέναντι από τις μητρικές αλυσίδες του DNA. Τα νέα μόρια DNA αρχίζουν να σχηματίζονται, καθώς δημιουργούνται δεσμοί υδρογόνου μεταξύ των συμπληρωματικών αζωτούχων βάσεων των δεοξυριβονουκλεοτιδίων. DNA πολυμεράσες επιδιορθώνουν επίσης λάθη που συμβαίνουν κατά τη διάρκεια της αντιγραφής. Μπορούν, δηλαδή, να «βλέπουν» και να απομακρύνουν νουκλεοτίδια που οι ίδιες τοποθετούν, κατά παράβαση του κανόνα της συμπληρωματικότητας, και να τοποθετούν τα σωστά. Ταυτόχρονα DNA πολυμεράσες απομακρύνουν τα πρωταρχικά τμήματα RNA και τα αντικαθιστούν με τμήματα DNA.

Οι DNA πολυμεράσες λειτουργούν μόνο προς καθορισμένη κατεύθυνση και τοποθετούν τα νουκλεοτίδια στο ελεύθερο 3΄ άκρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου κάθε αναπτυσσόμενης αλυσίδας. Έτσι, λέμε ότι αντιγραφή γίνεται με προσανατολισμό 5΄ προς 3΄.

Kάθε νεοσυντιθέμενη αλυσίδα θα έχει προσανατολισμό 5΄→3΄. Έτσι, σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες θα είναι αντιπαράλληλες. Για να ακολουθηθεί αυτός ο κανόνας σε κάθε τμήμα DNA που γίνεται η αντιγραφή, η σύνθεση του DNA είναι συνεχής στη μία αλυσίδα και ασυνεχής στην άλλη. Τα κομμάτια της ασυνεχούς αλυσίδας συνδέονται μεταξύ τους με τη βοήθεια ενός ενζύμου, που ονομάζεται DNA δεσμάση. Το ίδιο ένζυμο συνδέει και όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης της αντιγραφής.

Κατά την αντιγραφή του DNA λοιπόν, τα ένζυμα που τοποθετούν συμπληρωματικά ως προς τους μητρικούς κλώνους νουκλεοτίδια, προκειμένου να αναπτυχθούν οι θυγατρικοί κλώνοι κατά τον ημισυντηρητικό τρόπο αντιγραφής, είναι το πριμόσωμα (σύμπλοκο ενζύμων) και φυσικά οι DNA πολυμεράσες. Ακόμη συμπληρωματικά νουκλεοτίδια τοποθετούνται και από τα επιδιορθωτικά ένζυμα. Τα επιδιορθωτικά ένζυμα επιδιορθώνουν τα λάθη που συνέβησαν κατά την διαδικασία της αντιγραφής του DNA και δεν επιδιοθώθηκαν από την DNA πολυμεράση. Η δράση των επιδιορθωτικών ενζύμων περιορίζει τα λάθη της αντιγραφής σε 1 κάθε 1010 νουκλεοτίδια καθιστώντας την αντιγραφή μία εξαιρετικά ακριβής διαδικασία.

Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο mRNA με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η αλληλουχία των βάσεων του mRNA καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση έναν κώδικα αντιστοίχησης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών, τον γενετικό κώδικα. Το μόριο RNA που συντίθεται κατά τη μεταγραφή είναι συμπληρωματικό προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική. Το RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Η μεταγραφή όπως και η αντιγραφή έχει προσανατολισμό 5΄→3΄.

Εφόσον η κωδική αλυσίδα του γονιδίου έχει την αλληλουχία:

5΄…ATG CCA TGC AAA CCG AAA TGA…3΄

Το μόριο mRNA που προκύπτει από τη μεταγραφή του γονιδίου θα είναι:

5΄…AUG CCA UGC AAA CCG AAA UGA…3΄

Η RNA πολυμεράση, το ένζυμο που επιτελεί τη μεταγραφή, τοποθετεί ριβονουκλεοτίδια απέναντι από τα δεοξυριβονουκλεοτίδια της μη κωδικής αλυσίδας του DNA του γονιδίου, σύμφωνα με τον κανόνα της συμπληρωματικότητας των βάσεων, όπως και στην αντιγραφή, μόνο που εδώ απέναντι από την αδενίνη τοποθετείται το ριβονουκλεοτίδιο ουρακίλη. Συνεπώς το παραγόμενο mRNA διαθέτει την ίδια αλληλουχία νουκλεοτιδίων (ριβονουκλεοτιδίων) με την κωδική αλυσίδα του γονιδίου (δεοξυριβονουκλεοτιδίων) και συμπληρωματική αλληλουχία νουκλεοτιδίων (ριβονουκλεοτιδίων) με τη μη κωδική αλυσίδα του γονιδίου (δεοξυριβονουκλεοτιδίων).

Το γενετικό υλικό μπορεί να υποστεί αλλαγές με πολλούς και διαφορετικούς τρόπους. Οι αλλαγές στην αλληλουχία του DNA ονομάζονται μεταλλάξεις. Οι μεταλλάξεις δημιουργούν συνήθως έναν διαφορετικό φαινότυπο χωρίς όμως αυτό να είναι πάντοτε απαραίτητο. Αυτό εξαρτάται από τον τρόπο με τον οποίο η αλλαγή επιδρά στο γονιδιακό προϊόν, δηλαδή την πρωτεΐνη.

Οι γενετιστές κατατάσσουν τις μεταλλάξεις σε δύο μεγάλες κατηγορίες: Τις γονιδιακές και τις χρωμοσωμικές. Ο τυπικός αυτός διαχωρισμός σχετίζεται με την έκταση της αλλαγής. Αν αυτή αφορά μικρό αριθμό βάσεων, στις οποίες συμβαίνει αντικατάσταση, προσθήκη ή έλλειψη, τότε ονομάζεται γονιδιακή μετάλλαξη. Αν αφορά αλλαγές σε μεγαλύτερο τμήμα του χρωμοσώματος, ονομάζεται χρωμοσωμική ανωμαλία.

Η αλλαγή που συνέβη στην κωδική αλυσίδα του γονιδίου που δίνεται και έχει ως αποτέλεσμα το 4ο κωδικόνιο στο παραγόμενο mRNA να έχει τις βάσεις 5΄UAA3΄ και ταυτόχρονα να διατηρείται σταθερός ο αριθμός των νουκλεοτιδίων του γονιδίου καθώς και το πλαίσιο ανάγνωσής του (διαδρομή με βήμα τριπλέτας από το κωδικόνιο έναρξης του γονιδίου μέχρι το κωδικόνιο λήξης) συνιστά μία σημειακή μετάλλαξη αντικατάστασης βάσης, όπου η πρώτη αδενίνη (Α) του 4ου κωδικονίου της κωδικής αλυσίδας του DNA του γονιδίου αντικαθίσταται από μία θυμίνη (Τ), με αποτέλεσμα το παραγόμενο mRNA κατά τη μεταγραφή να είναι τώρα:

5΄…AUG CCA UGC UAA CCG AAA UGA…3΄

Η μετάλλαξη αυτή που συνέβη στο γονίδιο οδηγεί στο σχηματισμό πρόωρου κωδικονίου λήξης της μετάφρασης (το φυσιολογικό κωδικόνιο λήξης είναι το 5΄UGA3΄ που συνιστά την 7η τριπλέτα του mRNA που προκύπτει από τη μεταγραφή του δοθέντος κλώνου του γονιδίου) καθώς το κωδικόνιο 5΄ΤΑΑ3΄ που δημιουργείται στην κωδική αλυσίδα μεταγράφεται στο κωδικόνιο 5΄UAA3΄, στο παραγόμενο mRNA. Το κωδικόνιο 5΄UAA3΄ στο mRNA όπως και το κωδικόνιο 5΄ΤΑΑ3΄ στην κωδική αλυσίδα του DNA συνιστά κωδικόνιο λήξης για τον γενετικό κώδικα.

Η παρουσία του κωδικονίου λήξης στο μόριο του mRNA οδηγεί στον τερματισμό της πρωτεϊνοσύνθεσης επειδή δεν υπάρχουν tRNA που να αντιστοιχούν σε αυτό.

Το αποτέλεσμα λοιπόν αυτής της μετάλλαξης που συνέβη είναι ένα μικρότερο και πιθανόν μη λειτουργικό πεπτίδιο.

Πολλά ριβοσώματα μπορούν να μεταφράζουν ταυτόχρονα ένα mRNA, το καθένα σε διαφορετικό σημείο κατά μήκος του μορίου. Αμέσως μόλις το ριβόσωμα έχει μεταφράσει τα πρώτα κωδικόνια, η θέση έναρξης του mRNA είναι ελεύθερη για την πρόσδεση ενός άλλου ριβοσώματος. Το σύμπλεγμα των ριβοσωμάτων με το mRNA ονομάζεται πολύσωμα. Έτσι, η πρωτεϊνοσύνθεση είναι μία “οικονομική διαδικασία”. Ένα κύτταρο μπορεί να παράγει μεγάλα ποσά μίας πρωτεΐνης από ένα ή από δύο αντίγραφα ενός γονιδίου.

Σχόλια: Στο σχήμα της διχάλας αντιγραφής που δίνεται στην εκφώνηση, δεν προσδιορίζεται η θέση έναρξης της αντιγραφής, οπότε δεν μπορούμε να γνωρίζουμε τα όρια της συγκεκριμένης διχάλας. Έτσι είμαστε υποχρεωμένοι να αυθαιρετοποιήσουμε, δεχόμενοι ότι η θέση έναρξης της αντιγραφής βρίσκεται εκεί που έχει τοποθετηθεί το 3΄ άκρο της Α αλυσίδας της διχάλας.

Το ένζυμο DNA δεσμάση δεν δρα μόνο κατά την αντιγραφή του κλώνου Β, αλλά και κατά την αντιγραφή του κλώνου Α, όταν πραγματοποιείται η σύνδεση του τελευταίου νουκλεοτίδιου του πρωταρχικού τμήματος που αντικαταστάθηκε από την DNA πολυμεράση από ριβονουκλεοτίδιο σε δεοξυνουκλεοτίδιο, με το πρώτο δεοξυνουκλεοτίδιο που αναπτυσσόμενου κλώνου που τοποθετήθηκε από την DNA πολυμεράση μετά τη δράση του πριμοσώματος, κατά την αντιγραφή του Α κλώνου της δοθείσας διχάλας αντιγραφής.

Σύμφωνα με το σχολικό βιβλίο, οι τριπλέτες των νουκλεοτιδίων που ακολουθούν το κωδικόνιο λήξης δεν νοούνται ως κωδικόνια, αφού δεν κωδικοποιούν για κάποιο αμινοξύ. Τα νουκλεοτίδια που ακολουθούν αμέσως μετά το κωδικόνιο λήξης ανήκουν στην 3΄ αμετάφραστη περιοχή του γονιδίου, εκτός και αν είναι πολύ μακριά από το κωδικόνιο λήξης και μετά από αυτό, οπότε μπορεί να ανήκουν στις αλληλουχίες λήξης της μεταγραφής του γονιδίου. Συνεπώς η έκφραση στην εκφώνηση “… ο αριθμός των κωδικονίων να παραμείνει σταθερός.” είναι αδόκιμη.

