Αρχείο κατηγορίας Θέματα Πανελληνίων

Λυμένα θέματα πανελληνίων εξετάσεων παρελθόντων ετών

Λύσεις Βιολογίας θετικού προσανατολισμού Πανελληνίων εξετάσεων 2017 – Ημερήσια

Βιολογία Ομάδας Θετικού Προσανατολισμού

ΘΕΜΑΤΑ 2017 ΗΜΕΡΗΣΙΑ ΓΕΛ:  Οι Απαντήσεις

ΘΕΜΑ Α

Οι ζητούμενες απαντήσεις, είναι :

A1: δ , Α2 : δ , Α3 : β , Α4 : γ , Α5 : α

ΘΕΜΑ Β

B1

Ι → Α

Ι Ι → Ε

ΙΙΙ → ΣΤ

ΙVB

VZ

VI →Γ

VII → Δ

Β2

Η δοθείσα εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο.

Αιτιολόγηση : Γνωρίζουμε ότι στα προκαρυωτικά κύτταρα οι διαδικασίες της μεταγραφής ενός γονιδίου που κωδικοποιεί για μόριο mRNA και της μετάφρασης αυτού του μορίου mRNA, συμβαίνουν ταυτόχρονα. Δηλαδή, πριν ολοκληρωθεί η μεταγραφή, έχει ήδη ξεκινήσει η μετάφραση του νεοσυντιθέμενου μορίου mRNA καθώς είναι άμεσα δυνατή η πρόσδεση της μικρής ριβοσωμικής υπομονάδας στην 5′ αμετάφραστη περιοχή του mRNA. Αυτό είναι δυνατό καθώς τα βακτηριακά κύτταρα δεν διαθέτουν πυρηνική μεμβράνη και επομένως το μόριο DNA βρίσκεται στο κυτταρόπλασμα στην περιοχή του πυρηνοειδούς μαζί με τα ριβοσώματα, τα οποία είναι τα ειδικά σωματίδια του κυττάρου, που μαζί με άλλα μόρια (π.χ tRNA , rRNA κ.α ) και αρκετή ενέργεια πραγματοποιούν την διαδικασία της πρωτεϊνοσύνθεσης του κυττάρου.

Β3

Το ιδανικό φάρμακο είναι εκείνο που δεν επιφέρει καμία παρενέργεια στον οργανισμό ενώ ταυτόχρονα θεραπεύει αποτελεσματικά. Το ιδανικό φάρμακο είναι τα αντισώματα.

Τα αντισώματα είναι πρωτεϊνικά μόρια που παράγει ο οργανισμός των θηλαστικών (και των πτηνών) και έχουν την δυνατότητα να συνδέονται εκλεκτικά με ένα ορισμένο τμήμα ( αντιγονικός καθοριστής ) ενός ξένου προς τον οργανισμό σώματος (αντιγόνο).

Το αντιγόνο είναι ξένη προς τον οργανισμό ουσία που μπορεί να προκαλέσει ανοσολογική απόκριση, δηλαδή παραγωγή από τον οργανισμό ειδικών κυττάρων (λεμφοκυττάρων) και κυτταρικών προϊόντων ( π.χ αντισώματα) που θα δράσουν για την εξουδετέρωση του.

Τα αντισώματα παράγονται από τα Β-λεμφοκύτταρα του οργανισμού, κάθε διαφορετικό Β-λεμφοκύτταρο παράγει συγκεκριμένο διαφορετικό αντίσωμα, κατάλληλο για την αναγνώριση και την σύνδεση του μ’ έναν συγκεκριμένο αντιγονικό καθοριστή. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων είναι όλα όμοια μεταξύ τους και ονομάζονται μονοκλωνικά αντισώματα.

Τα μονοκλωνικά αντισώματα βρίσκουν πολλές εφαρμογές ως διαγνωστικά εργαλεία στην Βιολογία και την Ιατρική. Τα μονοκλωνικά αντισώματα δεν μπορούν να παραχθούν σε μεγάλες ποσότητες από τα Β-λεμφοκύτταρα όταν αυτά αναπτύσσονται σε κυτταροκαλλιέργειες in vitro καθώς τα φυσιολογικά Β – λεμφοκύτταρα (κυτταρική σειρά) δεν μπορούν να διαιρεθούν περισσότερες από 50 με 70 φορές, μιτωτικά, στην κυτταροκαλλιέργεια.

Προκειμένου λοιπόν να παραχθούν τα μονοκλωνικά αντισώματα που θέλουμε σε μεγάλες ποσότητες, πρέπει να συντηχθούν τα ειδικά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα (τα κύτταρα αυτά έχουν παραχθεί σε ένα ποντίκι εμβολιασμένο με τον επιθυμητό αντιγονικό καθοριστή, το οποιο πραγματοποιεί πρωτογενή ανοσοβιολογική απόκριση εναντίον αυτού του αντιγονικού καθοριστή) με καρκινικά Β-λεμφοκύτταρα ποντικού (μυέλωμα). Τα κύτταρα που προκύπτουν από την σύντηξη, ονομάζονται υβριδώματα και εμφανίζουν τις δύο ιδιότητες που θέλουμε, να παράγουν τα επιθυμητά αντισώματα και να διαιρούνται για πολύ περισσότερες φορές από 50-70 διαιρέσεις σε κυτταροκαλλιέργεια in vitro. Η τελευταία ιδιότητα είναι ιδιότητα των καρκινικών κυττάρων.

Έτσι προκειμένου να παράγουμε μονοκλωνικά αντισώματα που αναγνωρίζουν και συνδέονται με την χορειακή γοναδοτροπίνη του ανθρώπου ώστε να δημιουργήσουμε ένα ευαίσθητο διαγνωστικό έλεγχο για την εγκυμοσύνη στα πρώτα στάδια της, πρέπει :

α) Να χορηγήσουμε με ένεση σ’ ένα υγιές ποντίκι, ανθρώπινη χορειακή γοναδοτροπίνη, που έχουμε απομονώσει από γυναίκα που είναι έγκυος στα πρώτα στάδια της εγκυμοσύνης. Θεωρούμε δεδομένο ότι το ποντίκι δεν παράγει χορική γοναδοτροπίνη όμοια με του ανθρώπου, ώστε η ανθρώπινη ορμόνη να λειτουργήσει ως αντιγόνο σε αυτό. Επίσης, το ποντίκι που εμβολιάστηκε με την ανθρώπινη ορμόνη, ζει σε στείρο περιβάλλον ώστε να μην παράγει κατά το δυνατό αλλά αντισώματα, διαφορετικά από τα ζητούμενα, ώστε να διευκολυνθούμε στην απομόνωση των κατάλληλων Β-λεμφοκυττάρων

β) 15 μέρες μετά τον εμβολιασμό του, όταν έχει μεγιστοποιηθεί η ανοσολογική πρωτογενής αντίδραση του ποντικιού έναντι της ανθρώπινης ορμόνης, από το ποντίκι αφαιρείται ο σπλήνας του. Ο σπλήνας είναι δευτερογενές λεμφικό όργανο των θηλαστικών, στο οποίο πραγματοποιείται η ανοσολογική απόκριση .Επομένως, στον σπλήνα θα υπάρχουν πολλά Β-λεμφοκύτταρα του ποντικιού που παράγουν το επιθυμητό αντίσωμα.

γ) Από τον σπλήνα του ποντικιού απομακρύνονται τα επιθυμητά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα .

δ) Τα κατάλληλα Β-λεμφοκύτταρα του ποντικιού συντήκονται με καρκινικά Β-λεμφοκύτταρα ποντικιού που αναπτύσσονται σε κυτταροκαλλιέργεια (μυέλωμα). Τα προϊόντα της κυτταρικής σύντηξης ονομάζονται υβριδώματα. Τα Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντισωμα δίνουν στο υβρίδωμα τη δυνατότητα να παράγει το επιθυμητό αντισωμα και τα καρκινικά κύτταρα προσδίδουν αθανασία.

ε) Από τα υβριδώματα που παράγονται κάποια ευαισθητοποιούνται με την ανθρώπινη χορειακή γοναδοτροπίνη, όποτε κλωνοποιούνται (μιτωτικά) και στην συνέχεια κατά ένα μέρος τους διαφοροποιούνται σε πλασματοκύτταρα, τα οποία παραγάγουν και εκκρίνουν μεγάλες ποσότητες του επιθυμητού αντισώματος ενώ τα υπόλοιπα φυλάγονται στην κατάψυξη (-800C) για μεταγενέστερη χρήση.

Τα παραγόμενα από τα κατάλληλα υβριδώματα, μονοκλωνικά αντισώματα, που αναγνωρίζουν την ανθρώπινη χορειακή γοναδοτροπίνη, μπορούν τώρα να χρησιμοποιηθούν ως διαγωνιστικά εργαλεία για τον έλεγχο της ύπαρξης κύησης, κυρίως σε γυναίκες που βρίσκονται στα πρώτα στάδια της εγκυμοσύνης.

Η λήψη αίματος από μια γυναίκα που επιθυμεί να μάθει αν είναι έγκυος και η χρήση των μονοκλωνικών αντισωμάτων για τον ποσοτικό και ποιοτικό προσδιορισμό της χορειακής γοναδοτροπίνης της, μας επιτρέπει να γνωρίζουμε αν είναι έγκυος (εφόσον διαθέτει την ορμόνη στο αίμα της, ποιοτικός έλεγχος) και σε ποια αρχική εβδομάδα της κύησης βρίσκεται (ανάλογα με την ποσότητα της ορμόνης που εντοπίστηκε) .

Β4

Η τεχνολογία του ανασυνδυασμένου DNA έχει δώσει τη δυνατότητα δημιουργίας γονιδιωματικών βιβλιοθηκών των οργανισμών.

Η γονιδιωματική βιβλιοθήκη ενός οργανισμού είναι το σύνολο των βακτηρικών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό (με άγαρ) και κάθε κλώνος φέρει ενσωματωμένο σε ένα μόριο φορέα κλωνοποίησης (πλασμίδιο ή DNA λ-φάγου αντιστοίχως) ένα ορισμένο τμήμα από το DNA του οργανισμού, του οποίου δημιουργούμε την βιβλιοθήκη.

Αυτό το τμήμα του DNA του οργανισμού δότη του γενετικού υλικού (δηλαδή του οργανισμού του οποίου δημιουργούμε την γονιδιωματική βιβλιοθήκη), υπάρχει σε πολλαπλά αντίγραφα σε κάθε κλώνο της βιβλιοθήκης, δηλαδη, το DNA του οργανισμού δότη έχει κλωνοποιηθεί.