Η λύση που δόθηκε παραπάνω βασίστηκε στο ότι ο αριθμός των νουκλεοτιδίων του γονιδίου παραμένει σταθερός και ταυτόχρονα δεν μεταβάλλεται το πλαίσιο ανάγνωσης του γονιδίου, υποθέτοντας ότι η έκφραση της εκφώνησης του θέματος που αναφέρθηκε παραπάνω, ήθελε να υποδηλώσει ότι δεν έγινε προσθήκη ή έλλειψη νουκλεοτιδίων στο γονίδιο, μετάλλαξη που θα οδηγούσε σε αλλαγή του αριθμού των νουκλεοτιδίων και σε αλλαγή και του αναγνωστικού πλαισίου από το σημείο της μετάλλαξης και μετά. Διαφορετικά θα μπορούσε να θεωρηθεί σωστή και η απάντηση που στηρίζεται στην προσθήκη μίας θυμίνης (Τ) αμέσως πριν το 4ο κωδικόνιο (5΄ΑΑΑ3΄) οπότε διαφοροποιείται ο αριθμός των νουκλεοτιδίων και αλλάζει το αναγνωστικό πλαίσιο του γονιδίου καθώς σχηματίζεται ως 4ο κωδικόνιο το 5΄ΤΑΑ3΄ στην κωδική αλυσίδα, που οδηγεί στο κωδικόνιο 5΄UΑΑ3΄ του mRNA και αυτό είναι κωδικόνιο λήξης.

Βιολογία Θετικής κατεύθυνσης Γ’ Λυκείου-Θέματα επαναληπτικών εξετάσεων ημερησίων λυκείων έτος 2005

ΘΕΜΑ 1ο

Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

1. Στα πειράματά τους οι Avery, Mac-Leod και McCarty διαπίστωσαν ότι o μετασχηματισμός των αδρών βακτηρίων σε λεία οφείλεται…

α. στο DNA.

β. στο RNA.

γ. στους υδατάνθρακες.

δ. στις πρωτεΐνες.

Μονάδες 5

2. Η αιμορροφιλία Α είναι μια ασθένεια που εμφανίζεται…

α. συχνότερα στα θηλυκά άτομα.

β. μόνο στα θηλυκά άτομα.

γ. συχνότερα στα αρσενικά άτομα.

δ. μόνο στα αρσενικά άτομα.

Μονάδες 5

3. Ο χαρακτήρας προσκολλημένοι λοβοί των αυτιών στον άνθρωπο καθορίζεται από…

α. αυτοσωμικό επικρατές γονίδιο.

β. φυλοσύνδετο επικρατές γονίδιο.

γ. αυτοσωμικό υπολειπόμενο γονίδιο.

δ. φυλοσύνδετο υπολειπόμενο γονίδιο.

Μονάδες 5

4. Η χρωμοσωμική ανωμαλία που αλλάζει την ποσότητα του γενετικού υλικού ενός κυττάρου είναι…

α. η αναστροφή.

β. ο διπλασιασμός.

γ. η μετατόπιση.

δ. η αμοιβαία μετατόπιση.

Μονάδες 5

5. Οι μικροοργανισμοί παράγουν συνήθως χρήσιμα προϊόντα κατά τη διάρκεια…

α. μόνο της στατικής φάσης ανάπτυξής τους.

β. της εκθετικής και στατικής φάσης ανάπτυξής τους.

γ. μόνο της εκθετικής φάσης ανάπτυξής τους.

δ. της λανθάνουσας και εκθετικής φάσης ανάπτυξής τους.

Μονάδες 5

ΘΕΜΑ 2ο

Να απαντήσετε στις παρακάτω ερωτήσεις:

1. Τι δυνατότητες δίνουν στους αγρότες τα γενετικά τροποποιημένα φυτά (Μονάδες 4) και

ποια είναι τα κυριότερα φυτά που έχουν τροποποιηθεί γενετικά (Μονάδες 5);

Μονάδες 9

2. Τι μπορούμε να πετύχουμε με τη μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης (PCR) και ποιες είναι οι πρακτικές εφαρμογές της;

Μονάδες 8

3. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση, πριν προχωρήσουν στην απόκτηση απογόνων;

Μονάδες 8

ΘΕΜΑ 3ο

Η Βιοτεχνολογία με την παραγωγή μονοκλωνικών αντισωμάτων και τη γονιδιακή θεραπεία έχει συμβάλει αποτελεσματικά στην υλοποίηση των βασικών στόχων της Ιατρικής, μεταξύ των οποίων είναι και η αποτελεσματική θεραπεία ασθενειών.

1. Γιατί τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν στη θεραπεία του καρκίνου (Μονάδες 6)

και ποια είναι τα πλεονεκτήματα που παρουσιάζει η χρήση τους έναντι άλλων μεθόδων θεραπείας του (Μονάδες 2);

Μονάδες 8

2. Ποια διαδικασία ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος, η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (Μονάδες 8) και τι πιθανά προβλήματα αντιμετωπίζουν τα άτομα που πάσχουν από τη συγκεκριμένη ασθένεια (Μονάδες 3);

Μονάδες 11

3. Γιατί η χρήση της γονιδιακής θεραπείας θα είναι περιορισμένη στο άμεσο μέλλον;

Μονάδες 6

ΘΕΜΑ 4ο

Δίνονται τρία κωδικόνια ενός τμήματος γονιδίου από ένα μόριο DNA ευκαρυωτικού κυττάρου που κωδικοποιούν τη σύνθεση ενός πεπτιδικού τμήματος μιας πρωτεΐνης, και η διεύθυνση της μεταγραφής.

Να ορίσετε τα άκρα 3΄ και 5΄ των παραπάνω αλυσίδων DNA και να αιτιολογήσετε την απάντησή σας (Μονάδες 5).

Να γράψετε την αλληλουχία των βάσεων του τμήματος του mRNA που προκύπτει από τη μεταγραφή, σημειώνοντας τα άκρα 3΄ και 5΄ και να αιτιολογήσετε την απάντησή σας (Μονάδες 7).

Ποιο ένζυμο καταλύει το μηχανισμό της μεταγραφής και ποια είναι η δράση του μετά την πρόσδεσή του στον υποκινητή (Μονάδες 7); Τι επιπτώσεις μπορεί να έχει στη λειτουργικότητα της πρωτεΐνης, η οποία δεν τροποποιείται, η προσθήκη τριών διαδοχικών βάσεων που δεν κωδικοποιούν κωδικόνιο λήξης ή μιας βάσης, μεταξύ των παραπάνω κωδικονίων

(Μονάδες 6);

Μονάδες 25

ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2005

ΘΕΜΑ 1o

Οι σωστές απαντήσεις είναι:

1. α

2. γ

3. γ

4. β

5. β

ΘΕΜΑ 2o

1. Τα φυτά που έχουν υποστεί γενετική αλλαγή με τη χρήση των τεχνικών της Γενετικής Μηχανικής ονομάζονται διαγονιδιακά ή γενετικώς τροποποιημένα. Τα διαγονιδιακά φυτά προκύπτουν μετά από προσθήκη νέων γονιδίων απευθείας στον οργανισμό, οπότε καθίσταται δυνατή σε σύντομο χρονικό διάστημα η δημιουργία φυτών που έχουν τα επιθυμητά χαρακτηριστικά και μπορούν να τα μεταβιβάζουν στους απογόνους τους. Οι προσπάθειες των ερευνητών επικεντρώνονται στη δημιουργία γενετικά τροποποιημένων φυτών τα οποία θα δίνουν τη δυνατότητα στους αγρότες:

• Να προφυλάσσουν αποτελεσματικά τις καλλιέργειες από τις ασθένειες, τα έντομα και τα ζιζάνια.

• Να παράγουν προϊόντα τα οποία έχουν μεγαλύτερη «διάρκεια ζωής» από το χωράφι έως τον καταναλωτή.

Τα κυριότερα φυτά τα οποία έχουν τροποποιηθεί για τις παραπάνω ιδιότητες είναι η σόγια, το καλαμπόκι (για τροφή των ζώων), το βαμβάκι, ο καπνός και η ελαιοκράμβη.

Τα έντομα μπορεί να δημιουργήσουν μεγάλα προβλήματα στη γεωργία και να οδηγήσουν σε σημαντική μείωση της παραγωγής. Μετά το Δεύτερο Παγκόσμιο Πόλεμο χρησιμοποιήθηκαν πολλά εντομοκτόνα. Με την πάροδο των χρόνων όμως έγινε κατανοητό ότι ήταν επικίνδυνα για την υγεία του ανθρώπου και προκαλούσαν μεγάλη οικολογική καταστροφή. Ήταν λοιπόν αναγκαίο να βρεθούν εναλλακτικοί τρόποι αντιμετώπισης του προβλήματος. Το βακτήριο Bacillus thuringiensis, που ζει στο έδαφος παράγει μια ισχυρή τοξίνη, η οποία μπορεί να καταστρέψει πολλά είδη εντόμων και σκωλήκων και είναι 80.000 φορές πιο ισχυρή από πολλά εντομοκτόνα. Έγιναν προσπάθειες απομόνωσης του γονιδίου του βακτηρίου που παράγει την τοξίνη, και μεταφοράς του στα φυτά. Η μεταφορά στα φυτά έγινε με τη βοήθεια του πλασμιδίου Ti του Agrobacterium tumefaciens. Τα γενετικά τροποποιημένα φυτά θα είναι έτσι ανθεκτικά στα διάφορα έντομα. Το πρώτο φυτό στο οποίο ενσωματώθηκε το γονίδιο της ανθεκτικότητας στα έντομα του Bacillus thuringiensis ήταν το καλαμπόκι. (Τα γενετικά τροποποιημένα φυτά αυτού του τύπου αποτελούν τις ποικιλίες Βt).

2. Η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR: Polymerase Chain Reaction) μας επιτρέπει να αντιγράψουμε επιλεκτικά, εκατομμύρια φορές, ειδικές αλληλουχίες DNA από ένα σύνθετο μείγμα μορίων DNA, χωρίς τη μεσολάβηση ζωντανού κυττάρου. Η τεχνική αυτή που άρχισε να εφαρμόζεται ευρέως από το 1985, έχει αυξήσει την ευαισθησία των γενετικών αναλύσεων και έχει πολλές πρακτικές εφαρμογές. Για παράδειγμα χρησιμοποιείται στην Ιατρική για τη διάγνωση ασθενειών όπως του AIDS, στην εγκληματολογία για τη διαλεύκανση υποθέσεων και στη μελέτη DNA από απολιθώματα.

3. Η γενετική καθοδήγηση είναι μία διαδικασία κατά την οποία ειδικοί επιστήμονες δίνουν πληροφορίες σε μεμονωμένα άτομα, ζευγάρια και οικογένειες που πάσχουν από κάποια γενετική ασθένεια ή έχουν αυξημένες πιθανότητες να την εμφανίσουν. Οι πληροφορίες αυτές είναι απαραίτητες για τους ενδιαφερόμενους, γιατί τους βοηθούν στη λήψη αποφάσεων, κυρίως σχετικά με την απόκτηση υγιών απογόνων.

Παρ’ ότι η γενετική καθοδήγηση μπορεί να ζητήσουν όλοι οι υποψήφιοι γονείς, υπάρχουν ομάδες ατόμων οι οποίες είναι απαραίτητο να απευθυνθούν σε ειδικούς πριν προχωρήσουν στην απόκτηση απογόνων. Σε αυτές περιλαμβάνονται:

• Άτομα-φορείς γενετικών ασθενειών.

• Άτομα με οικογενειακό ιστορικό γενετικών ασθενειών.

• Γυναίκες ηλικίας 35 ετών και άνω.

• Γυναίκες με πολλαπλές αποβολές.

ΘΕΜΑ 3o

1. Τα αντισώματα είναι πρωτεϊνικά μόρια, που παράγονται από τα Β-λεμφοκύτταρα του ανοσοποιητικού μας συστήματος, όταν ένα αντιγόνο (παθογόνος μικροοργανισμός, ιός ή ξένο υλικό) προσβάλλει τον οργανισμό. Τα αντισώματα αντιδρούν με το αντιγόνο και το εξουδετερώνουν.

Ο οργανισμός μας είναι ικανός να παράγει αντισώματα εναντίον κάθε ξένου αντιγόνου. Στην πραγματικότητα, ένα αντίσωμα αναγνωρίζει μόνο μία περιοχή του αντιγόνου, η οποία ονομάζεται αντιγονικός καθοριστής.

Κάθε είδος αντισώματος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται από μία ομάδα όμοιων Β-λεμφοκυττάρων, που αποτελούν έναν κλώνο. Τα αντισώματα που παράγονται από ένα κλώνο Β-λεμφοκυττάρων ονομάζονται μονοκλωνικά.

Τα αντισώματα μπορούν να χρησιμοποιηθούν ως θεραπευτικά. Η πιο ενδιαφέρουσα εφαρμογή τους αφορά τη θεραπεία του καρκίνου. Τα καρκινικά κύτταρα έχουν στην εξωτερική επιφάνειά τους μεγάλη ποικιλία αντιγόνων που δεν υπάρχουν στα φυσιολογικά κύτταρα του οργανισμού, και ονομάζονται καρκινικά αντιγόνα. Έτσι μπορούν να κατασκευαστούν μονοκλωνικά αντισώματα εναντίον αυτών των αντιγόνων. Τα μονοκλωνικά αντισώματα είναι πολύ ειδικά μόνο για τα καρκινικά κύτταρα και μπορούν να «γίνουν μεταφορείς» ισχυρών αντικαρκινικών φαρμάκων. Όταν εισαχθούν στον οργανισμό, βρίσκουν και προσβάλλουν τους καρκινικούς στόχους. Τα αντικαρκινικά φάρμακα, που είναι συνδεδεμένα με τα αντισώματα, δρουν κατευθείαν στα καρκινικά κύτταρα και τα καταστρέφουν. Επιτρέπουν έτσι τη θεραπεία με αποφυγή της χειρουργικής επέμβασης και των δυσάρεστων επιπτώσεων της χημειοθεραπείας.

2. Η τεχνολογία του ανασυνδυασμένου DNA σε συνδυασμό με τις μεθόδους της παραδοσιακής Γενετικής (γενεαλογικά δένδρα) οδήγησε στον εντοπισμό της θέσης στα χρωμοσώματα (χαρτογράφηση) πολλών μεταλλαγμένων γονιδίων, που προκαλούν τις αντίστοιχες ασθένειες. Επιπλέον ορισμένα μεταλλαγμένα γονίδια κλωνοποιήθηκαν και συγκρίθηκαν με τα φυσιολογικά αλληλόμορφά τους, για να εξακριβωθεί το είδος των μεταλλάξεων. Οι γνώσεις αυτές έδωσαν τη δυνατότητα ανάπτυξης θεραπείας που στηρίζεται στην τεχνολογία του ανασυνδυασμένου DNA και ονομάζεται γονιδιακή θεραπεία. Αυτή έχει ως στόχο να «διορθώσει» τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου. Απαραίτητη προϋπόθεση για την εφαρμογή της γονιδιακής θεραπείας είναι, εκτός από την κλωνοποίηση του υπεύθυνου γονιδίου, και ο προσδιορισμός των κυττάρων που εμφανίζουν τη βλάβη από την ασθένεια.

Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990 σε ένα τετράχρονο κορίτσι που έπασχε από ανεπάρκεια του ανοσοποιητικού συστήματος. Η ασθένεια αυτή οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA), που παίρνει μέρος στο μεταβολισμό των πουρινών στα κύτταρα του μυελού των οστών. Η έλλειψη οφείλεται σε μετάλλαξη του γονιδίου που παράγει το ένζυμο αυτό.

Η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας είναι η εξής:

• Λεμφοκύτταρα του παιδιού παραλαμβάνονται και πολλαπλασιάζονται σε κυτταροκαλλιέργειες.

• Το φυσιολογικό γονίδιο της απαμινάσης της αδενοσίνης ενσωματώνεται σε έναν ιό-φορέα (ο οποίος έχει καταστεί αβλαβής) με τις τεχνικές του ανασυνδυασμένου DNA.

• O γενετικά τροποποιημένος ιός εισάγεται στα λεμφοκύτταρα.

• Τα γενετικά τροποποιημένα λεμφοκύτταρα εισάγονται με ενδοφλέβια ένεση στο παιδί και παράγουν το ένζυμο ADA.

Βέβαια, τα τροποποιημένα λεμφοκύτταρα δεν ζουν για πάντα μέσα στον οργανισμό – δηλαδή η θεραπεία δεν είναι μόνιμη – και χρειάζεται συνεχής έκχυση τέτοιων κυττάρων. Όμως τα άτομα μπορούν να ζουν φυσιολογικά, κάνοντας σε τακτά χρονικά διαστήματα αυτή τη θεραπεία. Ο τύπος αυτός της γονιδιακής θεραπείας ονομάζεται ex vivo, γιατί τα κύτταρα τροποποιούνται έξω από τον οργανισμό και εισάγονται πάλι σε αυτόν.

Η παραπάνω ασθένεια εμφανίζει αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. Οι ασθενείς πάσχουν από χρόνιες μολύνσεις, έχουν προδιάθεση για ανάπτυξη καρκίνου σε πολύ μικρή ηλικία και πολλοί πεθαίνουν ύστερα από λίγους μήνες ζωής. Είναι γνωστή η περίπτωση ενός παιδιού που έζησε εννέα χρόνια σε έναν πλαστικό θάλαμο, για να εμποδιστεί η επαφή του με ιούς, επειδή το ανοσοποιητικό του σύστημα δεν μπορούσε να τους καταπολεμήσει.

3. Έως πρόσφατα η πιθανότητα επιτυχούς γονιδιακής θεραπείας ανήκε στη σφαίρα της επιστημονικής φαντασίας. Με τον προσδιορισμό γονιδίων που είναι υπεύθυνα για γενετικές ασθένειες και την εύρεση της αλληλουχίας τους δημιουργούνται νέες προοπτικές για τη γονιδιακή θεραπεία πολλών ασθενειών. Είναι βασικό να τονιστεί ότι παρόλο που η γονιδιακή θεραπεία παρουσιάζεται ως πανάκεια στην Ιατρική, η εφαρμογή της, τουλάχιστον στο άμεσο μέλλον, θα είναι περιορισμένη επειδή δεν έχουν ακόμα ξεπεραστεί προβλήματα όπως αυτά που αφορούν τη χρήση φορέων. Όπως αναφέρθηκε προηγουμένως, στις περισσότερες περιπτώσεις ως φορείς χρησιμοποιούνται ιοί οι οποίοι αν και καθίστανται αβλαβείς, έχουν μικρή πιθανότητα να προκαλέσουν παρενέργειες και σε ορισμένες περιπτώσεις καρκίνο. Έτσι λοιπόν η ανάπτυξη πιο κατάλληλων φορέων είναι ο επόμενος στόχος για τη βελτίωση των μεθόδων της γονιδιακής θεραπείας.

ΘΕΜΑ 4o

Το DNA είναι ένα μακρομόριο που αποτελείται από νουκλεοτίδια. Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση πολλών νουκλεοτιδίων με 3΄→ 5΄ φωσφοδιεστερικό δεσμό, που είναι ένας ομοιοπολικός δεσμός. Ο δεσμός αυτός δημιουργείται μεταξύ του υδροξυλίου του 3΄ άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής ομάδας που βρίσκεται συνδεδεμένη στον 5΄ άνθρακα της πεντόζης του επόμενου νουκλεοτιδίου. Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων από τα οποία αποτελείται η πολυνουκλεοτιδική αλυσίδα το πρώτο της νουκλεοτίδιο έχει πάντα μια ελεύθερη φωσφορική ομάδα συνδεδεμένη στον 5΄ άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο έχει ελεύθερο το υδροξύλιο του 3΄ άνθρακα της πεντόζης του. Γι’ αυτό ο προσανατολισμός της πολυνουκλεοτιδικής αλυσίδας είναι 5΄→ 3΄. Επίσης σύμφωνα με το μοντέλο της διπλής έλικας του DNA, σε κάθε δίκλωνο μόριο DNA, oι δύο πολυνουκλεοτιδικές αλυσίδες που το συνιστούν είναι αντιπαράλληλες, δηλαδή το 3΄ άκρο της μίας είναι απέναντι από το 5΄ άκρο της άλλης. Όπως παρατηρούμε στο δοθέν τμήμα του μορίου του DNA, το 3΄ άκρο της αλυσίδας 1 βρίσκεται στα δεξιά της, αφού εκεί βρίσκεται το ελεύθερο υδροξύλιο. Επομένως είναι:

(1) 5΄… ACA AAG ATA …3΄

(2) 3΄… ΤGT TTC TAT …5΄

Γνωρίζουμε ότι οι υποκινητές βρίσκονται πάντοτε πριν από την αρχή κάθε γονιδίου και η μεταγραφή έχει προσανατολισμό 5΄→3΄ ως προς τον υποκινητή του γονιδίου που προσδιορίζει και τη διεύθυνση της μεταγραφής.

Το μόριο RNA που συντίθεται κατά τη μεταγραφή είναι συμπληρωματικό προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική. Το RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου.

Επομένως από το δοθέν τμήμα DNA η μεταγραφόμενη αλυσίδα είναι η πρώτη αφού αυτή έχει προσανατολισμό 3΄→5΄ ως προς τον υποκινητή που βρίσκεται δεξιά του γονιδίου – όπως προσδιορίζεται η θέση του από τη δοθήσα διεύθυνση μεταγραφής. Συνεπώς, τo mRNA που προκύπτει θα είναι συμπληρωματικό της μεταγραφόμενης αλυσίδας και με προσανατολισμό 5΄→3΄ ως προς τον υποκινητή. Αυτό είναι το:

5΄… UAU CUU UGU …3΄

Η μεταγραφή καταλύεται από ένα ένζυμο, την RNA πολυμεράση (υπάρχουν τρία είδη RNA πολυμερασών στους ευκαρυωτικούς οργανισμούς).

Η RNA πολυμεράση προσδένεται στον υποκινητή, με τη βοήθεια πρωτεϊνών, που ονομάζονται μεταγραφικοί παράγοντες.

Κατά την έναρξη της μεταγραφής του γονιδίου η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA. Στη συνέχεια τοποθετεί απέναντι από τα δεοξυριβονουκλεοτίδια του DNA τα αντίστοιχα ριβονουκλεοτίδια με βάση τον κανόνα της συμπληρωματικότητας των βάσεων, όπως και στην αντιγραφή, με τη διαφορά ότι εδώ απέναντι από την αδενίνη τοποθετείται το ριβονουκλεοτίδιο που περιέχει ουρακίλη. Η RNA πολυμεράση ενώνει τα ριβονουκλεοτίδια που προστίθενται το ένα μετά το άλλο με 3΄→ 5΄ φωσφοδιεστερικό δεσμό και συνεπώς η μεταγραφή, όπως και η αντιγραφή, γίνεται με προσανατολισμό 5΄→ 3΄. Η σύνθεση του RNA σταματά στο τέλος του γονιδίου, όπου ειδικές αλληλουχίες που ονομάζονται αλληλουχίες λήξης της μεταγραφής, επιτρέπουν την απελευθέρωσή του.

Οι αλλαγές στην αλληλουχία του DNA, που ονομάζονται μεταλλάξεις, δημιουργούν συνήθως ένα διαφορετικό φαινότυπο χωρίς όμως αυτό να είναι πάντοτε απαραίτητο. Αυτό εξαρτάται από τον τρόπο με τον οποίο η αλλαγή επιδρά στο γονιδιακό προϊόν, δηλαδή στην πρωτεΐνη. Μια από τις δύο κατηγορίες των μεταλλάξεων είναι οι γονιδιακές μεταλλάξεις. Αυτές αφορούν μικρό αριθμό βάσεων στις οποίες συμβαίνει αντικατάσταση, προσθήκη ή έλλειψη. Αλλαγές στον αριθμό των βάσεων έχουν συνήθως ως αποτέλεσμα την εμφάνιση μεταλλαγμένων φαινοτύπων. Η προσθήκη ή η έλλειψη διαδοχικών βάσεων, μεταξύ των κωδικονίων, σε οποιοδήποτε αριθμό πολλαπλάσιο του τρία δημιουργεί, αντίστοιχα, προσθήκη ή έλλειψη ενός ή περισσότερων αμινοξέων στην πολυπεπτιδική αλυσίδα, που μπορεί να αλλάζει τη λειτουργικότητά της. Αν όμως ο αριθμός των βάσεων είναι διαφορετικός του τρία ή πολλαπλασίων του, τότε η αλληλουχία των αμινοξέων δεν εμφανίζει πλέον πολλές ομοιότητες με την αρχική.