Το σύνολο των κλώνων της γονιδιωματικής βιβλιοθήκης φέρει το σύνολο του γονιδιώματος του οργανισμού δότη (συνήθως χωρίς το μιτοχόνδριακό ή/και το χλωροπλαστικό DNA -το τελευταίο μόνο σε περίπτωση φυτικού οργανισμού- αναφερόμενο σε ευκαρυωτικό οργανισμό) σε πολλά διαφορετικά τμήματα σε πολλά αντίγραφα το κάθε τμήμα. Γονιδιωματικές βιβλιοθήκες δημιουργούνται και για προκαρυωτικούς και για ευκαρυωτικούς οργανισμούς.

Γνωρίζουμε ότι τα κύτταρα ενός πολυκυτταρικού οργανισμού φέρουν όλα τα ίδιο γενετικό υλικό (εκείνο το DNA, του ζυγωτού του οργανισμού αυτού) αφού όλα είναι προϊόντα μίτωσης του πρώτου διπλοειδούς κυττάρου (ζυγωτό) αυτού του οργανισμού. ‘Έτσι όλα τα απόγονα κύτταρα από την μίτωση κυττάρων που διαιρούνται, ενός ζωικού οργανισμού, όπως είναι τα μυϊκά και τα ηπατικά, θα φέρουν το ίδιο DNA (θεωρούμε ότι δεν έχουν συμβεί καινοφανείς μεταλλάξεις στα όργανα αυτά).

Η δημιουργία της γονιδιωματικής βιβλιοθήκης ενός οργανισμού περιλαμβάνει τα εξής βήματα:

Α) Απομόνωση κυττάρων του οργανισμού π.χ μυϊκά ή/και ηπατικά.

Β) Απομόνωση του DNA των κυττάρων αυτών, με λύση των κυττάρων.

Γ) Πέψη του DNA των κυττάρων αυτών με μία ορισμένη περιοριστική ενδονουκλέαση π.χ EcoRI. H περιοριστική ενδονουκλέαση αναγνωρίζει και κόβει με συγκεκριμένη φορά, μία ορισμένη δίκλωνη αλληλουχία DNA μήκους 4-8 ζευγών βάσεων. Η EcoRI για παράδειγμα αναγνωρίζει την δίκλωνη αλληλουχία:

5’GAATΤC3’

3’CTTAAG5’

και κόβει μεταξύ του G και του Α με προσανατολισμό 5’→3’ αφήνοντας αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα). Κάθε περιοριστικό ένζυμο δημιουργεί τέτοια κολλώδη άκρα όπως αυτά προκύπτουν με βάση την αλληλουχία αναγνώρισης DNA που αναγνωρίζει αυτό το ένζυμο. Για την EcoRI:

 

5’G 3′           5′ AATΤC3’

3’CTTAA 5′           3′G5’

AATT : κολλώδες άκρο Ι

TTAA : κολλώδες άκρο ΙΙ

Τα κολλώδη άκρα Ι και ΙΙ είναι συμπληρωματικά. Κάθε περιοριστικό ένζυμο κόβει το δίκλωνο DNA σε δυο φωσφοδιεστερικούς δεσμούς 3’→5’ και το ανάλογο πλήθος δεσμών υδρογόνου, σύμφωνα με την αλληλουχία αναγνώρισης του. Η ΕcoRI σπάει 8 δεσμούς υδρογόνου μεταξύ των 4 ζευγών βάσεων Α και Τ.

Δ) Απομόνωση κατάλληλου φορέα κλωνοποίηση, πλασμίδιο ή DNA φαγού λ και πέψη του φορέα κλωνοποίησης με το ίδιο περιοριστικό ένζυμο που χρησιμοποιήθηκε στο προηγούμενο βήμα, ώστε να δημιουργηθούν συμπληρωματικά κολλώδη άκρα .

Ε) Ανάμιξη και ανασυνδυασμός των τμημάτων DNA του οργανισμού δότη και των κομμένων φορέων κλωνοποίησης με την προσθήκη DNA δεσμάσης για την ένθεση – δημιουργία δυο 3′->5′ φωσφοδιεστερικων δεσμών ανα σημειο συνδεσης- ενός τμήματος DNA του οργανισμού δότη σε έναν φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακους φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου της καλλιέργειας (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών, για την ανάπτυξη αποικιών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Εφόσον σύμφωνα με τα δεδομένα της εκφώνησης τα ένζυμα και οι τεχνικές που χρησιμοποιούνται είναι ίδια τόσο για τη δημιουργία της βιβλιοθήκης του ηπατικού όσο και του μυϊκού κυττάρου, οι δύο γονιδιωματικές βιβλιοθήκες θα είναι ίδιες, εφόσον δεν φέρουν τα κύτταρα που απομονώσαμε από αυτά τα όργανα μεταλλάξεις.

cDNA βιβλιοθήκη ενός κυτταρικού τύπου ενός ευκαρυωτικού οργανισμού είναι το σύνολο των βακτηριακών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό και φέρουν σε πολλαπλά αντίγραφα, το ολικό ώριμο mRNA του κυτταρικού τύπου με τη μορφή δίκλωνου DNA ενσωματωμένο σε φορείς κλωνοποίησης (πλασμίδια ή DNA λ-φάγου, αντιστοίχως).

Η διαδικασία δημιουργίας της cDNA βιβλιοθήκης ενός κυτταρικού τύπου εν συντομία, είναι:

Α) Απομόνωση κυττάρων του κυτταρικού τύπου του οργανισμού π.χ μυϊκά ή ηπατικά στο κατάλληλο αναπτυξιακό στάδιο στην επιθυμητή φάση του κυτταρικού κύκλου των κυττάρων, στις επιθυμητές συνθήκες για τον οργανισμό.

Β) Απομόνωση του ολικού ώριμου mRNA των κυττάρων αυτών με ήπια λύση των κυττάρων.

Γ) Χρήση του ολικού ωρίμου mRNA ως καλούπι για την σύνθεση cDNA με την βοήθεια της αντίστροφης μεταγραφάσης.

Δ) Δημιουργία δίκλωνου DNA από το cDNA με την βοήθεια της DNA πολυμεράσης.

Ε) Ένθεση του δίκλωνου DNA, μετά από κατάλληλη κατεργασία, σε φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακούς φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους αντιστοίχως.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Η cDNA βιβλιοθήκη ενός κυτταρικού τύπου διαφέρει ανάλογα με το αναπτυξιακό στάδιο του οργανισμού καθώς και την φάση των κυττάρων του οργανισμού δότη, που έγινε η απομόνωση του ολικού ώριμου mRNA των κυττάρων του, εξαιτίας του γεγονότος ότι, διαφορετικά γονίδια εκφράζονται σε κάθε χρονική στιγμή.

Επίσης, η cNAD βιβλιοθήκες δύο διαφορετικών κυτταρικών τύπων του ίδιου οργανισμού, την ίδια χρονική στιγμή, διαφέρουν εξαιτίας της κυτταρικής διαφοροποίησης, δηλαδή της επιλεκτικής έκφρασης διαφορετικών γονιδίων από κάθε κύτταρο που ανήκει σε διαφορετικό κυτταρικό τύπο του ίδιου οργανισμού, όπως το ήπαρ και οι μύες, ώστε κάθε κύτταρο του κάθε κυτταρικού τύπου, να διαθέτει τις κατάλληλες πρωτεΐνες για την σωστή δομή και λειτουργία του, στο ορισμένο αναπτυξιακό στάδιο του οργανισμού και τις συνθήκες που επικρατούν στον οργανισμό και στο περιβάλλον του, έτσι ώστε να ανταποκριθούν καταλλήλως τα κύτταρα του κάθε κυτταρικού τύπου.

Βεβαίως κάθε κύτταρο ενός οργανισμού παράγει και πρωτεΐνες που είναι αναγκαίες για τις βασικές λειτουργίες του όπως π.χ τις λειτουργίες της μεταγραφής και της μετάφρασης καθώς και της αντιγραφής για τα μυϊκα και τα ηπατικά κύτταρα, τα οποία διαιρούνται. Επομένως, οι cDNA βιβλιοθήκες ενός ηπατικού και ενός μυϊκού κυττάρου αναμένεται να έχουν πολλούς διαφορετικούς κλώνους και ορισμένους κοινούς κλώνους.

ΘΕΜΑ Γ

Γ1

Θεωρούμε ότι η α1 αντιθρυψίνη που αναφέρεται στην εκφώνηση του ερωτήματος είναι η πρωτεΐνη του ανθρώπου που παράγεται στο ήπαρ και η έλλειψη της οδηγεί σε πνευμονικό εμφύσημα.

Γνωρίζουμε ότι μπορούμε σήμερα να δημιουργήσουμε διαγονιδιακά ζώα, δηλαδή ζώα, που με την τεχνολογία του ανασυνδυασμένου DNA, φέρουν ένα ετερόλογο γονίδιο, δηλαδή γονίδιο ενός άλλου είδους όπως παραδείγματος χάριν του ανθρώπου, στο γονιδίωμά τους. Τα ζώα αυτά χρησιμοποιούνται σήμερα ως εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών (gene farming) καθώς είναι δυνατή η έκφραση των ανθρώπινων γονιδίων από τα ζωικά κύτταρα.

Για να εκφράσει ένα γονίδιο πρέπει στα κύτταρα του κυτταρικού τύπου του ευκαρυωτικού οργανισμού οπου θα εκφράζεται αυτό το γονίδιο, να υπάρχουν οι κατάλληλοι μεταγραφικοί παράγοντες οι οποιοι αναγνωρίζουν και συνδέονται με τον υποκινητή του γονιδίου αυτού, δηλαδή του γονιδίου, που εκφράζεται. Μόνο όταν ο σωστός συνδυασμός μεταγραφικών παραγόντων έχει συνδεθεί στον υποκινητή του γονιδίου, είναι δυνατή η σύνδεση της RNA πολυμεράσης με τον υποκινητή του γονιδίου αυτού, ώστε να ξεκινήσει σωστά η μεταγραφή του.

Επίσης δεδομένου ότι ο γενετικός κώδικας είναι σχεδόν καθολικός, δηλαδή όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα και σε συνδυασμό με το γεγονός πως τα ριβοσώματα των οργανισμών μπορούν να χρησιμοποιηθούν ως θέσεις πρωτεινοσυνθεσης για οποιοδήποτε μόριο mRNA οποιουδήποτε οργανισμού ή ιού. Το ζωικό κύτταρο θα μπορεί να μεταφράσει το mRNA που θα προκύψει από την μεταγραφή του ανθρώπινου γονιδίου, το οποίο είναι ενσωματωμένο κατάλληλα στο γονιδίωμα του ζώου.