Συνεπώς, εφόσον η μετάλλαξη συνιστάται στην προσθήκη τριών διαδοχικών βάσεων, που δεν κωδικοποιούν κωδικόνιο λήξης, μεταξύ των δοθέντων κωδικονίων του γονιδίου, το γονιδιακό προϊόν που θα κωδικοποιείται από το μεταλλαγμένο γονίδιο θα φέρει ένα επιπλέον αμινοξύ. Οι επιπτώσεις της παρουσίας ενός επιπλέον αμινοξέος στην λειτουργικότητα της πεπτιδικής αλυσίδας εξαρτώνται από το είδος και τη θέση του αμινοξέος, κατά πόσο δηλαδή τροποποιείται η στερεοδιάταξη του πρωτεϊνικού μορίου και σε πιο σημείο του. Εάν το επιπλέον αμινοξύ έχει ως επίδραση την τροποποίηση του ενεργού κέντρου, εφόσον η πρωτεΐνη είναι ένζυμο, ή την περιοχή κοντά σε αυτό, τότε η ενεργότητα του ενζύμου, δηλαδή η ικανότητα κατάλυσης αντιδράσεων μπορεί να ελαττωθεί ή και να μηδενισθεί. Δεν αποκλείεται ωστόσο να αυξηθεί κιόλας, με θετικές ή αρνητικές επιπτώσεις για το κύτταρο. Επίσης, αν η πρωτεΐνη δεν είναι ένζυμο, η μετάλλαξη μπορεί να οδηγήσει σε αλλαγή της δομής της και συνεπώς της λειτουργικότητάς της, με απρόσμενες επιπτώσεις για τη ζωή του κυττάρου.

Στην περίπτωση τώρα που η μετάλλαξη συνιστάται στην προσθήκη μίας βάσης μεταξύ των δοθέντων κωδικονίων τότε δεδομένου ότι ο γενετικός κώδικας είναι κώδικας τριπλέτας, συνεχής και μη – επικαλυπτόμενος, θα προκληθεί αλλαγή αναγνωστικού πλαισίου (δηλαδή των τριπλετών που κωδικοποιούν αμινοξέα) από το σημείο της προσθήκης και μετά (προς το 3΄ άκρο της κωδικής αλυσίδας) με αποτέλεσμα την πλήρη τροποποίηση της ακολουθίας των αμινοξέων της παραγομενης πεπτιδικής αλυσίδας ή /και την δημιουργία πρόωρου τερματισμού της πρωτεϊνοσύνθεσης στην περίπτωση δημιουργίας πρόωρου κωδικονίου λήξεως. Επίσης, είναι δυνατή η κατάργηση του φυσιολογικού κωδικονίου λήξεως και συνέχιση της πρωτεϊνοσύνθεσης με αποτέλεσμα ένα επιμηκυμένο πεπτίδιο. Ένα τέτοιο γονιδιακό προϊόν δεν εμφανίζει πλεόν πολλές ομοιότητες με το αρχικό και είτε εμφανίζει παντελή έλλειψη λειτουργικότητας ή εμφανίζει εντελώς διαφορετική λειτουργία με το αρχικό, με απρόσμενα αποτελέσματα για την ζωή του κυττάρου.

Τόσο στην πρώτη όσο και στη δεύτερη περίπτωση μετάλλαξης, τις περισσότερες φορές καταστρέφεται η λειτουργικότητα της πρωτεΐνης.

Σχόλιο: Η αναφορά στα δεδομένα του 4ου θέματος στο τελευταίο ερώτημα, ότι η πρωτεΐνη δεν τροποποιείται, προφανώς εννοεί μετά-μεταφραστικά ώστε να απομακρυνθεί πιθανόν το διαφοροποιημένο τμήμα της, που θα έχει προκύψει λόγω της μετάλλαξης. Διαφορετικά το ερώτημα δεν θα έχει νόημα, αφού μετά τη μετάλλαξη η πρωτεΐνη δεν τροποποιείται, δηλαδή εννοεί ότι το μεταλλαγμένο γονίδιο κωδικοποιεί για την ίδια ακριβώς πρωτεΐνη όπως και το φυσιολογικό γονίδιο;

Θέματα εσπερινών Λυκείων 2009

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δ΄ ΤΑΞΗΣ
ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2009
ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ
ΒΙΟΛΟΓΙΑ
ΘΕΜΑ 1ο
Για τις ημιτελείς προτάσεις 1 έως και 5, να γράψετε στο τετράδιό σας τον αριθμό της φράσης και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της.
1. Το πλασμίδιο Ti εντοπίζεται στο βακτήριο
α. πνευμονιόκοκκος (Diplococcus pneumoniae).
β. Escherichia coli.
γ. Bacillus thuringiensis.
δ. Agrobacterium tumefaciens.
Μονάδες 5
2. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες
α. ινσουλίνης.
β. ιντερφερονών.
γ. μονοκλωνικών αντισωμάτων.
δ. α1- αντιθρυψίνης.
Μονάδες 5
3. Στον ανθρώπινο φυσιολογικό καρυότυπο απεικονίζονται
α. 23 χρωμοσώματα.
β. 22 ζεύγη χρωμοσωμάτων.
γ. 23 ζεύγη χρωμοσωμάτων.
δ. 46 ζεύγη χρωμοσωμάτων.
Μονάδες 5
4. Η επιλογή ενός βακτηριακού κλώνου που περιέχει το ανασυνδυασμένο πλασμίδιο γίνεται με:
α. χρήση ειδικών μορίων ανιχνευτών.
β. χρήση αντιβιοτικών.
γ. ένζυμα πρωτεϊνοσύνθεσης.
δ. χρήση βιοαντιδραστήρων.
Μονάδες 5
5. Το κωδικόνιο έναρξης της μετάφρασης του mRNA σε όλους τους oργανισμούς είναι το
α. AUG.
β. UUU.
γ. CAA.
δ. UAA.
ΘΕΜΑ 2ο
A. Να γράψετε στο τετράδιό σας τον αριθμό κάθε στοιχείου της Στήλης Ι και, δίπλα σε κάθε αριθμό, το γράμμα από στοιχείο της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση.
Δύο στοιχεία της Στήλης ΙΙ περισσεύουν:
Στήλη Ι Στήλη ΙΙ
1. διαβήτης α. αδελφές χρωματίδες
2. διαγονιδιακά ζώα β. ριβονουκλεοπρωτεϊνικά “σωματίδια”
3. κεντρομερίδιο γ. ινσουλίνη
4. ωρίμανση mRNA δ. μικροέγχυση
5. βιοαντιδραστήρας ε. ιντερφερόνη
ζ. ζύμωση
η. περιοριστικές ενδονουκλεάσες
Μονάδες 10
B. Ένας νέος τομέας της Βιοτεχνολογίας που αναπτύσσεται ταχύτατα είναι η γονιδιακή θεραπεία.
1. Ποιος είναι ο στόχος της γονιδιακής θεραπείας;
Μονάδες 5
2. Ποιες είναι οι προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας;
Μονάδες 6
3. Να αναφέρετε ονομαστικά τους τύπους γονιδιακής θεραπείας.
Μονάδες 4
ΘΕΜΑ 3ο
Πρόκειται να καλλιεργηθεί στο εργαστήριο ένας ετερότροφος μικροοργανισμός.
1. Να αναφέρετε ονομαστικά τα θρεπτικά συστατικά τα οποία πρέπει να προστεθούν στο μέσο καλλιέργειας, ώστε ο μικροοργανισμός αυτός να αναπτυχθεί φυσιολογικά.
Μονάδες 8
2. Πώς μπορούμε να διαπιστώσουμε αν ο μικροοργανισμός αυτός είναι υποχρεωτικά αναερόβιος;
Μονάδες 7
3. Τι γνωρίζετε για τους άλλους παράγοντες που επιδρούν στην ανάπτυξη του μικροοργανισμού;
Μονάδες 10
ΘΕΜΑ 4ο
Δίνεται το παρακάτω τμήμα DNA στο οποίο έχει αρχίσει η διαδικασία της αντιγραφής:

1. Στις θέσεις Α, Β, Γ, Δ, Ε, Ζ να αντιστοιχίσετε τις ενδείξεις 3΄ ή 5΄ ώστε να φαίνεται ο προσανατολισμός των αρχικών και των νεοσυντιθέμενων αλυσίδων.
Μονάδες 6
2. Τι είναι τα πρωταρχικά τμήματα, πώς δημιουργούνται και πώς επιμηκύνονται;
Μονάδες 9
3. Εξηγήστε γιατί πρέπει, στην παραπάνω διαδικασία να ενεργοποιηθεί το ένζυμο DNA δεσμάση και πώς θα δράσει αυτό;
Μονάδες 6
4. Ποια ένζυμα θα επιδιορθώσουν τα πιθανά λάθη της διαδικασίας της αντιγραφής;
Μονάδες 4
ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ 2009
ΘΕΜΑ 1o
Οι σωστές απαντήσεις είναι:
1. δ
2. γ
3. γ
4. β
Σημείωση: Με τη χρήση ειδικών μορίων ανιχνευτών γίνεται η επιλογή του βακτηριακού κλώνου μίας γονιδιωματικής βιβλιοθήκης που περιέχει το ανασυνδυασμένο πλασμίδιο με το επιθυμητό θραύσμα DNA. Με τον ίδιο τρόπο είναι δυνατό να γίνεται και η απομόνωση του ανασυνδυασμένου βακτηριακού κλώνου μίας cDNA βιβλιοθήκης.
5. α
ΘΕΜΑ 2o
Α. Οι σωστές απαντήσεις είναι:
1. γ
2. δ
3. α
4. β
5. ζ
Β. 1. Υπάρχουν περισσότερες από 4.000 γενετικές ασθένειες, ασθένειες δηλαδή που οφείλονται σε γονιδιακές μεταλλάξεις. Όλες σχεδόν αυτές οι ασθένειες προκαλούν δυσμορφίες, το 80% όλων διανοητική καθυστέρηση και το ένα πέμπτο από αυτές θάνατο στην παιδική ηλικία.
Έως πρόσφατα η μοριακή βάση των γενετικών ασθενειών δεν ήταν γνωστή. Η τεχνολογία του ανασυνδυασμένου DNA σε συνδυασμό με τις μεθόδους της παραδοσιακής Γενετικής (γενεαλογικά δένδρα) οδήγησε στον εντοπισμό της θέσης στα χρωμοσώματα (χαρτογράφηση) πολλών μεταλλαγμένων γονιδίων, που προκαλούν τις αντίστοιχες ασθένειες. Επιπλέον ορισμένα μεταλλαγμένα γονίδια κλωνοποιήθηκαν και συγκρίθηκαν με τα φυσιολογικά αλληλόμορφά τους, για να εξακριβωθεί το είδος των μεταλλάξεων.
Οι γνώσεις αυτές έδωσαν τη δυνατότητα ανάπτυξης μίας θεραπείας που στηρίζεται στην τεχνολογία του ανασυνδυασμένου DNA και ονομάζεται γονιδιακή θεραπεία. Αυτή έχει ως στόχο να «διορθώσει» τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου.
2. Απαραίτητη προϋπόθεση για την εφαρμογή της γονιδιακής θεραπείας είναι, εκτός από την κλωνοποίηση του υπεύθυνου γονιδίου, και ο προσδιορισμός των κυττάρων που εμφανίζουν τη βλάβη από την ασθένεια. Με τις μεθόδους της γονιδιακής θεραπείας δε γίνεται αποκατάσταση της λειτουργίας του μεταλλαγμένου γονιδίου σε όλα τα κύτταρα του
οργανισμού αλλά μόνο σε ορισμένα κύτταρα-στόχους (σωματικά κύτταρα).
3. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990. Σήμερα υπάρχουν δύο τύποι γονιδιακής θεραπείας, αυτοί είναι η ex vivo γονιδιακή θεραπεία και η in vivo γονιδιακή θεραπεία. Ο διαχωρισμός τους στηρίζεται στο αν τα κύτταρα στόχοι που υφίστανται τη γενετική αλλαγή μπορούν ή όχι αντίστοιχα, να αφαιρεθούν προσωρινά από το σώμα του ασθενούς.
ΘΕΜΑ 3o
1. Όπως και όλοι οι υπόλοιποι οργανισμοί, για να αναπτυχθεί ένας μικροοργανισμός είναι απαραίτητο να μπορεί να προμηθεύεται από το περιβάλλον στο οποίο αναπτύσσεται μια σειρά θρεπτικών συστατικών. Σε αυτά περιλαμβάνονται ο άνθρακας, το άζωτο, διάφορα μεταλλικά ιόντα και το νερό.
Για τους ετερότροφους μικροοργανισμούς η πηγή άνθρακα (C) είναι διάφορες οργανικές ενώσεις, όπως οι υδατάνθρακες.
Η πηγή αζώτου για τους περισσότερους μικροοργανισμούς είναι τα αμμωνιακά ή τα νιτρικά ιόντα (ΝΟ-3). Τέλος, τα μεταλλικά ιόντα είναι απαραίτητα για την πραγματοποίηση των χημικών αντιδράσεων στο κύτταρο και ως συστατικά διαφόρων μορίων.
2. Η παρουσία ή απουσία O2 μπορεί να βοηθήσει ή να αναστείλει την ανάπτυξη των μικροοργανισμών. Υπάρχουν μικροοργανισμοί που για την ανάπτυξή τους απαιτούν υψηλή συγκέντρωση O2 (υποχρεωτικά αερόβιοι) όπως τα βακτήρια του γένους Mycobacterium. Άλλοι μικροοργανισμοί, όπως οι μύκητες που χρησιμοποιούνται στην αρτοβιομηχανία, ανήκουν
στην κατηγορία των μικροοργανισμών που αναπτύσσονται παρουσία O2 με ταχύτερο ρυθμό απ’ότι απουσία O2 (προαιρετικά αερόβιοι). Τέλος, υπάρχουν μικροοργανισμοί όπως βακτήρια του γένους Clostridium για τους οποίους το O2 είναι τοξικό (υποχρεωτικά αναερόβιοι).
Συνεπώς μπορούμε να διαπιστώσουμε αν ο μικροοργανισμός μας είναι υποχρεωτικά αναερόβιος όταν τον καλλιεργήσουμε σε περιβάλλον παρουσία Ο2 και αδυνατεί να αναπτυχθεί ενώ όταν τον καλλιεργήσουμε σε περιβάλλον απουσία Ο2 τότε αυτός αναπτύσσεται φυσιολογικά.
3. Οι παράγοντες που επηρεάζουν το χρόνο διπλασιασμού και κατά συνέπεια το ρυθμό ανάπτυξης των μικροοργανισμών είναι η διαθεσιμότητα θρεπτικών συστατικών, το pH, το Ο2και η θερμοκρασία. Το pH επηρεάζει σημαντικά την ανάπτυξη των μικροοργανισμών. Οι περισσότεροι μικροοργανισμοί αναπτύσσονται σε pH 6-9. Υπάρχουν όμως και mικροοργανισμοί, όπως βακτήριατου γένους Lactobacillus που αναπτύσσονται σε pH 4-5.
Τέλος, η θερμοκρασία είναι ένας ακόμη σημαντικός παράγοντας που επηρεάζει την ανάπτυξη των μικροοργανισμών. Οι περισσότεροι μικροοργανισμοί αναπτύσσονται άριστα σε θερμοκρασίες 20ο- 45οC. Για παράδειγμα το βακτήριο E.coli αναπτύσσεται άριστα σε θερμοκρασία 37οC. Υπάρχουν όμως ορισμένοι μικροοργανισμοί που για την ανάπτυξή τους
απαιτούν θερμοκρασία μεγαλύτερη από 45οC, όπως αυτοί που αναπτύσσονται κοντά σε θερμοπηγές, και άλλοι που αναπτύσσονται σε θερμοκρασία μικρότερη των 20οC.
ΘΕΜΑ 4o
1.

Το DNA είναι ένα μακρομόριο (πολυνουκλεοτίδιο) που αποτελείται από νουκλεοτίδια. Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση πολλών νουκλεοτιδίων με ομοιοπολικό δεσμό. Ο δεσμός αυτός αναπτύσσεται μεταξύ του υδροξυλίου του 3΄ άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής ομάδας που είναι ενωμένη στον
5΄ άνθρακα της πεντόζης του αμέσως επόμενου νουκλεοτιδίου. Ο δεσμός ονομάζεται 3΄→ 5΄ φωσφοδιεστερικός δεσμός.
Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων μιας πολυνουκλεοτιδικής αλυσίδας, το πρώτο νουκλεοτίδιο θα έχει πάντα ελεύθερη μια φωσφορική ομάδα ενωμένη στον 5΄ άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο θα έχει ελεύθερο το υδροξύλιο του 3΄ άνθρακα της πεντόζης του. Για αυτό λέμε ότι ο προσανατολισμός μιας πολυνουκλεοτιδικής αλυσίδας είναι πάντα 5΄→3΄.
Εξαιτίας της δράσης (δημιουργία 3΄→5΄ φωσφοδιεστερικού δεσμού) των ενζύμων που πραγματοποιούν τον πολυμερισμό (DNA πολυμεράσες) κάθε νεοσυντιθέμενης αλυσίδας DNA στο αντιγραφόμενο τμήμα DNA, η αντιγραφή έχει προσανατολισμό 5΄→3΄. Κάθε νέος κλώνος DNA που συντίθεται γίνεται με προσανατολισμό 5΄→3΄, οπότε σε κάθε διπλή έλικα που προκύπτει οι δύο συμπληρωματικοί κλώνοι DNA είναι αντιπαράλληλοι.
2. Καθώς οι DNA πολυμεράσες δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. DNA πολυμεράσες επιμηκύνουν τα πρωταρχικά τμήματα, τοποθετώντας συμπληρωματικά δεοξυριβονουκλεοτίδια απέναντι από τις μητρικές αλυσίδες του DNA.
3. Επειδή, όπως ειπώθηκε, οι DNA πολυμεράσες λειτουργούν μόνο προς καθορισμένη κατεύθυνση και τοποθετούν τα νουκλεοτίδια στο ελεύθερο 3΄ άκρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου κάθε αναπτυσσόμενης αλυσίδας. Έτσι, λέμε ότι αντιγραφή γίνεται με προσανατολισμό 5΄ προς 3΄. Κάθε νεοσυντιθέμενη αλυσίδα θα έχει προσανατολισμό 5΄→3΄. Έτσι, σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες θα είναι αντιπαράλληλες. Για να ακολουθηθεί αυτός ο κανόνας σε κάθε τμήμα DNA που γίνεται η αντιγραφή, η σύνθεση του DNA είναι συνεχής στη μία αλυσίδα και ασυνεχής στην άλλη. Τα κομμάτια της ασυνεχούς αλυσίδας συνδέονται μεταξύ τους με τη βοήθεια ενός ενζύμου, που ονομάζεται DNA δεσμάση. Το ίδιο ένζυμο συνδέει και όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής σε ένα γραμμικό μόριο DNA.
4. Οι DNA πολυμεράσες, εκτός των άλλων, επιδιορθώνουν επίσης λάθη που συμβαίνουν κατά τη διάρκεια της αντιγραφής. Μπορούν δηλαδή, να “βλέπουν” και να “απομακρύνουν” νουκλεοτίδια που οι ίδιες τοποθετούν, κατά παράβαση του κανόνα της συμπληρωματικότητας, και να τοποθετούν τα σωστά. Το κύτταρο ελέγχει αν η αλληλουχία βάσεων του DNA είναι σωστή. Η αντιγραφή του DNA είναι απίστευτα ακριβής, μόνο ένα νουκλεοτίδιο στα 100.000 μπορεί να ενσωματωθεί λάθος. Τα λάθη που δεν επιδιορθώνονται από τις DNA πολυμεράσες, επιδιορθώνονται σε μεγάλο ποσοστό από ειδικά επιδιορθωτικά ένζυμα. Έτσι ο αριθμός των λαθών περιορίζεται στους ευκαρυωτικούς οργανισμούς το ένα στα 1010!

Θέματα ημερησίων λυκείων 2009

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2009
ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ
ΒΙΟΛΟΓΙΑ
ΘΕΜΑ 1ο
Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.
1. Στο οπερόνιο της λακτόζης δεν περιλαμβάνεται
α. χειριστής.
β. υποκινητής.
γ. snRNA.
δ. δομικά γονίδια.
Μονάδες 5
2. Τα νουκλεοσώματα
α. αποτελούνται αποκλειστικά από DNA.
β. δεν σχηματίζονται κατά τη μεσόφαση.
γ. αποτελούνται από DNA που τυλίγεται γύρω από πρωτεΐνες.
δ. είναι ορατά μόνο με το οπτικό μικροσκόπιο.
Μονάδες 5
3. Σε άτομα που πάσχουν από μια μορφή εμφυσήματος χορηγείται
α. παράγοντας ΙΧ.
β. αυξητική ορμόνη.
γ. ινσουλίνη.
δ. α1 – αντιθρυψίνη.
Μονάδες 5
4. ∆ιαγονιδιακά είναι φυτά
α. τα οποία έχουν υποστεί γενετική αλλαγή.
β. στα οποία έχουν εισαχθεί ορμόνες.
γ. τα οποία έχουν εμβολιαστεί με αντιγόνα in vitro.
δ. στα οποία έχουν εισαχθεί αντιβιοτικά.
Μονάδες 5
5. Μετασχηματισμός βακτηριακού κυττάρου ξενιστή είναι
α. η εισαγωγή αντισώματος.
β. η εισαγωγή DNA πλασμιδίου.
γ. η εισαγωγή θρεπτικών συστατικών.
δ. η εισαγωγή αντίστροφης μεταγραφάσης.
Μονάδες 5
ΘΕΜΑ 2ο
Να απαντήσετε στις παρακάτω ερωτήσεις:
1. Τι εννοούμε με τον όρο ζύμωση και ποια τα προϊόντα της;
Μονάδες 4
2. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου; (Μονάδες 5) Ποια είναι τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας; (Μονάδες 2)
Μονάδες 7
3. Τι είναι η μετατόπιση και τι είναι η αμοιβαία μετατόπιση; Ποια προβλήματα μπορεί να προκαλέσει η αμοιβαία μετατόπιση στον άνθρωπο;
Μονάδες 6
4. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση;
Μονάδες 8
ΘΕΜΑ 3ο
Α. Στα παρακάτω γενεαλογικά δέντρα μελετάται ο τρόπος κληρονόμησης κοινού μονογονιδιακού χαρακτηριστικού σε δύο διαφορετικές οικογένειες 1 και 2.
Γενεαλογικό δένδρο
Στην 1η οικογένεια φέρουν το χαρακτηριστικό τα άτομα Ι2, ΙΙ2, ΙΙ3 (μαυρισμένα) ενώ στην 2η οικογένεια φέρουν το χαρακτηριστικό τα άτομα ΙΙ2, ΙΙ3 (μαυρισμένα). Να προσδιορίσετε τον τρόπο κληρονόμησης του χαρακτηριστικού με βάση τα παραπάνω στοιχεία, αιτιολογώντας την απάντησή σας με τις κατάλληλες διασταυρώσεις (να μη ληφθεί υπόψη η περίπτωση μετάλλαξης και να μην εξεταστεί η περίπτωση του φυλοσύνδετου επικρατούς γονιδίου). (Μονάδες 8) Να γράψετε τους γονότυπους όλων των ατόμων. (Μονάδες 5)
Μονάδες 13
Β. Να υποδείξετε ένα πιθανό μηχανισμό που μπορεί να εξηγήσει τη γέννηση ατόμου με σύνδρομο Τurner από γονείς με φυσιολογικό αριθμό χρωμοσωμάτων. (Μονάδες 6) Να περιγράψετε τη διαδικασία με την οποία μπορούμε να απεικονίσουμε τα χρωμοσώματα του ατόμου με σύνδρομο Turner, μετά τη γέννησή του. (Μονάδες 6)
Μονάδες 12
ΘΕΜΑ 4ο
∆ίνεται δίκλωνο μόριο DNA, το οποίο περιέχει τμήμα ασυνεχούς γονιδίου που μεταγράφεται σε mRNA.
Αλληλουχία γονιδίων
α. Πού συναντάμε ασυνεχή γονίδια; (μονάδες 2)
β. Να προσδιορίσετε τα 3΄ και 5΄ άκρα του παραπάνω μορίου DNA. (Μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (Μονάδες 4)
γ. Να γράψετε το τμήμα του πρόδρομου mRNA και του ώριμου mRNA που προκύπτουν από τη μεταγραφή του παραπάνω μορίου DNA, χωρίς αιτιολόγηση. (Μονάδες 2)
δ. Πώς προκύπτει το ώριμο mRNA; (Μονάδες 3)
ε. Μπορεί η περιοριστική ενδονουκλεάση ΕcoRI να κόψει το παραπάνω τμήμα DNA; (Μονάδα 1) Να αιτιολογήσετε την απάντησή σας. (Μονάδες 3)
στ. Ποιες κατηγορίες γονιδίων που υπάρχουν στο χρωμοσωμικό DNA ενός κυτταρικού τύπου δεν κλωνοποιούνται σε cDNA βιβλιοθήκη; (μονάδες 8)
Μονάδες 25
ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2009
ΘΕΜΑ 1o
Οι σωστές απαντήσεις είναι:
1. γ
2. γ
3. δ
4. α
5. β
ΘΕΜΑ 2o
1. Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες. Ο όρος ζύμωση παλιότερα χρησιμοποιείτο μόνο για αναερόβιες διεργασίες αλλά σήμερα χρησιμοποιείται με την ευρεία έννοια και περιλαμβάνει όλες τις διεργασίες αερόβιες και αναερόβιες.
Τα προϊόντα της ζύμωσης είναι είτε τα ίδια τα κύτταρα που ονομάζονται βιομάζα είτε προϊόντα των κυττάρων όπως πρωτεΐνες και αντιβιοτικά.
2. Το ιδανικό φάρμακο σύμφωνα με το Γερμανό γιατρό Ehrlich είναι αυτό που μπορεί να καταπολεμά αποτελεσματικά τις μολύνσεις, χωρίς να προκαλεί παρενέργειες στον οργανισμό. Η φύση έχει δημιουργήσει το ιδανικό φάρμακο, τα αντισώματα. Τα αντισώματα είναι πρωτεΐνες που παράγονται φυσιολογικά από τα Β-λεμφοκύτταρα του οργανισμού μας και ρόλος τους είναι να εντοπίζουν και να καταστρέφουν αντιγόνα που εισέρχονται στον οργανισμό. Στην πραγματικότητα τα αντισώματα αναγνωρίζουν περιοχές των αντιγόνων που ονομάζονται αντιγονικοί καθοριστές. Ένα μεγάλο αντιγόνο μπορεί να έχει παραπάνω από έναν αντιγονικό καθοριστή, οπότε και να παράγονται γι’ αυτό περισσότερα του ενός είδους αντισωμάτων. Κάθε είδος αντισωμάτων παράγεται από μια ομάδα όμοιων Β-λεμφοκυττάρων, που αποτελούν ένα κλώνο. Τα αντισώματα που παράγονται από ένα κλώνο όμοιων Β-λεμφοκυττάρων, ονομάζονται μονοκλωνικά αντισώματα.
Τα αντισώματα είναι ιδιαίτερα σημαντικά για την ιατρική καθώς χρησιμοποιούνται ως ανοσοδιαγνωστικά για την ανίχνευση ασθενειών αλλά και ως εξειδικευμένα φάρμακα εναντίον παθογόνων μικροοργανισμών. Ιδιαίτερα σημαντική είναι η χρήση τους ως θεραπευτικά για τη θεραπεία του καρκίνου.
Τα καρκινικά κύτταρα έχουν στην εξωτερική επιφάνειά τους μεγάλη ποικιλία αντιγόνων που δεν υπάρχουν στα φυσιολογικά κύτταρα του οργανισμού, και ονομάζονται καρκινικά αντιγόνα. Έτσι μπορούν να κατασκευαστούν μονοκλωνικά αντισώματα εναντίον αυτών των αντιγόνων. Τα μονοκλωνικά αντισώματα είναι πολύ ειδικά μόνο για τα καρκινικά κύτταρα και μπορούν να «γίνουν μεταφορείς» ισχυρών αντικαρκινικών φαρμάκων. Όταν εισαχθούν στον οργανισμό, βρίσκουν και προσβάλλουν τους καρκινικούς στόχους. Τα αντικαρκινικά φάρμακα, που είναι συνδεδεμένα με τα αντισώματα, δρουν κατευθείαν στα καρκινικά κύτταρα και τα καταστρέφουν. Επιτρέπουν έτσι τη θεραπεία με αποφυγή της χειρουργικής επέμβασης και των δυσάρεστων συνεπειών της χημειοθεραπείας.
3. Οι μεταλλάξεις είναι αλλαγές στην ακολουθία και στον αριθμό των νουκλεοτιδικών βάσεων στο γονιδίωμα ενός οργανισμού. Οι μεγάλες σε έκταση αλλαγές αποτελούν τις χρωμοσωμικές ανωμαλίες. Οι αλλαγές στον αριθμό των χρωμοσωμάτων ονομάζονται αριθμητικές χρωμοσωμικές ανωμαλίες, ενώ οι αλλαγές στη δομή αποτελούν τις δομικές χρωμοσωμικές ανωμαλίες. Οι αλλαγές αυτές έχουν συνήθως ως αποτέλεσμα την τροποποίηση του φαινοτύπου του ατόμου. Η ανάλυση των χρωμοσωμικών ανωμαλιών έγινε δυνατή μετά την ανάπτυξη τεχνικών που επιτρέπουν την παρατήρηση και τη λεπτομερή μελέτη των χρωμοσωμάτων.
Οι δομικές χρωμοσωμικές ανωμαλίες είναι αλλαγές στη δομή ενός ή περισσότερων χρωμοσωμάτων. Οι δομικές αλλαγές στο χρωμόσωμα μπορεί να αφορούν μερικά γονίδια ή ένα μεγάλο τμήμα του χρωμοσώματος. Η δημιουργία δομικών χρωμοσωμικών ανωμαλιών μπορεί να είναι αποτέλεσμα διαφόρων μηχανισμών κατά τη διάρκεια του κυτταρικού κύκλου. Για παράδειγμα, η θράυση τμήματος από ένα ή περισσότερα χρωμοσώματα και, στη συνέχεια, η λανθασμένη επανένωσή του μπορεί να έχει ως αποτέλεσμα έλλειψη, μετατόπιση ή κάποια άλλη αναδιάταξη των γονιδίων στο χρωμόσωμα. Οι δομικές χρωμοσωμικές ανωμαλίες είναι επίσης αποτέλεσμα της δράσης μεταλλαξογόνων παραγόντων όπως οι ακτινοβολίες και οι διάφορες χημικές ουσίες.
Οι δομικές χρωμοσωμικές ανωμαλίες έχουν, όπως ειπώθηκε, ως αποτέλεσμα την αλλαγή στην ποσότητα ή στη διάταξη της γενετικής πληροφορίας στα χρωμοσώματα. Ανάλογα με τον τύπο της αλλαγής διακρίνονται διάφορα είδη δομικών χρωμοσωμικών ανωμαλιών (αναστροφή, έλλειψη, διπλασιασμός, μετατόπιση, αμοιβαία μετατόπιση).
Συγκεκριμένα, η μετατόπιση είναι αποτέλεσμα θραύσης ενός τμήματος του χρωμοσώματος και στη συνέχεια ένωσής του σε ένα άλλο μη ομόλογο χρωμόσωμα. Στις αμοιβαίες μετατοπίσεις έχουμε «ανταλλαγή» χρωμοσωμικών τμημάτων ανάμεσα σε μη ομόλογα χρωμοσώματα. Στις αμοιβαίες μετατοπίσεις δε χάνεται γενετικό υλικό και τα άτομα που τις φέρουν εμφανίουν συνήθως φυσιολογικό φαινότυπο. Ταυτόχρονα όμως εμφανίζουν κίνδυνο απόκτησης απογόνων με χρωμοσωμικές ανωμαλίες, επειδή κατά το ζευγάρωμα των χρωμοσωμάτων στη μειωτική διαίρεση προκύπτουν και μη-φυσιολογικοί γαμέτες.
4. Η γενετική καθοδήγηση είναι μία διαδικασία κατά την οποία ειδικοί επιστήμονες δίνουν πληροφορίες σε μεμονωμένα άτομα, ζευγάρια και οικογένειες που πάσχουν από κάποια γενετική ασθένεια ή έχουν αυξημένες πιθανότητες να την εμφανίσουν. Οι πληροφορίες αυτές είναι απαραίτητες για τους ενδιαφερόμενους, γιατί τους βοηθούν στη λήψη αποφάσεων, κυρίως σχετικά με την απόκτηση υγιών απογόνων.