Ένα διαγονιδιακό ζώο που θέλουμε να παράγει την ανθρώπινη α1-αντιθρυψίνη στα μαστικά του κύτταρα, θα πρέπει να έχει δημιουργηθεί με τέτοιο τρόπο ώστε το ανθρώπινο γονίδιο που με μικροέγχυση έχει εισέλθει στο γονιμοποιημένο ωράριο του ζώου, να έχει τοποθετηθεί στο γονιδίωμα του ζώου με τέτοιο τρόπο, ώστε να βρίσκεται υπό τον έλεγχο του υποκινητή ενός γονιδίου του ζώου, το οποίο εκφράζεται αποκλειστικά στα μαστικά κύτταρα. Τέτοιο γονίδιο του ζώου, είναι το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος του ζώου.

Σύμφωνα με τα δεδομένα της εκφώνησης, το ανθρώπινο γονίδιο της α1-αντιθρυψίνη έχει τοποθετηθεί με το σωστό προσανατολισμό μέσα στο γονίδιο της καζεΐνης του γάλακτος του ζώου, δηλαδή η κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης έχει τοποθετηθεί με το 5’ άκρο της προς τον υποκινητή του γονιδίου της ζωικής καζεΐνης και συνεπώς η μη-κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης θα έχει το 3’άκρο της προς τον υποκινητή του γονιδίου της καζεΐνης του ζώου. Έτσι , κατά την μεταγραφή του γονιδίου της καζεΐνης του ζώου από την RNA πολυμεράση του ζώου, θα μεταγράφεται η μη κωδική αλυσίδα του γονιδίου της ανθρώπινης α1-αντιθρυψίνης. ‘Έτσι το ζωικό κύτταρο στη συνέχεια, μετά την μεταγραφή του γονιδίου της ανθρώπινης α1-αντιθρυψίνης, θα ωριμάσει αρχικά (αν το ανθρώπινο γονίδιο δεν έχει απομονωθεί από cDNA βιβλιοθήκη ανθρωπίνων ηπατικών κυττάρων) και θα μεταφράσει στη συνέχεια, το κατάλληλο mRNA για την παραγωγή της ανθρώπινης πρωτεΐνης σε πρόδρομη μορφή. Η λειτουργική πρωτεΐνη α1-αντιθρυψίνη του ανθρώπου, θα δημιουργηθεί από τους μετά-μεταφραστικούς μηχανισμούς του ζώου, που δεν διαφέρουν από εκεινους του ανθρώπου καθώς και τα δυο είδη είναι θηλαστικά.

Γ2

Μας δίνεται το δίκλωνο γραμμικό τμήμα DNA:

5’GAATTCCGCAAATTAA

3’CTTAAGGCGTTTAATT5’

To οποίο πέπτεται από το περιοριστικό ένζυμο ΕcoRI . Το περιοριστικό ένζυμο EcoRI αναγνωρίζει την δίκλωνη αλληλουχία

5’GAATTC3’

3’ CTTAAG5’

και κόβει με προσανατολισμό 5’→3’ μεταξύ του G και Α σπάζοντας τους φοσφωδιεστερικούς δεσμούς μεταξύ τους και ταυτόχρονα σπάει και τους 8 δεσμούς υδρογόνου μεταξύ των συμπληρωματικών ζευγών Α και Τ, αφήνοντας μονόκλωνες αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα).

Δηλαδή μετά την επίδραση της EcoRI το δοθέν τμήμα DNA πέπτεται ως εξής, εφόσον φέρει μοναδική θέση αναγνώρισης του περιοριστικού ενζύμου στα αριστερά.

ΕΙΚΟΝΑ Α

5’G3΄            5΄AATTCCGCAAATTAA

3’CTTAA5΄           3′ GGCGTTTAATT5’

3′ TTAA5’ KOΛΛΩΔΕΣ ΑΚΡΟ Ι

AATΤ ΚΟΛΛΩΔΕΣ ΑΚΡΟ ΙΙ

Η τεχνολογία του ανασυνδυασμένου DNA είναι το σύνολο των τεχνικών και των μεθόδων που μας επιτρέπουν την επέμβαση μας στο γενετικό υλικό των οργανισμών.

Μέσω της τεχνολογίας αυτής είναι δυνατή η ένθεση ενός γραμμικού δίκλωνου τμήματος DNA, που έχει κοπεί σε δύο σημεία με την ίδια περιοριστική ενδονουκλέαση, ώστε να φέρει στα δύο άκρα του συμπληρωματικά κολλώδη άκρα. Το τμήμα αυτό μπορεί να ενθεθει σ΄ ένα πλασμίδιο, όταν το πλασμίδιο έχει κοπεί σε μοναδικό σημείο από την ίδια περιοριστική ενδονουκλέαση ώστε να φέρει συμπληρωματικά κολλώδη άκρα στο σημείο τομής.

2017 Blog 8-9-01

Όπως προκύπτει από τις εικόνες Α και Β είναι αδύνατη η έκθεση του τμήματος που μας δίνεται σε πλασμίδιο που έχει κοπεί μία φορά με το ΕcoRI, καθώς το τμήμα που μας δίνεται διαθέτει μόνο μία φορά την αλληλουχία που αναγνωρίζεται από την ΕcoRI και επομένως φέρει ένα μονάχα κολλώδες άκρο στην μία ακριανή πλευρά του (εικόνα Α).

Η ένθεση του τμήματος που μας δίνεται θα ήταν εφικτή με το δοθέν πλασμίδιο, μονάχα αν ήταν δυνατό να προστεθεί το κατάλληλο κολλώδες άκρο, με την βοήθεια κατάλληλου ενζύμου, στο δεξιό άκρο του τμήματος μας.

Γ3

Σύμφωνα με τα δεδομένα της εκφώνησης έχουμε το παρακάτω γενεαλογικό δέντρο:

2017 Blog 8-9-01 extra 1

Η μελέτη της κληρονομικότητας στον άνθρωπο εμφανίζει πολλές δυσκολίες καθώς ο άνθρωπος δεν εμφανίζει τα χαρακτηριστικά του κατάλληλου οργανισμού μοντέλου για την Γενετική. Ο άνθρωπος έχει μεγάλο χρόνο γενεάς, αφήνει λίγους απογόνους και δεν επιδέχεται επιλεκτικές διασταυρώσεις. Επομένως, η μελέτη της Γενετικής του ανθρώπου γίνεται με την δημιουργία γενεαλογικών δέντρων, δηλαδή μιας διαγραμματικής απεικόνισης των γάμων και των γεννήσεων μιας οικογένειας για πολλές γενεές .

Σύμφωνα με τα δεδομένα της άσκησης μια γυναίκα (Γ1) παντρεύτηκε με δύο διαφορετικούς συζύγους στην διάρκεια της ζωής της και απέκτησε με τον καθένα από ένα παιδί .

Η γυναίκα έχει ομάδα αίματος 0, και ο ένας σύζυγος της έχει ομάδα αίματος ΑΒ (Σ1) ενώ ο άλλος έχει ομάδα αίματος Α (Σ2). Το παιδί Π1 έχει ομάδα αίματος 0 και το παιδί Π2 έχει ομάδα αίματος Β.

Γνωρίζουμε ότι η ταυτοποίηση των ομάδων αίματος του ανθρώπου μπορεί να γίνει με τη χρήση κατάλληλων διαγνωστικών εργαλείων, όπως είναι τα μονοκλωνικά αντισώματα.

Ένα άτομο με ομάδα αίματος 0 δεν εμφανίζει κανένα αντιγόνο ούτε Α, ούτε Β στην επιφάνεια των ερυθροκυττάρων του, επομένως κατά την ταυτοποίηση με αντι-Α-αντισώματα και αντί-Β-αντισώματα, δεν θα πραγματοποιηθεί ανοσολογική αντίδραση in vitro, μεταξύ των ερυθροκυττάρων του ατόμου και των αντί-Α και αντί-Β αντισωμάτων.

Ένα άτομο με ομάδα αίματος ΑΒ θα εμφανίζει στην επιφάνεια των ερυθροκυττάρων του και το αντιγόνο Α και το αντιγόνο Β και in vitro, θα εμφανίζει ανοσολογική αντίδραση με τα δυο διαφορετικά είδη αντισωμάτων που αναγνωρίζουν αυτά τα αντιγόνα. Ομοίως σκεπτόμενοι, άτομα με ομάδα αίματος Α αντιδρά ανοσολογικά μόνο με το αντι-Α-αντίσωμα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με τα αντί-Α-αντίσωματα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με το αντι-Β-αντίσωματα.

Γνωρίζουμε ότι το γονίδιο Ι που ελέγχει για τις ομάδες αίματος είναι αυτοσωμικό και έχει τρία πολλαπλά αλληλόμορφα τα ΙΑ, ΙΒ , και i . Τα ΙΑ και ΙΒ είναι συνεπικρατή μεταξύ τους και επικρατούν του i. Tο αλληλόμορφο ΙΑ κωδικοποιεί για μια πρωτεΐνη που μετατρέπει μια πρόδρομη ουσία σε αντιγόνο Α, το οποίο τοποθετείται στην επιφάνεια των ερυθροκυττάρων. Ομοίως το ΙΒ κωδικοποιεί την πρωτεΐνη που σχηματίζει το αντιγόνο Β, ενώ το αλληλόμορφο i δεν κωδικοποιεί για κάποια πρωτεΐνη. Έτσι άτομα με γονότυπο ΙΑ ΙΑ και ΙΑI έχουν φαινότυπο ομάδα αίματος Α. Τα άτομα με το γονότυπο ΙΒ ΙΒ ή ΙΒ i έχουν φαινότυπο ομάδα αίματος Β, άτομα γονότυπου ΙΑΙΒ έχουν φαινότυπο ομάδα αίματος ΑΒ και τέλος τα άτομα γονότυπου ii έχουν ομάδα αίματος 0.

Σύμφωνα με τα παραπάνω και με δεδομένο ότι κάθε γονέας κληροδοτέι ένα πλήρες απλοειδές γονιδίωμα σε κάθε απόγονο του σύμφωνα με τον 1ₒ νόμο του Μendel, ο οποίος αναφέρει ότι κατά τον σχηματισμό των γαμετών, τα αλληλόμορφα γονίδια διαχωρίζονται και κατανέμονται στους γαμέτες τυχαία μεν άλλα ισοπιθανα δε. Η γονιμοποίηση είναι τυχαίο γεγονός.