Παρ’ ότι η γενετική καθοδήγηση μπορεί να ζητήσουν όλοι οι υποψήφιοι γονείς, υπάρχουν ομάδες ατόμων οι οποίες είναι απαραίτητο να απευθυνθούν σε ειδικούς πριν προχωρήσουν στην απόκτηση απογόνων. Σ’ αυτές περιλαμβάνονται:
• Άτομα-φορείς γενετικών ασθενειών.
• Άτομα με οικογενειακό ιστορικό γενετικών ασθενειών.
• Γυναίκες ηλικίας 35 ετών και άνω.
• Γυναίκες με πολλαπλές αποβολές.
ΘΕΜΑ 3o
Α. Στα δοθέντα γενεαλογικά δένδρα μελετάται ο τρόπος κληρονόμησης κοινού μονογονιδιακού χαρακτηριστικού σε δύο διαφορετικές οικογένειες, συνεπώς πρόκειται για μονοϋβριδισμό.
Γνωρίζοντας τους φαινότυπους των ατόμων των δύο οικογενειών, θα βρούμε τον τρόπο κληρονόμησης του χαρακτηριστικού που μελετάται.
Εξετάζουμε περιπτώσεις:
α. Αν το γονίδιο που ελέγχει το υπό μελέτη χαρακτηριστικό είναι φυλοσύνδετο και υπολειπόμενο, τότε: Έστω ο γενετικός τόπος του φυλετικού χρωμοσώματος Χ – για τον οποίο δεν υπάρχει αντίστοιχος στο Υ φυλετικό χρωμόσωμα – στον οποίο εδράζεται το γονίδιο Α που ελέγχει τον υπό μελέτη χαρακτήρα.
Το γονίδιο Α διαθέτει δύο αλληλόμορφα τα Α και α. Το αλληλόμορφο Α είναι το επικρατές ενώ το αλληλόμορφο α είναι το υπολειπόμενο και η παρουσία του σε ένα αρσενικό άτομο συνεπάγεται και τη φαινοτυπική παρουσία του χαρακτηριστικού. Η παρουσία του αλληλόμορφου α σε ομόζυγη κατάσταση στο θηλυκό άτομο επίσης συνεπάγεται τη φαινοτυπική έκφραση του χαρκτηριστικού που μελετάμε. Αντίθετα, αρσενικά άτομα με γονότυπο ΧΑΥ και θηλυκά άτομα με γονότυπο ΧΑΧΑ ή ΧΑΧα δεν εμφανίζουν το χαρακτηριστικό.
Από τα γενεαλογικά δένδρα που δίνονται, το χαρακτηριστικό αποκλείεται να κληρονομείται με φυλοσύνδετο υπολειπόμενο πρότυπο κληρονομικότητας, διότι είναι αδύνατο από τη διασταύρωση Ι1 (ΧΑΥ) x Ι2 (ΧαΧα) του πρώτου γενεαλογικού δένδρου να προκύψει ο απόγονος Ι3 (ΧαΧα) καθώς κάθε απόγονος κληρονομεί ένα πλήρες απλοειδές γονιδίωμα από κάθε γονέα του. Συνεπώς, το άτομο ΙΙ3 θα έπερεπε να μη φέρει το χαρακτηριστικό, διότι θα κληρονομούσε υποχρεωτικά το φυλετικό χρωμόσωμα ΧΑ του πατέρα του εφόσον το ατομο ΙΙ3 είναι θηλυκό άτομο.
β. Αν το γονίδιο που ελέγχει το χαρακτηριστικό που μελετάμε είναι αυτοσωμικό τότε:
i) Αν είναι επικρατές, θα έχουμε: Έστω ο γενετικός τόπος ενός ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων στον οποίο εδράζεται το γονίδιο Α που ελέγχει τον υπό μελέτη χαρακτήρα. Το γονίδιο Α διαθέτει δύο αλληλόμορφα τα Α και α, με σχέση επικράτειας μεταξύ τους το Α επικρατές του α. Άτομα με γονότυπο ΑΑ ή Αα εμφανίζουν το χαρακτηριστικό ενώ άτομα με γονότυπο αα δεν το εμφανίζουν.
Από τα δοθέντα γενεαλογικά δένδρα το χαρακτηριστικό αποκλείεται να κληρονομείται ως αυτοσωμικό επικρατές, διότι από τη διασταύρωση Ι1 (αα) x Ι2 (αα) του δεύτερου γενεαλογικού δένδρου είναι αδύνατο να προκύψουν οι απόγονοι ΙΙ2 (Αα ή ΑΑ) και ΙΙ3 (Αα ή ΑΑ).
Συνεπώς το χαρακτηριστικό δεν κληρονομείται ως αυτοσωμικό επικρατές.
ii) Αν είναι υπολειπόμενο, θα έχουμε: Έστω ο γενετικός τόπος ενός ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων στον οποίο εδράζεται το γονίδιο Α που ελέγχει τον υπό μελέτη χαρακτήρα. Το αλληλόμορφο Α του γονιδίου Α είναι επικρατές και η παρουσία του στο γονότυπο ενός ατόμου αποκλείει την εμφάνιση του χαρακτηριστικού. Το αλληλόμορφο α του γονιδίου Α είναι το υπολειπόμενο και η παρουσία του σε ομόζυγη κατάσταση στο γονότυπο ενός ατόμου συνεπάγεται τη φαινοτυπική έκφραση του χαρακτηριστικού. Δηλαδή άτομα με γονότυπο ΑΑ ή Αα δεν εμφανίζουν το χαρακτηριστικό ενώ άτομα με γονότυπο αα εμφανίζουν το χαρακτηριστικό.
Από τα δοθέντα γενεαλογικά δένδρα προκύπτει ότι το χαρακτηριστικό ακολουθεί αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας καθώς αυτός ο τύπος κληρονομικότητας επιβεβαιώνεται από όλες τις διασταυρώσεις των δύο γενεαλογικών δένδρων.
Συνεπώς το υπό εξέταση χαρακτηριστικό ακολουθεί αυτοσωμικό υπολειπόμενο τρόπο κληρονόμησης.
Από τα γενεαλογικά δένδρα που δίνονται έχουμε τους γονότυπους των ατόμων των δύο οικογενειών.
Γενεαλογικό δένδρο 1 (οικογένεια 1):
Ι1: Αα, καθώς δε φέρει το χαρακτηριστικό, αλλά αποκτά απογόνους που το φέρουν.
Ι2: αα, φέρει το χαρακτηριστικό.
ΙΙ1: Αα, το αλληλομορφο Α από τον πατέρα του (Ι1) και το αλληλομορφο α από τη μητέρα του (Ι2).
ΙΙ2: αα, φέρει το χαρακτηριστικό.
ΙΙ3: αα, φέρει το χαρακτηριστικό.
Γενεαλογικό δένδρο 2 (οικογένεια 2):
Ι1: Αα, δε φέρει το χαρακτηριστικό, αλλά αποκτά απογόνους που το φέρουν.
Ι2: Αα, ομοίως με Ι1.
ΙΙ1: ΑΑ (με πιθανότητα __ 13) ή Αα (με πιθανότητα _2_3), εφόσον δε φέρει το χαρακτηριστικό και έχει ετερόζυγους γονείς.
ΙΙ2: αα, φέρει το χαρακτηριστικό.
ΙΙ3: αα, φέρει το χαρακτηριστικό.
Οι παραπάνω γονότυποι προκύπτουν εύκολα από τα παρακάτω αβάκια του Punnett. Σε κάθε αβάκιο απεικονίζονται διαγραμματικά οι γαμέτες της κάθε διασταύρωσης και ο τρόπος συνδυασμού τους.
Ρ1: ♂ Αα (Ι1) x ♀ αα (Ι2)
Γαμέτες: Α, α / α, α
♂ / ♀ α α
Α Αα (ΙΙ1) Αα (ΙΙ1)
α αα (ΙΙ2) αα (ΙΙ3)
F1: Αα : αα γονοτυπική αναλογία
[Α] : [α] φαινοτυπική αναλογία
Αν το άτομο Ι1 είχε γονότυπο ΑΑ τότε όλοι οι απόγονοί του με το άτομο Ι2 θα είχαν γονότυπο Αα και δεν θα έφεραν το χαρακτηριστικό αυτό φαινοτυπικά.
Ρ2: ♂ Αα (Ι1) x ♀ Αα (Ι2)
Γαμέτες: Α, α / Α, α
♂ / ♀ Α α
Α ΑΑ (ΙΙ1) Αα (ΙΙ1)
α Αα (ΙΙ1) αα (ΙΙ2, ΙΙ3)
F1: ΑΑ : 2 Αα : αα γονοτυπική αναλογία
3[Α] : [α] φαινοτυπική αναλογία
Εφόσον το άτομο ΙΙ1 δεν φέρει το χαρακτηριστικό, θα έχει γονότυπο είτε ΑΑ είτε Αα, Με βάση το αβάκιο του Punnett που δίνεται παραπάνω, η πιθανότητα να έχει τον πρώτο από τους πιθανούς γονότυπους είναι __ 13, ενώ για τον δεύτερο πιθανό γονότυπο, η πιθανότητα είναι __ 23.
Εάν ένας τουλάχιστον από του γονείς της Ρ2 διασταύρωσης είχε γονότυπο ΑΑ, τότε θα ήταν αδύνατο να προκύψουν οι απόγονοι ΙΙ2 και ΙΙ3 με γονότυπο αα, ώστε να εμφανίζουν το χαρακτηριστικό.
Β. Οι μεταλλάξεις που αφορούν μεγάλες σε έκταση αλλαγές στην ακολουθία και στον αριθμό των βάσεων στο γονιδίωμα ενός οργανισμού αποτελούν τις χρωμοσωμικές ανωμαλίες. Οι αλλαγές στον αριθμό των χρωμοσωμάτων ονομάζονται αριθμητικές χρωμοσωμικές ανωμαλίες και έχουν ως αποτέλεσμα την τροποποίηση του φαινότυπου του ατόμου, εφόσον επιζήσει. Τα άτομα που έχουν περίσσεια ή ελλειψη μικρού αριθμού χρωμοσωμάτων ονομάζονται ανευπλοειδή. Η απουσία ενός μόνο χρωμοσώματος – αυτοσωμικού ή φυλετικού – ονομάζεται μονοσωμία.
Εφόσον οι γονείς έχουν φυσιολογικό αριθμό και μέγεθος χρωμοσωμάτων θα διαθέτουν, η μεν γυναίκα 22 αυτοσωμικά (Α) και 2 φυλετικά (Χ), ο δε άνδρας 22 αυτοσωμικά (Α) και ένα ζεύγος φυλετικών Χ, Υ χρωμοσωμάτων.
Τα ανευπλοειδή άτομα με έλλειψη μικρού αριθμού χρωμοσωμάτων, όπως αυτά με σύνδρομο Turner (ΧΟ) φέρουν 22 αυτοσωμικά και ένα φυλετικό Χ χρωμόσωμα προκύπτουν συνήθως λόγω του μη φυσιολογικού διαχωρισμού χρωμοσωμάτων κατά τη μείωση και είναι η μοναδική περίπτωση μονοσωμίας που επιζεί στον άνθρωπο.
Ειδικότερα ενας πιθανός μηχανισμός που μπορει να εξηγήσει τη γέννηση ενός παιδιού με μονοσωμία ως προς το φυλετικό χρωμόσωμα (44Α + ΧΟ), αφορα τη μείωση σε κάποιον από τους δύο γονείς και είναι για παράδειγμα:
Να μην αποχωριστούν τα φυλετικά χρωμοσώματα κατά τη μείωση Ι στη γυναίκα. Επομένως στο ένα θυγατρικό κύτταρο της μείωσης Ι θα υπάρχει φυσιολογικός αριθμός αυτοσωμικών χρωμοσωμάτων και τα δύο Χ φυλετικά χρωμοσώματα, ενώ στο άλλο θυγατρικό κύτταρο θα υπάρχει φυσιολογικός αριθμός αυτοσωμικών χρωμοσωμάτων και κανένα φυλετικό Χ χρωμόσωμα. Έτσι μετά το τέλος της μείωσης προκύπτουν γαμέτες που περιέχουν 22 αυτοσωμικά και δύο Χ φυλετικά χρωμοσώματα και γαμέτες που δεν περιέχουν κανένα Χ φυλετικό χρωμόσωμα αλλά έχουν 22 αυτοσωμικά χρωμοσώματα.
Αν ο γαμέτης που δεν έχει κανένα φυλετικό χρωμόσωμα γονιμοποιηθεί από ένα φυσιολογικό σπερματοζωάριο που έχει το Χ φυλετικό χρωμόσωμα, προκύπτει ζυγωτό 44Α + ΧΟ, δηλαδή άτομο με σύνδρομο Turner.
Λάθος μειωτική διαίρεση για το σχηματισμό Turner
Σημείωση: Τέκνο με σύνδρομο Turner (μονοσωμία στα φυλετικά χρωμοσώματα του ανθρώπου) μπορεί να προκύψει από φυσιολογικούς γονείς και με άλλους πιθανούς τρόπους [Βλέπε απαντήσεις 2004, θέμα 3ο(1)].