Έχουμε λοιπόν τις εξής δύο διασταυρώσεις :

  1. Ρ1 : Γ1 Χ Σ1

F1 : Παιδί Α

Δηλαδή : Ρ1 : ii × IA I B

γαμέτες : i, i / IA , IB

γαμέτες/ γαμέτες

IA

IB

i

IAi

IBi

i

IAi

IBi

Oι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών μιας διασταύρωσης και τρόπου συνδυασμού τους, μεταξύ τους.

Γονοτυπική αναλογία F1 γενεάς: IAi : IBi

Φαινοτυπική αναλογία F1 γενεάς: [ Α ] : [ B ]

Δηλαδή η γυναίκα αυτή μπορεί να αποκτήσει με τον σύζυγο 1, παιδιά με ομάδα αίματος Α ή με ομάδα αίματος Β. Δεν μπορεί να αποκτήσει παιδιά με ομάδα αίματος ΑΒ και παιδιά με ομάδα αίματος 0. Θεωρούμε ότι δεν εμφανίζονται νέες μεταλλάξεις και όλα συμβαίνουν φυσιολογικά.

Β) Ρ2 : Γ1 x Σ2

F1 : Παιδί Β

Δηλαδή : P2 : ii x IAIA ή P2 : ii x IA i

γαμέτες: i , i / IA , IA γαμέτες : i , i / IA , i

F1 :

γαμέτες/ γαμέτες

IA

IA

i

IAi

IAi

i

IAi

IAi

ή

F1 :

γαμέτες/ γαμέτες

IA

i

i

IAi

ii

i

IAi

ii

F1

Γονοτυπική αναλογία : 100% IAi                   ή                  Γονοτυπική αναλογία : ΙΑi : ii

Φαινοτυπική αναλογία : 100 % [A]                  ή                   Φαινοτυπική αναλογία : [Α] : [0]

Επομένως , αναλόγως με τον γονότυπο του συζύγου 2, η γυναίκα αυτή με τον άνδρα αυτό, μπορεί είτε να αποκτήσει μόνο παιδιά με ομάδα αίματος Α ή παιδιά με ομάδα αίματος Α και με ίση αναλογία παιδιά με ομάδα αίματος 0.

Επομένως, με βάση τις παραπάνω, το παιδί Π1 αφού έχει ομάδα αίματος 0 είναι παιδί του Σ2, ο οποίος θα έχει ομάδα αίματος Α και γονότυπο ΙΑi και το παιδί Π2, αφού έχει ομάδα αίματος Β είναι παιδί του Σ1.

Δηλαδή το γενεαλογικό δέντρο είναι :

2017 Blog 8-9-01 extra 2

Γ4

Γνωρίζουμε ότι όλοι οι μικροοργανισμοί όπως και όλα τα έμβια όντα απαιτούν για την ανάπτυξη τους πηγή άνθρακα (C) στο περιβάλλον τους σε κατάλληλες ποσότητες, αφού όλα τα βιολογικά μακρομόρια που δομούν τα κύτταρα (πρωτεΐνες, DNA, RNA, λιπίδια και υδατάνθρακες) αποτελούνται από C. Οι ετερότροφοι μικροοργανισμοί προμηθεύονται από τo περιβάλλον τους τον C, με μορφή οργανικών ενώσεων, ενώ οι αυτότροφοι προμηθεύονται από τον C από τον CO2 της ατμόσφαιρας.

Το βακτήριο E.coli είναι ετερότροφο και απαιτεί ως πηγή άνθρακα είτε γλυκόζη (κατά προτίμηση), είτε λακτόζη, είτε κάποιον άλλον υδατάνθρακα που θα μπορεί να τον μεταβολίσει. Οι Γάλλοι επιστήμονες, Jacob και Monod απέδειξαν ότι το βακτήριο E. coli μπορεί να μεταβολίζει την λακτόζη (δισακχαρίτης αποτελούμενος από γλυκόζη και γαλακτόζη) χάρη στην ύπαρξη στο γονιδίωμα του, του οπερονίου της λακτόζης.

Το οπερόνιο της λακτόζης, απέδειξαν οι Γάλλοι επιστήμονες, ότι αποτελείται από τρία γονίδια που ονομάζονται δομικά ( με τη σειρά: Ζ,Υ,Α) τα οποία βρίσκονται υπό τον έλεγχο του ίδιου υποκινητή. Την έκφραση των δομικών γονιδίων του οπερονίου ελέγχουν δύο ρυθμιστικές αλληλουχίες του. Η μία ονομάζεται χειριστής και βρίσκεται μεταξύ της αλληλουχίας του υποκινητή του οπερονίου, και του πρώτου δομικού γονιδίου Ζ του οπερονίου.

Η άλλη ρυθμιστική αλληλουχία της έκφρασης των δομικών γονιδίων του οπερονίου της λακτόζης, ονομάζεται ρυθμιστικό γονίδιο και βρίσκεται μπροστά από τον υποκινητή του οπερονίου. Το ρυθμιστικό γονίδιο διαθέτει τον δικό του υποκινητή και τις δικές του αλληλουχίες λήξης της μεταγραφής.

Το ρυθμιστικό γονίδιο εκφράζεται συνεχώς και κωδικοποιεί λίγα μόρια μιας πρωτεΐνης, που ονομάζεται πρωτεΐνη καταστολεας. Η πρωτεΐνη αυτή έχει τέτοια στερεοδιάταξη ώστε να αναγνωρίζει την αλληλουχία του χείριστη και να συνδέεται με αυτήν. Η σύνδεση του καταστολέα με τον χειριστή παρεμποδίζει την μεταγραφή των δομικών γονιδίων του οπερονίου της λακτόζης.

΄Όμως, όταν εντός του βακτηρικού κυττάρου υπάρχει λακτόζη, τότε ο ίδιος ο διασακχαρίτης συνδέεται με την πρωτεΐνη καταστολέα σε κατάλληλο σημείο της. Η συνδεση αυτή οδηγεί σε αλλαγή στην στερεοδιάταξη της πρωτεΐνης καταστολέα ώστε αυτή τώρα να μην μπορεί να συνδέεται πλέον με τον χειριστή του οπερονίου. Οπότε, η ίδια η λακτόζη λειτουργεί ως επαγωγέας της έκφρασης των δομικών γονιδίων του οπερονίου, που την καταβολίζει. Δηλαδή, όταν το βακτήριο αναπτύσσεται σε περιβάλλον με μόνη πηγή άνθρακα λακτόζη, εκφράζεται το οπερόνιο της λακτόζης, δηλαδή μεταγράφεται και μεταφράζεται. Με την μεταγραφή του παράγεται ένα μόριο mRNA που φέρει τρεις πληροφορίες για την σύνθεση τριών διαφορετικών πρωτεϊνών (με τη σειρά β-γαλακτοζιδάση, περμεάση, τρανσακετυλάση) κατά την μετάφρασή του, οι οποίες συμμετέχουν στον καταβολισμό της λακτόζης.

Σύμφωνα λοιπόν με τα παραπάνω μπορούμε να ερμηνεύσουμε το δοθέν διάγραμμα, με βάση το οποίο, λίγο πριν την χρονική στιγμή t1, η πηγή άνθρακα του θρεπτικού υλικού έχει εξαντληθεί. Τη χρονική στιγμή t1 προστίθεται λακτόζη στο θρεπτικό υλικό. Μέτα την προσθήκη λακτόζης παρατηρείται σιγμοειδής αύξηση (παρατηρήθηκε εκθετική αύξηση στην παραγόμενη από τα κύτταρα ποσότητα mRNA, μέχρι μία ορισμένη μέγιστη τιμή πέρα από την οποία η ποσότητα του mRNA/βακτήριο δεν αυξάνεται άλλο) στην καμπύλη μεταβολής της συνάρτησης mRNA ανά κύτταρο =f(t).

Μετά την προσθήκη της λακτόζης στην καλλιέργεια την χρονική στιγμή t1, το βακτήριο E.coli άρχισε να εκφράζει το οπερόνιο της λακτόζης και να παράγει το mRNA από την μεταγραφή του, ενώ ταυτόχρονα, επειδή το κύτταρο διαθέτει πλέον πηγή C και επομένως ενέργεια και υλικά για την κάλυψη των αναγκών του και για την σύνθεση των βιολογικών μακρομορίων του, εκφράζει εκτός από το οπερόνιο της λακτόζης και τα υπόλοιπα γονίδια που σχετίζονται με την ανάπτυξη κάθε βακτηρίου για το δεδομένο περιβάλλον όπου αναπτύσσεται. Η παραγωγή των μορίων mRNA θα φτάσει κάποια χρονική στιγμή την μέγιστη δυνατή τιμή πέρα από την οποία δεν μπορεί να αυξηθεί άλλο, αφού αυτές είναι οι μέγιστες ενδογενείς δυνατότητες των βακτηρίων της καλλιέργειας σε αυτό το δεδομένο περιβάλλον.

ΘΕΜΑ Δ

Δ1

Στο φυσιολογικό γονίδιο της αλυσίδας β της αιμοσφαιρίνης Α (HbA) αντιστοιχεί η αλληλουχία ΙΙΙ της δοθείσας εικόνας 4. Στο παθολογικό γονίδιο βς αντιστοιχεί η αλληλουχία Ι της εικόνας 4.

Αιτιολόγηση: Γνωρίζουμε ότι η αιμοσφαιρίνη Α (ΗbA) είναι μία πρωτεΐνη των ερυθρών αιμοσφαιρίων μας, υπεύθυνη για την μεταφορά του οξυγόνου (02 )στους ιστούς. Η αιμοσφαιρίνη Α αποτελείται από 4 πολυπεπτιδικές αλυσίδες 2α και 2β.

Οι αλυσίδες β της ΗbA κωδικοποιούνται από ένα αυτοσωμικό γονίδιο, το γονίδιο β, στο οποίο έχουν βρεθεί περισσότερα από 300 πολλαπλά παθολογικά αλληλόμορφα. Ένα παθολογικό αλληλόμορφο του γονιδίου β είναι το γονίδιο βς το οποίο κωδικοποιεί για τις αλυσίδες βς που συνδεόμενες ανά 2, με 2 αλυσίδες α, δίνουν την μεταλλαγμένη αιμοσφαιρίνη ΗbS, αιτία της ασθένειας της δρεπανοκυτταρικής αναιμίας μίας σοβαρής αυτοσωμικής υπολειπόμενης νόσου.

Η διαφορά της πολυπεπτιδικής αλυσίδας β (φυσιολογική) από της βς (παθολογική ) είναι το 6ο αμινοξύ των πολυπεπτιδίων όπου η β φέρει ως αμινοξύ γλουταμινικό οξύ και η βς φέρει βαλίνη.

Γνωρίζουμε ότι η μεταφορά της γενετικής πληροφορίας από το γονίδιο στην πολυπεπτιδική αλυσίδα γίνεται μέσω της μεταφοράς της πληροφορίας από την μία αλυσίδα του γονιδίου στο κινητό αντίγραφο της γενετικής πληροφορίας, που είναι ένα μονόκλωνο μόριo mRNA, μέσω της διαδικασίας μεταγραφής του γονιδίου. Αντίγραφό λοιπόν της κωδικής αλυσίδας του γονιδίου (που φέρει άμεσα την γενετική πληροφορία του γονιδίου) είναι ένα μόριο mRNA, το οποίο μεταφέρεται στα ριβοσώματα για την παραγωγή του πολυπεπτιδίου, μέσω ενός κώδικα αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών (γενετικός κώδικας) χάρη στα μόρια tRNA.

O Γενετικός κώδικας είναι:

α) Τρίλεπτας, τρία νουκλεοτίδια του mRNA κωδικοποιούν ένα αμινοξύ (κωδικόνιο).

β) Συνεχής , κατά την μετάφραση δεν παραλείπεται κανένα νουκλεοτίδιο.

γ) Μη επικαλυπτόμενος, κάθε νουκλεοτίδιο του mRNA που μεταφράζεται ανήκει μόνο σ ένα κωδικόνιο.

δ) Έχει κωδικόνιο έναρξης της μετάφρασης (ΑUG) και κωδικόνιο λήξης της μετάφρασης ένα εκ των (5΄’UAG3 , 5’UAA3, , UGA). Η μετάφραση σταματάει στα κωδικόνια λήξης καθώς δεν υπάρχουν μόρια tRNA με συμπληρωματικά αντικωδικόνια για αυτά τα κωδικόνια.

Σύμφωνα με την διαδικασία της μεταγραφής, το παραγόμενο μονόκλωνο μόριο mRNA, είναι όμοιο σε αλληλουχία και προσανατολισμό, αποτελούμενο βεβαίως από ριβονουκλεοτίδια, με τον ένα από τους δυο κλώνους του γονιδίου. Ο κλώνος αυτός του γονιδίου, ονομάζεται κωδικός και είναι αυτός που φέρει την γενετική πληροφορία όπως και το κινητό αντίγραφο του, το μόριο mRNA. Το μεταγράφημα (mRNA) προέκυψε από την μεταγραφή της συμπληρωματικής προς τον κωδικό κλώνο αλυσίδας του γονιδίου του κυττάρου, η αλυσίδα αυτή ονομάζεται μη κωδική και είναι αυτός ο κλώνος του γονιδίου που χρησιμοποιήθηκε από το ένζυμο της μεταγραφής δηλαδή, την RNA πολυμεράση ως καλούπι για την σύνθεση του mRNA. O κλώνος αυτός δεν φέρει κωδικόνια.

Η RNA πολυμεράση, κατά την μεταγραφή, συνδέεται στον υποκινητή του γονιδίου με την βοήθεια των κατάλληλων μεταγραφικών παραγόντων και ξετυλίγοντας την διπλή έλικα συνθέτει το μόριο RNA με καλούπι της, τη μη κωδική αλυσίδα του γονιδίου. Δημιουργείται έτσι ένα μόριο RNA με προσανατολισμό 5’→3’ , αφού το ένζυμο συνδέει τα ριβονουκλεοτίδια στο αναπτυσσόμενο RNA, με 3’→5’ φωσφοδιεστερικό δεσμό. Επομένως το mRNA που παράγεται κατά την μεταγραφή, έχει προσανατολισμό 5’→3’ με το 5’ άκρο του προς τον υποκινητή του γονιδίου, που μεταγράφεται. Όμοιο προσανατολισμό, έχει και η κωδική αλυσίδα του γονιδίου. Η μη-κωδική αλυσίδα του γονιδίου έχει αντιπαράλληλο προσανατολισμό.

Το αμινοξυ. γλουταμινικο οξύ, κωδικοποιείται απο το κωδικονιο 5’GAG3’ ενώ η βαλινη κωδικοποιείται από το κωδικόνιο 5’GTG3’.

Επομένως στις δοθείσες αλληλουχίες Ι , ΙΙ ,ΙΙΙ της εικόνας 4, προκειμένου να βρούμε την αλληλουχία του φυσιολογικού αλληλόμορφου β και του μεταλλαγμένου αλληλόμορφου βς θα αναζητήσουμε το κωδικόνιο έναρξης 5’ΑΤG3’ σ’ έναν από τους δύο κλώνους, της κάθε αλληλουχίας και για το γονίδιο β θα αναζητήσουμε και ως έβδομο κωδικόνιο το 5’GΑG3’ , ενώ για το παθολογικό αλληλομορφο βς ως έβδομο κωδικόνιο το 5’GTG3’. Γνωρίζουμε ότι κατά την μετα-μεταφραστική τροποποίηση που υφίσταται το παραγόμενο από τη μετάφραση πολυπεπτίδιο του συγκεκριμένου γονιδίου, αφαιρείται η αρχική μεθειονίνη από το αρχικό αμινικό άκρο, δηλαδή το έκτο αμινοξύ, τόσο στο λειτουργικό πολυπεπτίδιο β όσο και στο παθολογικό βς κωδικοποιήθηκε από το έβδομο κωδικόνιο στo mRNA.

Σύμφωνα λοιπόν με τα παραπάνω και τις δοθείσες αλληλουχίες I,II,III της εικόνας 4 παρατηρούμε ότι κωδικονιο έναρξης 5’ΑTG3’ υπάρχει μόνο στην πάνω αλυσίδα, στις αλληλουχίες Ι και ΙΙΙ και στην Ι αλληλουχία το 70 κωδικόνιο είναι το 5’GTG3’ άρα πρόκειται για το γονίδιο βς ενώ στην αλληλουχία ΙΙΙ το 70 κωδικόνιο είναι το GAG3’. Επομένως πρόκειται για το φυσιολογικό γονίδιο β.

Δ2

Η αλληλουχία της εικόνας 4 που απομένει είναι η αλληλουχία ΙΙ και θα μπορούσε να αντιστοιχεί σε γονίδιο που προκαλεί την β-θαλασσαιμία.

Αιτιολόγηση:

Γνωρίζουμε ότι ο γενετικός τόπος του γονιδίου β εμφανίζει περισσότερα από 300 πολλαπλά αλληλόμορφα. Εκείνα τα αλληλόμορφα που φέρουν τέτοια μετάλλαξη, η οποία έχει ως συνέπεια την παντελή έλλειψη της πολυπεπτιδικής αλυσίδας β, είτε έχει ως συνέπεια την μειωμένη παραγωγή της, τα αλληλόμορφα αυτά του γονιδίου β ευθύνονται για την β-θαλασσαιμία μια ασθένεια που εμφανίζει ετερογένεια συμπτωμάτων και προκαλείται από την απουσία ή την μειωμένη παρουσία της ΗbA στα ερυθροκυτταρα του ανθρωπου.

Ένα γονίδιο δεν εκφράζεται όταν δεν είναι δυνατή είτε η μεταγραφή είτε η μετάφραση του. Όταν ένα γονίδιο έχει υποστεί τέτοια μετάλλαξη (μόνιμη αλλαγή στην αλληλουχία του DNA του) που δεν φέρει κωδικόνιο έναρξης 5’ΑΤG3’ , τότε δεν μεταφράζεται το μόριο mRNA που προκύπτει από το γονίδιο αυτό, το οποίο μόριο mRNA αντιστοιχεί στην κωδική αλυσίδα του γονιδίου, όπως αποδείχθηκε στο προηγούμενο ερώτημα.

Παρατηρούμε ότι η αλληλουχία ΙΙ δεν φέρει τριπλέτα 5’ΑΤG3 στον πάνω κλώνο παρά μόνο στον κάτω. Ωστόσο, ο κάτω κλώνος δεν είναι η κωδική αλυσίδα του γονιδίου β, όπως αποδείχθηκε στο προηγούμενο ερώτημα. Συνεπώς, το παραγόμενο κατά την μεταγραφή μόριο mRNA αδυνατεί, να μεταφρασθεί για να παραχθεί το πολυπεπτίδιο β. Συνεπώς, η αλληλουχία β μπορεί να αντιστοιχεί σε ένα παθολογικό αλληλόμορφο γονίδιο β΄ του γονιδίου β, το οποίο παθολογικό β΄ ευθύνεται για την β-θαλασσαιμία.

Παρατηρούμε ότι οι τρεις αλληλουχίες Ι,ΙΙ,ΙΙΙ που μας δίνονται στην εικόνα 4 είναι πολλαπλά αλληλόμορφα του ίδιου γενετικού τόπου. Το αλληλόμορφο β΄( αλληλουχία ΙΙ) εμφανίζει σημειακή μετάλλαξη προσθήκης ενός ζεύγους βάσης ανάμεσα στο 8ο φυσιολογικό ζεύγος βάσεων και στο 90 ζεύγος βάσεων από αριστερά προς τα δεξιά, όπου το ζεύγος C-G έχει προστεθεί στην αλληλουχία ΙΙ .

C

III

G

Η μετάλλαξη αυτή οδηγεί στην κατάργηση του κωδικόνιου έναρξης, που υπάρχει φυσιολογικά στο γονίδιο β, μετά από έξι συνεχόμενες αδενινες, διαβάζοντας από τα αριστερά προς τα δεξιά τον πάνω κλώνο (κωδικό) στις αλληλουχίες Ι και ΙΙΙ που μας έχουν δοθεί και αντιστοιχούν σε τμήμα του 1ου εξωνίου του γονιδίου β της HbA. Αρα το mRNA μόριο που θα προκύψει από την μεταγραφή του γονιδίου β΄(αλληλουχία ΙΙ) δεν θα είναι δυνατόν να μεταφραστεί.

Δ3

α) Η θέση έναρξη της αντιγραφής βρίσκεται στην θέση Υ

β) Συνεχώς αντιγράφεται η αλυσίδα Α.

Ασυνεχώς Αντιγράφεται η αλυσίδα Β.