Τα άτομα με σύνδρομο Turner εμφανίζουν συγκεκριμένο και χαρακτηριστικό φαινότυπο (είναι θηλικού γένους αλλά δεν εμφανίζουν τα δευτερογενή χαρακτηριστικά του φύλου και είναι στείρα), οπότε και η διάγνωση του συνδρόμου είναι εύκολη από τα εξωτερικά φαινοτυπικά χαρακτηριστικά του ατόμου. Στην περίπτωση όμως, που θέλουμε να μελετήσουμε τα χρωμοσώματα ενός ατόμου με αυτό το σύνδρομο μετά τη γέννησή του, είναι απαραίτητη η καρυοτυπική απεικόνισή τους και η παρατηρησή τους στο μικροσκόπιο.
Η μελέτη των χρωμοσωμάτων είναι δυνατή μόνο σε κύτταρα τα οποία διαιρούνται. Τα κύτταρα αυτά μπορεί να προέρχονται είτε από ιστούς που διαιρούνται φυσιολογικά είτε από κυτταροκαλλιέργειες, όπου γίνεται in vitro επαγωγή της διαίρεσης με ουσίες που έχουν μιτογόνο δράση. Τα κύτταρα που θα χρησιμοποιηθούν πρέπει να μπορούν να αφαιρεθούν εύκολα και ανώδυνα από το σώμα του ατόμου. Τέτοια κύτταρα είναι τα λευκά αιμοσφαίρια του αίματος. Το αίμα αφαιρείται από το σώμα του ατόμου με απλή αιμοληψία και τα λευκά αιμοσφαίρια, σε αντίθεση με τα ερυθρά αιμοσφαίρια, είναι εμπύρηνα και διαιρούνται. Τα χρωμοσώματα μελετώνται στο στάδιο της μετάφασης, όπου εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και είναι ευδιάκριτα ως μεμονομένες δομές στο οπτικό μικροσκόπιο. Επειδή σε ένα πληθυσμό διαιρούμενων κυττάρων το ποσοστό αυτών που βρίσκονται στη μετάφαση είναι μικρό, χρησιμοποιούνται ουσίες, οι οποίες σταματούν την κυτταρική διαίρεση στη φάση αυτή. Στη συνέχεια, τα κύτταρα επωάζονται σε υποτονικό διάλυμα, ώστε να σπάσει η κυτταρική τους μεμβράνη και τα χρωμοσώματά τους απλώνονται σε αντικειμενοφόρο πλάκα. Τέλος, χρωματίζονται με ειδικές χρωστικές ουσίες και παρατηρούνται στο μικροσκόπιο.
Τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος. Η απεικόνιση αυτή αποτελεί τον καρυότυπο. Κατά την παρατήρηση του καρυότυπου, η παρουσία 45 χρωμοσωμάτων, 44 αυτοσωμικών και ενός φυλετικού Χ χρωμοσώματος μας οδηγεί στο συμπέρασμα ότι πρόκειται για άτομο με το σύνδρομο Turner.
ΘΕΜΑ 4o
α. Στους ευκαρυωτικούς οργανισμούς, σε αντίθεση με τους προκαρυωτικούς, το mRNA που παράγεται κατά τη μεταγραφή ενός γονιδίου συνήθως δεν είναι έτοιμο να μεταφραστεί αλλά υφίσταται μια πολύπλοκη διαδικασία ωρίμανσης. Η ανακάλυψη αυτής της διαδικασίας οδήγησε στο συμπέρασμα ότι τα περισσότερα γονίδια των ευκαρυωτικών οργανισμών (και των ιών που τους προσβάλλουν) είναι ασυνεχή ή διακεκομμένα. Δηλαδή, η αλληλουχία που μεταφράζεται σε αμινοξέα διακόπτεται από ενδιάμεσες αλληλουχίες, οι οποίες δε μεταφράζονται σε αμινοξέα. Οι αλληλουχίες που μεταφράζονται σε αμινοξέα ονομάζονται εξώνια και οι ενδιάμεσες αλληλουχίες ονομάζονται εσώνια.
β. Το DNA των οργανισμών είναι δίκλωνο μόριο, κάθε κλώνος του είναι μια πολυνουκλεοτιδική αλυσίδα και οι δύο αλυσίδες που το συνιστούν έχουν αντιπαράλληλο προσανατολισμό. Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση πολλών νουκλεοτιδίων με 3΄→ 5΄ φωσφοδιεστερικό δεσμό, που είναι ένας ομοιοπολικός δεσμός. Ο δεσμός αυτός δημιουργείται μεταξύ του υδροξυλίου του 3΄ άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής ομάδας που βρίσκεται συνδεδεμένη στον 5΄ άνθρακα της πεντόζης του επόμενου νουκλεοτιδίου. Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων από τα οποία αποτελείται η πολυνουκλεοτιδική αλυσίδα, το πρώτο της νουκλεοτίδιο έχει πάντα μια ελεύθερη φωσφορική ομάδα συνδεδεμένη στον 5΄ άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο έχει ελεύθερο το υδροξύλιο του 3΄ άνθρακα της πεντόζης του. Γι’ αυτό ο προσανατολισμός της πολυνουκλεοτιδικής αλυσίδας είναι 5΄→3΄.
Στο τμήμα του μορίου DNA που δίνεται προσδιορίζεται ότι το δεξί άκρο της επάνω αλυσίδας του φέρει ελεύθερο υδροξύλιο, συνεπώς αυτό αποτελεί το 3΄ άκρο του, κατά συνέπεια τα 3΄ και 5΄ άκρα του δοσμένου μορίου DNA φαίνονται παρακάτω:
5 ΄… GA AGGAGGTTGCTTA AGGGGCCCTACCA AT …3 ΄
3 ΄ … CTTCCTCCA ACGA ATTCCCCGGGATGGTTA …5 ΄
γ. Πρόδρομο mRNA: 5΄ … GAAGGAGGUUGCUUAAGGGGCCCUACCAAU … 3΄
Ώριμο mRNA: 5΄ … GAAGGAGGUUGCUUAACUACCAAU … 3΄
δ. Όταν ένα γονίδιο που περιέχει εσώνια μεταγράφεται, δημιουργείται το πρόδρομο mRNA που περιέχει και εξώνια και εσώνια. Το πρόδρομο mRNA μετετρέπεται σε ώριμο mRNA με τη διαδικασία της ωρίμανσης, κατά την οποία τα εσώνια κόβονται από μικρά ριβονουκλεοπρωτεϊνικά «σωματίδια» και απομακρύνονται. Τα ριβονουκλεοπρωτεϊνικά σωματίδια αποτελούνται από snRNA και από πρωτεΐνες και λειτουργούν ως ένζυμα: κόβουν τα εσώνια και συρράπτουν τα εξώνια μεταξύ τους. Έτσι σχηματίζεται το «ώριμο» mRNA. Αυτό, παρ’ ότι αποτελείται αποκλειστικά από εξώνια, έχει δύο περιοχές που δε μεταφράζονται σε αμινοξέα. Η μία βρίσκεται στο 5΄ άκρο και η άλλη στο 3΄ άκρο. Οι αλληλουχίες αυτές ονομάζονται 5΄ και 3΄ αμετάφραστες περιοχές, αντίστοιχα. Το mRNA μεταφέρεται από τον πυρήνα στο κυτταρόπλασμα και ειδικότερα στα ριβοσώματα όπου είναι η θέση της πρωτεϊνοσύνθεσης.
ε. Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν ειδικές αλληλουχίες δίκλωνου DNA, μήκους 4-8 νουκλεοτιδίων. Τα ένζυμα αυτά κόβουν το δίκλωνο DNA σε ειδικές θέσεις αφήνοντας μονόκλωνα άκρα από αζευγάρωτες βάσεις στα κομμένα άκρα.
Στο δοσμένο τμήμα DNA δεν υπάρχει η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης EcoRI με κατεύθυνση 5΄→3΄, συνεπώς το συγκεκριμένο περιοριστικό ένζυμο δεν μπορεί να κόψει το δοθέν τμήμα DNA.
Η αλληλουχία αναγνώρισης της EcoRI είναι η:
5΄…G A A T T C…3΄
3΄…C T T A A G…5΄
στ. Η γενετική πληροφορία υπάρχει σε τμήματα του DNA με συγκεκριμένη ακολουθία, τα γονίδια. Αυτά, διαμέσου της μεταγραφής και της μετάφρασης καθορίζουν τη σειρά των αμινοξέων στην πρωτεΐνη. Τα γονίδια διακρίνονται σε δύο κατηγορίες:
– Στα γονίδια που μεταγράφονται σε mRNA και μεταφράζονται στη συνέχεια σε πρωτεΐνες και
– Στα γονίδια που μεταγράφονται και παράγουν tRNA, rRNA και snRNA (μόνο στα ευκαρυωτικά κύτταρα).
Δηλαδη υπάρχουν τέσσερα είδη μορίων RNA που παράγονται με τη μεταγραφή ευκαρυωτικών γονιδίων: το αγγελιοφόρο RNA (mRNA), το μεταφορικό RNA (tRNA), το ριβοσωμικό RNA (rRNA) και το μικρό πυρηνικό RNA (snRNA).
Όλα τα κύτταρα ενός πολυκύτταρου οργανισμού έχουν το ίδιο DNA. Μολονότι όλα τα κύτταρα έχουν τις ίδιες γενετικές οδηγίες, έχουν αναπτύξει μηχανισμούς που τους επιτρέπουν να εκφραζουν τη γενετική τους πληροφορία επιλεκτικά και να ακολουθούν μόνο τις οδηγίες που χρειάζονται κάθε χρονική στιγμή. Τα κύτταρα λοιπόν ενός πολύπλοκου πολυκύτταρου οργανισμού, όπως τα νευρικά, τα μυϊκά, τα ηπατικά, διαφέρουν στη μορφή και στη λειτουργία τους, αλλά έχουν όλα το ίδιο γενετικό υλικό, άρα και τα ίδια γονίδια. Στους ανώτερους ευκαρυωτικούς οργανισμούς πολλά γονίδια εκφράζονται μόνο σε συγκεκριμένους τύπους κυττάρων, όπως τα γονίδια των αλυσίδων των αιμοσφαιρινών που εκφράζονται μόνο στα πρόδρομα ερυθρά αιμοσφαίρια.
Αν θέλουμε να κλωνοποιήσουμε μόνο τα γονίδια που εκφράζονται σε συγκεκριμένα κύτταρα, τότε κατασκευάζουμε cDNA-βιβλιοθήκες. Οι cDNA βιβλιοθήκες περιέχουν αντίγραφα των mRNA όλων των γονιδίων που εκφράζονται στα κύτταρα αυτά μια συγκεκριμένη χρονική στιγμή και επιπλέον έχουν το πλεονέκτημα απομόνωσης μόνο των αλληλουχιών των γονιδίων που μεταφράζονται σε αμινοξέα, δηλαδή των εξωνίων.
Για να κατασκευάσουμε μια cDNA βιβλιοθήκη, αρχικά απομονώνουμε το συνολικό ώριμο mRNA από τα κύτταρα του ιστού στον οποίο εκφράζεται το γονίδιο που μας ενδιαφέρει. Το mRNA χρησιμοποιείται σαν καλούπι για τη σύνθεση μιας συμπληρωματικής αλυσίδας DNA (cDNA: complementary DNA). Με κατάλληλες τεχνικές το αποτέλεσμα είναι η δημιουργία δίκλωνων μορίων DNA που εισάγονται σε πλασμίδια ή βακτηριοφάγους και κλωνοποιούνται.
Συνεπώς δεν κλωνοποιούνται σε cDNA βιβλιοθήκη οι παρακάτω κατηγορίες των γονιδίων που υπάρχουν στο χρωμοσωμικό DNA ενός κυτταρικού τύπου ενός πολυκύτταρου ευκαρυωτικού οργανισμού:
• Τα γονίδια που κωδικοποιούν για rRNA, snRNA, tRNA.
• Τα γονίδια που κωδικοποιούν για κάποια πολυπεπτιδική αλυσίδα, αλλά σε αυτόν τον κυτταρικό τύπο δε συντίθεται αυτή η πολυπεπτιδική αλυσίδα.
• Τα γονίδια που κωδικοποιούν για κάποια πολυπεπτιδική αλυσίδα που είναι απαραίτητη στο συγκεκριμένο κυτταρικό τύπο, αλλά τη δεδομένη χρονική στιγμή που πραγματοποιείται η διαδικασία κατασκευής cDNA βιβλιοθήκης του συγκεκριμένου κυτταρικού τύπου, το γονίδιο που κωδικοποιεί αυτή η πολυπεπτιδική αλυσίδα δεν εκφράζεται, είτε γιατί το κύτταρο διαθέτει επαρκή ποσότητα από αυτή την πολυπεπτιδική αλυσίδα είτε γιατί δε συντρέχουν οι απαραίτητες προΰποθέσεις (κατάλληλο ερέθισμα, περιβάλλον) για την έκφραση του συγκεκριμένου γονιδίου.