γ) Το πρωταρχικό τμήμα iii (5’ΑCGCCA3’) συντίθεται πρώτο.

Δ4

Γνωρίζουμε ότι τα άτομα που φέρουν ένα φυσιολογικό β αλληλόμορφο του γονιδίου β που κωδικοποιεί για την πολυπεπετιδικη αλυσίδα β της HbA και ένα παθολογικό υπολειπόμενο β’ ονομάζονται φορείς της ασθένειας της β θαλασσαιμιας και είναι φαινοτυπικά υγιείς σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Επίσης, ετερόζυγα άτομα με γονότυπο ββς , είναι φορείς της δρεπανοκυτταρικής αναιμίας και είναι φαινοτυπικα υγειή άτομα σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Η β-θαλασσαιμία, όπως και η δρεπανοκυτταρική αναιμία είναι δύο ασθένειες που ελέγχονται από το ίδιο γενετικό τόπο που εδράζεται σε αυτοσωμικό χρωμόσωμα. Η κάθε μία από τις παραπάνω ασθένειες είναι υπολειπόμενες (χαμηλά υψόμετρα) και ελέγχονται από διαφορετικά παθολογικά αλληλόμορφα του γονιδίου β που ευθύνεται για την σύνθεση των φυσιολογικών β-αλυσίδων της ΗbA.

Έστω λοιπόν ο γενετικός τόπος ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων όπου εδράζεται το γονίδιο β με πολλαπλά αλληλόμορφα (πάνω από 300). Το γονίδιο β είναι φυσιολογικό και επικρατεί έναντι των παθολογικών υπολειπόμενων αλληλόμορφων του β’ και του βς. Το αλληλόμορφο β ελέγχει την σύνθεση της φυσιολογικής β πολυπεπτιδικής αλυσίδας της ΗbA, το παθολογικό υπολειπόμενο αλληλόμορφο β’ ελέγχει για την παντελή έλλειψη παραγωγής της β αλυσίδας της ΗbA ή για την μειωμένη παραγωγή της, ενώ το παθολογικό υπολειπόμενο βς ελέγχει για την σύνθεση των βς αλυσίδων της ΗbS που προκαλεί την δρεπανοκυταρική αναιμία. Το αλληλόμορφο β’ ευθύνεται για την β-θαλασσαιμία.

Δηλαδή άτομα με γονότυπο ββ είναι υγιή, άτομα με γονότυπο ββς και ββ’ είναι υγιή και ετερόζυγα (φορείς) της δρεπανοκυτταρικής αναιμίας και την β-θαλασσαιμία αντίστοιχα. Τέλος άτομα με το γονότυπο β΄βς νοσούν από μικροδρεπανοκυτταρική αναιμία και άτομα με γονότυπο β’β’ νοσούν από β- θαλασσαιμία

Έχουμε λοιπόν την διασταυρώση :

P: ββ’ x ββς

Γαμέτες : β, β΄ / β, βς

Oι γαμέτες προκύπτουν σύμφωνα με τον 10 νόμο Mendel δηλαδή το νόμο του διαχωρισμού των αλληλόμορφων γονιδίων, σύμφωνα με τον οποίο τα αλληλόμορφα ενός γονιδίου διαχωρίζονται κατά την πρώτη μειωτική διαίρεση και κατανέμονται τυχαία αλλά ισοπίθανα στους γαμέτες. Η γονιμοποίηση είναι τυχαίο γεγονός.

F1 : Οι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών και του τρόπου συνδυασμού τους σε μία διασταύρωση.

F1 :

γαμέτες/ γαμέτες

β

β΄

β

ββ

ββ’

βς

ββς

βςβ’

Γονοτυπική αναλογία F1 : ββ : ββ’ : ββς : βςβ’

Δηλαδή από την διασταύρωση αυτή προκύπτουν είτε άτομα με γονότυπο ββ είτε με ββ’ είτε με ββς είτε άτομο που φέρει και τα δύο παθολογικά αλληλόμορφα.

Από τον ιστότοπο βιολογίας: www.nikimargariti.com.

Βιολογία Ομάδας Θετικού Προσανατολισμού Πανελλήνιες Εξετάσεις 2016

Για καλούς λύτες;

 

Η Βιολογία Ομάδας θετικού Προσανατολισμού, όπως ακριβώς όφειλε ως το μάθημα με τον υψηλότερο συντελεστή (1,3), που καθορίζει το 1/3 (33%) της συνολικής βαθμολογίας του υποψηφίου για τα τμήματα της τριτοβάθμιας εκπαίδευσης των επιστήμων ζωής, μεταξύ των οποίων συγκαταλέγονται και οι περιζήτητες Ιατρικές σχόλες, φαίνεται ότι αποτέλεσε φέτος το φίλτρο επιλογής για τους φετινούς υποψηφίους, που από τον Σεπτέμβριο θα καθίσουν στα έδρανα των αμφιθεάτρων των ιατρικών σχολών.

Ωστόσο, και φέτος τα θέματα δεν στερούνταν δυστυχώς αστοχιών και προχειρότητας.

Πράγματι, αν προσέξουμε τα θέματα, έχουμε:

Θέμα Α. Ερώτημα Α3:

Τα σωματικά κύτταρα του προβάτου Dolly περιείχαν:

α. ανασυνδυασμένο DNA

β. Το σύνολο του γενετικού υλικού του κυττάρου του μαστικού αδένα εξάχρονου προβάτου που χρησιμοποιήθηκε στη διαδικασία της κλωνοποίησης.

γ. το γονίδιο που είναι υπεύθυνο για την σύνθεση  της α1-αντιθρυψίνης

δ. το μιτοχονδριακό DNA του ωαρίου στο οποίο τοποθετήθηκε ο πυρήνας του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το κεφάλαιο 9, την διαδικασία κλωνοποίησης, και τον ορισμό και την δημιουργία διαγονιδιακών ζώων.

Από το κεφάλαιο 1 ότι τα μιτοχόνδρια είναι μητρικής προέλευσης.

Από το κεφάλαιο 4 τον ορισμό του ανασυνδυασμένου DNA.

Θα έπρεπε όμως, να γνωρίζει την θέση των μιτοχονδρίων στα κύτταρα και ποια κύτταρα διαθέτουν μιτοχόνδρια, γνώσεις που απέκτησε από την Β’ λυκείου.!

Όμως στην σελίδα 149 του σχολικού βιβλίου της Β’ λυκείου, υπάρχει το ένθετο με τίτλο ΝΤΟΛΥ. Το ένθετο αυτό στην τελευταία παράγραφο του αναφέρει:” Το μητρικό πρόβατο είχε αποκτήσει με την βοήθεια της Γενετικής Μηχανικής , την ιδιότητα να παράγει γάλα με ινσουλίνη. Η ιδιότητα αυτή πέρασε φυσικά και στην κόρη της την Ντόλυ.”

Ποια είναι λοιπόν η σωστή απάντηση που πρέπει να επιλέξει ο μαθητής, η α ή η δ; Μήπως είναι και τα δυο;

Ένας μαθητής οφείλει να γνωρίζει από την Β’ λυκείου που βρίσκονται τα μιτοχόνδρια ώστε μπορεί να αποκλείσει το β, άλλα δεν πρέπει να γνωρίζει τι λέει το σχολικό βιβλίο της β’ λυκείου για την Ντόλυ;;;

Θέμα Β. Ερώτημα Β1:

DNA δεσμάση:

Α. δημιουργία φωσφοδιεστερικών δεσμών;

Β. διασπάση φωσφοδιεστερικών δεσμών;

Γ. ούτε Α ούτε Β

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Την αναφορά του σχολικού βιβλίου στο συγκεκριμένο ένζυμο, στο δεύτερο και στο τέταρτο κεφάλαιο (δεν αναφέρεται πουθενά αλλού στο σχολικό της τρίτης λυκείου, ούτε και σε άλλο σχολικό βιβλίο μικρότερων τάξεων).

Όμως, από αυτές τις αναφορές ο μαθητής δεν μπορεί να συμπεράνει ποια είναι η δράση της δεσμάσης και τι είδους δεσμούς δημιουργεί!!!

Επομένως ποια είναι η σωστή αντιστοίχηση, με το Α που είναι πράγματι το επιστημονικώς ορθο, το οποίο όμως, πως θα το εξάγει ο μαθητής από το σχολικό βιβλίο; Ή μήπως σωστή, πρέπει να θεωρηθεί και η Γ, αφού δεν μπορεί να γνωρίζει αν συγκεκριμένα δημιουργεί φωσφοδιεστερικούς δεσμούς?

Είναι ιδιαιτέρως αξιοπρόσεκτο δε, το γεγονός ότι,στα θέματα του 2015 στο τρίτο θέμα που αφορούσε τα ένζυμα της αντιγραφής που δρούν στο σημείο σύνδεσης του πρωταρχικού τμήματος που αντικαταστάθηκε με δεοξυνουκλεοτίδια, με το τμήμα DNA του θυγατρικού κλώνου, το οποίο δημιούργησε η DNA πολυμεράση ως προϊόν επιμήκυνσης νωρίτερα αυτού του πρωταρχικού τμήματος, η περυσινή ΚΕΕ δεν ζητούσε και την δεσμάση!

Φέτος όμως ,η ΚΕΕ απαιτεί να γνωρίζει ο μαθητής τι είδους δεσμούς δημιουργεί η δεσμάση!!!! Πόσο άραγε θα έχουν μπερδευτεί τα παιδιά που ξαναδίνουν φέτος;;;;

Δηλαδή, πέρυσι η ΚΕΕ εκτίμησε ότι ο μαθητής δεν μπορεί να συνάγει τον ρόλο της δεσμάσης από το σχολικό βιβλίο, αλλά φέτος με το ίδιο ακριβώς σχολικό βιβλίο πιστεύει ότι ο μαθητής μπορεί να το συνάγει!!

Ερώτημα Β2: Τι είναι ο καρύοτυπος; Να αναφέρετε δυο (2) συμπεράσματα που μπορούν να εξαχθούν από την μελέτη του καρυοτύπου ενός ανθρώπου.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το πρώτο κεφάλαιο την διαδικασία δημιουργίας του καρυοτύπου (για να ξέρει ότι τα χρωμοσώματα είναι μεταφασικά και την διαζώνωση με την χρώση Giemsa), τον ορισμό του καρυοτύπου, την αναφορά του σχολικού βιβλίου στα αυτοσωμικά και φυλετικά χρωμοσώματα του ανθρώπου.

Από το έκτο κεφάλαιο, τις δυνατότητες διάγνωσης των αριθμητικών και των δομικών χρωμοσωμικών ανωμαλιών, τόσο στα τμήματα του βιβλίου που αναφέρονται οι μεταλλάξεις αυτές όσο και στο ειδικότερο τμήμα του σχολικού βιβλίου στο έκτο κεφάλαιο που αναφέρετε στις διαγνωστικές τεχνικές και στον προγενετικό έλεγχο. Επίσης θα έπρεπε (ή μήπως και να μην έπρεπε ; ) να έχει μελετήσει τον πινάκα 6.1 του σχολικού βιβλίου.

Από τα παραπάνω και δεδομένης της ασάφειας της εκφώνησης του ερωτήματος, ο μαθητής μπορεί να αναφέρει διάφορους συδυασμούς από δυο συμπεράσματα που μπορούν να εξαχθούν από την μελέτη του καρυοτύπου του ανθρώπου. Ας ελπίσουμε ότι η σωστή απάντηση δεν είναι ο μαναδικός συνδυασμός που σκέφτηκε η ΚΕΕ.

Αξίζει και εδώ να παρατηρήσουμε , όπως και στην περίπτωση της δεσμάσης, την έλλειψη πρωτοτυπίας του θέματος που αφορά τον καρυύτυπο, με το περυσινό τέταρτο ζήτημα στις πανελλήνιες του 2015 που αφορούσε και πάλι τον καρυότυπο. Αλλά και εδώ, όπως και στην δεσμάση, τα φετινά ζητούμενα αναιρούν τα περυσινά ζητούμενα σε σχέση με τον καρυότυπο όπως και στην περίπτωση της δεσμάσης.

Πιο συγκεκριμένα:

Πέρυσι η ΚΕΕ θεωρούσε δεδομένο από την εκφώνηση στο Δ1 ότι είναι δομική μετάλλαξη η ανάστροφη λιγότερων από δέκα νουκλεοτιδίων (ερχόμενη σε πλήρη αντίθεση τον ορισμό του βιβλίου)!!! Και ζητούσε από τα παιδιά να γράψουν ως σωστή απάντηση (και την δεχόταν ως σωστή!) ότι είναι δυνατή η παρατήρηση αυτής της μετάλλαξης στον καρυότυπο, όταν το σχολικό βιβλίο αναφέρει ότι τα νουκλεοσώματα που αποτελούνται από 146 ζεύγη βάσεων παρατηρούνται μόνο στο ηλεκτρονικό μικροσκόπιο και ότι ο καρυότυπος παρατηρείται στο οπτικό μικροσκόπιο!!!!

Η εκφώνηση δε, τουΔ4 το 2015 έλεγε:”Να εξηγήσετε το είδος ή τα είδη των δομικών χρωμοσωμικών ανωμαλιών, που σίγουρα θα έχει κάθε απόγονος με μη φυσιολογικό καρυότυπο”.

Εν ολίγης, ο μαθητής πέρυσι την ώρα των εξετάσεων  “έμαθε” ότι οι ανάστροφες τμημάτων DNA μεγέθους μικρότερου των 10 ζευγών βάσεων οδηγούν σε μη φυσιολογικό καρυότυπο και άρα παρατηρούνται στον καρυότυπο!!!

Εάν φέτος ο ίδιος μαθητής ξαναδίνει πανελλήνιες εξετάσεις και γράψει αυτό που “ έμαθε” πέρυσι θα θεωρηθεί σωστό από την ΚΕΕ και αν όχι, γιατί;

Σημείωση: Το πρόβλημα του μεγέθους των γονιδίων και των μεγάλων αλληλουχιών, μπορεί πολύ εύκολα να αντιμετωπιστεί με την ενδιάμεση  ύπαρξη, … , όπως χρησιμοποιήθηκε φέτος για την 5′ αμετάφραστη περιοχή, όχι όμως για το γονίδιο, το οποίο φυσικά δεν μπορεί να είναι τόσο μικρό  όσο δόθηκε. Ευτυχώς πάντως που χρησιμοποιήθηκε τουλάχιστον για την 5′ αμετάφραστη, ώστε να μην υπάρξουν τα προβλήματα που εμφάνιζε το Δ θέμα το 2014 με την 5′ αμετάφραστη περιοχή των 4 νουκλεοτιδίων στο mRNA, στο οποίο μάλιστα μπορούσε να συνδεθεί το ριβόσωμα κατά την ΚΕΕ!

Θέμα Γ. Ερώτημα Γ1: Να γράψετε στο τετράδιο  σας τον γονότυπο του ατόμου Ι 1 που βρίσκεται  στο γενεαλογικό δένδρο 1 και να αιτιολογήσετε την απάντησή σας.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Στο πέμπτο κεφάλαιο, την αναφορά του σχολικού βιβλίου για τις  ομάδες αίματος, τον πρώτο νόμο του Μέντελ, και την αναφορά του βιβλίου για τα γενεαλογικά δένδρα.

Σύμφωνα με αυτές τις γνώσεις αυτές και με βάση τα δεδομένα του γενεαλογικού δένδρου που δόθηκε, δεν υπάρχει μόνο ένας γονότυπος για το άτομο Ι1 αλλά δύο! Ποια είναι λοιπόν η σωστή απάντηση;

Η εύκολη λύση είναι όλα σωστά, αδικώντας τους μαθητές που βρήκαν και τις δυο λύσεις! Όμως σε διαφορετική περίπτωση αδικούν τους μαθητές που βρήκαν και τους δυο τρόπους άλλα έγραψαν μόνο τον ένα, αφού έναν τους ζητάει η εκφώνηση.

Η πιο σωστή λύση είναι να είναι απλώς ορθά διατυπωμένη η ερώτηση για να μην προκύπτουν τέτοια ζητήματα.

Ερώτημα Γ5: “ Βρέθηκε ότι στελέχη … αυτές οι μεταλλάξεις”.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Την αναφορά του σχολικού βιβλίου της Γ’ λυκείου στο δεύτερο κεφάλαιο, για την δομή και την λειτουργιά του οπερονίου.

Ακόμη από το δεύτερο κεφάλαιο την διαδικασία της μεταγραφής.

Επίσης από το έκτο κεφάλαιο τον ορισμό των μεταλλάξεων, τα είδη των μεταλλάξεων και ειδικότερα τις επιπτώσεις των γονιδιακών μεταλλάξεων στα γονίδια και στα προϊόντα τους.

Σύμφωνα με αυτές τις γνώσεις τις οποίες υποτίθεται ότι είναι οι μόνες που μπορεί να έχει και στις οποίες εξετάζεται, ο μαθητής ,εξάγει ότι οι μεταλλάξεις είναι τυχαία γεγονότα, που συμβαίνουν χωρίς σκοπιμότητα και οδηγούν σε απρόβλεπτα αποτελέσματα τόσο για το DNA, όσο και κατ΄ επέκταση για το γονιδιακό προϊόν των μεταλλαγμένων γονιδίων, άρα και για το κύτταρο. Επιπρόσθετα, συνάγει  ότι καθορισμένες αλληλουχίες DNA (π.χ υποκινητές) εμφανίζουν συγγένεια με κατάλληλες πρωτεΐνες (π.χ. μεταγραφικοί παράγοντες, καταστολέας οπερονίου). Αντιλαμβάνεται λοιπόν ο μαθητής, ότι αλλαγές είτε στην αλληλουχία του DNA,  είτε στην στερεοδιάταξη της κατάλληλης πρωτεΐνης δεν επιτρέπουν την σύνδεση της πρωτεΐνης με το DNA.

Επομένως, ανεξάρτητα από τον πραγματικό ορθό τρόπο λειτουργίας του οπερονίου της λακτόζης στο E.coli, ο οποίος δεν περιγράφεται  εξάλλου με λεπτομέρειες στο σχολικό, ο μαθητής μπορεί να υποθέσει διάφορες πιθανές περιπτώσεις που μπορούν να έχουν συμβεί και δεν εκφράζεται το οπερόνιο της λακτόζης στα δεδομένα στελέχη του βακτηρίου.

Ποιές θα θεωρηθούν σωστές και με ποια κριτήρια;

Οι “σωστές” απαντήσεις είναι άραγε μόνο όσες σκέφτηκαν οι θεματοδότες και ο λύτης; Αν είναι έτσι, πρέπει κάνεις να αναρωτηθεί αν στο μάθημα της Βιολογίας (δυστυχώς, όχι μόνο φέτος) τα παιδιά εξετάζονται πράγματι στη Βιολογία που διδάσκονται στο σχολείο (μόνο στην Γ ‘ Λυκείου;) ή μήπως στην μαντική τέχνη;

Σημείωση: Για την δομή του οπερονίου αξίζει κάνεις να προσέξει το κείμενο του βιβλίου, άλλα και την περίληψη του βιβλίου στο σημείο αυτό.

Θέμα Δ. Ερώτημα Δ3: Να γράψετε την αλληλουχία των βάσεων του mRNA, θα χρησιμοποιηθεί κατά την μετάφραση της πληροφορίας, του γονιδίου της εικόνας 2.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το δεύτερο καφάλαιο την διαδικασία της μεταγραφής, της ωρίμανσης και της μετάφρασης των γονιδίων των ευκαρυώτικων οργανισμών.

Σύμφωνα λοιπόν με τα παραπάνω και με δεδομένη την εκφώνηση της ερώτησης, που ζητάει το τμήμα του μορίου του ωρίμου mRNA που θα χρησιμοποιηθεί κατά την μετάφραση της πληροφορίας του γονιδίου που δόθηκε, η απάντηση που πρέπει να δώσει ο μαθητής είναι: Το ώριμο mRNA μέχρι και το κωδικόνιο λήξης ,εκτός της  υπόλοιπης 3′ αμετάφραστης περιοχής καθώς το σχολικό βιβλίο αλλα ούτε και κάποιο άλλο σχολικό βιβλίο βιολογίας προηγούμενων τάξεων, αναφέρει τον ρόλο της 3′ αμετάφραστης περιοχής του mRNA. Επομενως ο μαθητής προκείμενου να αποφύγει το λάθος να γράψει κάτι που δεν ξέρει αν χρησιμοποιείται στην μετάφραση, μπορεί να επιλέξει να μην το γράψει μόνο και μόνο για να είναι σύμφωνος με ότι τον ερωτάνε.

Ποια είναι λοιπόν η σωστή απάντηση; Αυτή που προκύπτει σύμφωνα με όσα αναλύθηκαν παραπάνω ή απλώς η σωστή απάντηση είναι για μια ακόμη άφορα αυτή και μόνο αυτή που σκέφτηκε ο λύτης των θεμάτων, πριν αυτά δοθούν στους μαθητές;

Ερώτημα Δ5: Στην εικόνα 4…ii) θέση 2.

Για να απαντησει ο μαθητης πρεπει να γνωριζει:

Από το πρώτο κεφάλαιο τον προσανατολισμό των πολυνουκλεοτιδικών αλυσίδων καθώς και την αντιπαραλληλία των δύο κλώνων ενός δίκλωνου μορίου νουκλεϊκών οξέων.

Από το δεύτερο κεφάλαιο τις διαδικασίες της μεταγραφής, της μετάφρασης  καθώς και τις ιδιότητες του γενετικού κώδικα.

Από το έκτο κεφάλαιο τον ορισμό της μετάλλαξης, την διάκριση των μεταλλάξεων αναλόγως του μεγέθους της αλλαγής, ειδικότερα τις γονιδιακές μεταλλάξεις και τις πιθανές αλλαγές που προκαλούν,  τόσο στο μόριο του  DNA όσο και κατά συνεπεία στα προϊόντα της μεταγραφής και πιθανόν της μετάφρασης.

Σύμφωνα λοιπόν με το παραπάνω περιεχόμενο του σχολικού βιβλίου και με βάση τα δεδομένα της εκφώνησης του ερωτήματος, ο μαθητής μπορεί να υποθέσει δυο πιθανούς τρόπους ένθεσης της τριπλέτας (με ποιο μηχανισμό έγινε δυνατή η ένθεση; αυτό δεν αναφέρεται σε κανένα σημείο του σχολικού βιβλίου βιολογίας) που δίνεται, δηλαδή είτε όπως δίνεται είτε ανεστραμμένη  (κατά 180 μοίρες).

Ως προς το αποτέλεσμα της μεταλλαγής, πρέπει να αναφερθεί ο μαθητής τόσο στην αλλαγή στο DNA, όσο και στα παραγόμενα προϊόντα κάθε φορά (μετάλλαξη), εφόσον δεν προσδιορίζεται από την εκφώνηση η έννοια του αποτελέσματος , αν αφορά μόνο το γενετικό υλικό ή και το προϊόν του μεταλλαγμένου γονιδίου. Φυσικά, αναλόγως του τρόπου ένθεσης της τριπλέτας θα έχουμε διαφορετικά αποτελέσματα.

Συνεπώς, η διατύπωση του ερωτήματος άφηνε πολλές εκδοχές, όπου ένας καλά προετοιμασμένος μαθητής που θα τις σκεφτόταν, και θα ήθελε να τις γράψει δεν είναι βέβαιο ότι θα πραλάβαινε στον δεδομένο χρόνο. Αν αυτός  μαθητής ιεραρχούσε την σειρά των απαντήσεων του σε αυτό το ερώτημα, με τέτοιο τρόπο, που δεν προλαβαινε να γράψει την απάντηση που δόθηκε από τον θεματοδότη και τον λύτη?

Καταλήγοντας λοιπόν σε αυτόν τον σχολιασμό των θεμάτων της Βιολογίας Ομάδας Θετικού Προσανατολισμού 2016, μπορούμε να πούμε ότι τα φετινά θέματα θα επιτρέψουν πιθανόν, αλλά και δικαίως, στο μάθημα της Βιολογίας, όπως αρμόζει άλλωστε, να καθορίζει την διάκριση των υποψηφίων στην εισαγωγή τους στις σχόλες του πεδίου των Επιστήμων Ζωής, αφού αυτό είναι έτσι και αλλιώς το αντικείμενο μελέτης αυτών των σχολών όπως η Ιατρική, το Βιολογικό κ.ά.

[ Αποτελεί Παγκόσμια πρωτοτυπία να εισάγονται μαθητές στα βιολογικά τμήματα χωρίς να έχουν διδαχθεί Βιολογία και να μην εισάγονται μαθητές στα χημικά τμήματα ενώ έχουν διδαχθεί την ίδια ακριβώς ύλη χημείας με αυτούς που έχουν την δυνατότητα να εισαχθούν!]

Όμως η προχειρότητα και οι αστοχίες στην διατύπωση των θεμάτων, περιορίζουν την αντικειμενική βαθμολόγηση, μειώνοντας σημαντικά την διακριτική ικανότητα των θεμάτων να ξεχωρίσουν τους άριστους από τους κάλους και τους κάλους από τους μέτριους με τρόπο αντικειμενικό, ειδικότερα όταν οι ενδεικτικές απαντήσεις της ΚΕΕ είναι οι μόνες σωστές και η φράση “ κάθε απάντηση επιστημονικά τεκμηριωμένη θεωρείται σωστή” έχει περιορισμένη χρήση και άξια.

Τα θέματα, ενώ πρέπει να βγαίνουν μέσα από την εξεταστέα ύλη του [ή μήπως των σχολικών βιβλίων  και των προηγούμενων τάξεων, όπως στην Φυσικη και την έκθεση φέτος, αλλά και στην Χημεία γενικότερα (δεν ορίζεται στην γ’ λυκείου η έννοια του mol, αλλά στην α’ λυκείου) ; ] σχολικού βιβλίου και να είναι ορθώς διατυπωμένα με σαφήνεια και ακρίβεια δηλαδή να είναι ορθά επιστημονικώς όσο και φιλολογικά, θα πρέπει να απαιτούν κριτική σκέψη με αναλυτική και συνθετική ικανότητα από τους μαθητές, ακόμη πρέπει να έχουν διαβαθμισμένη δυσκολία, αλλά και οι απαντήσεις των μαθητών να κρίνονται μέσα στα πλαίσια που επιτρέπει το σχολικό βιβλίο σε συνδυασμό με την  γνώση που έχει αποκτήσει ο μαθητής από τις προηγούμενες τάξεις, άλλα και φυσικά κάθε επιστημονικά τεκμηριωμένη απάντηση που ξεφεύγει από το σχολικό βιβλίο να λαμβάνεται ως ορθή, εφόσον είναι πράγματι ορθή.

‘Ομως και οι διορθωτές για να κρίνουν την ορθότητα μια απάντησης ενός μαθητή που ξεφεύγει από τις ενδεικτικές απαντήσεις της ΚΕΕ και την αυτούσια αναπαραγωγή των λεγομένων του σχολικού βιβλίου,  πρέπει να γνωρίζουν Βιολογία (όχι αυστηρά μόνο του λυκείου) καλύτερα από τον διαγωνιζόμενο!

‘Ενας διάγωνιζόμενος, είναι αρκετά πιθανό να είναι πρωτοετής φοιτητής του Βιολογικου τμήματος ή της Φαρμακευτικης ή της Γεωπονικης ή της Κτηνιατρικης κ.ά.  και ενώ  παρακολούθησε τη σχολή και έδωσε μαθήματα στην εξεταστική του χειμερινού α’ εξαμήνου ίσως και ορισμένα του εαρινού εξαμήνου (άρα διδάχθηκε και διάβασε Βιολογία από πανεπιστημιακούς δασκάλους και πανεπιστημιακά συγγράματα), αποφάσισε να ξαναδώσει  πανελλήνιες, πιθανόν για να περάσει στην  Ιατρική ή σε άλλη πόλη. Αυτός ο διαγωνιζόμενος λοιπόν, κινδυνεύει να μην επιτύχει το στόχο του ούτε την δεύτερη φορά, επειδή παρακολούθησε Βιολογία στο πανεπιστήμιο;

Και τα μέλη της ΚΕΕ, πρέπει να αναλαμβάνουν την ευθύνη των θεμάτων και των λύσεων τους με γνωστοποίηση των ονομάτων τους μετά το πέρας των εξετάσεων.

Οι πανελλήνιες είναι εν πολλοίς, αδιάβλητες είναι όμως και αδιαφανείς.

Εν όψη των αλλαγών που αυτόν τον καιρό, προτείνονται για την εισαγωγή στην τριτιβαθμια εκπαίδευση, τίποτα από τα παραπάνω δεν ακυρώνεται. Θα πρέπει να διαμορφωθεί ένα σύστημα αξιοκρατικό, δίκαιο, διαφάνες αυτή τη φορά, το οποίο θα συνεχίζει να είναι αδιάβλητο και θα μπορεί να Ελεγχεται σε κάθε του στάδιο.

Βιολογία Θετικής Κατεύθυνσης θέματα πανελλήνιων εξετάσεων 2015 ασάφειες και προβληματισμοί!

Τα φετινά θέματα της βιολογίας κατεύθυνσης θα πρέπει να χαρακτηριστούν διαφορετικής προσέγγισης, από τα θέματα που μέχρι πρότινος είχαμε συνηθίσει να βλέπουμε στις πανελλήνιες εξετάσεις στο συγκεκριμένο μάθημα.

Είναι αξιοπρόσεκτη η προσπάθεια των θεματοδότων, να μην επαναληφθούν, σε γενικές γραμμές, τα θέματα σχεδόν όλων των προηγούμενων ετών, που δεν υπήρχε σχεδόν ποτέ καμιά πρωτοτυπία στο Θέμα Γ και Δ. Στα θέματα εκείνα βλέπαμε μια επανάληψη ασκήσεων του 2ου κεφαλαίου (εύρεση κωδικής και μη κωδικής αλυσίδας ενός γονιδίου που κωδικοποιεί για mRNA) και μια άσκηση από το 5ο κεφάλαιο (σχεδόν πάντα αυτοσωμικό υπολειπόμενο χαρακτηριστικό). Επιπλέον φέτος, όπως και πέρυσι, υπάρχει εμφανείς διάθεση στο Θέμα Β να περιορίσουν την έκταση των θεμάτων που απαιτούν απλή ανάκληση αυτούσιων αποσπασμάτων του σχολικού βιβλίου.

Η προσπάθεια αυτή αναμφίβολα είναι ένα πολύ θετικό βήμα για τον τρόπο με τον οποίο άρχισε επιτέλους να αντιμετωπίζεται ενα απολύτως θετικό επιστημονικό αντικείμενο όπως είναι η Βιολογία. Καιρός ήταν πια να αρχίσει να παίρνει η Βιολογία την θέση που της αρμόζει και να απαλλαγεί από τον χαρακτηρισμό ενός μαθήματος » που μαθαίνει ο μαθητής το βιβλίο απέξω και γραφεί» όπως είναι ατυχώς η άποψη πολλών καθηγητών και μαθητών.

Ωστόσο δεν έλειψε και εφέτος η προχειρότητα με την οποία διατυπώθηκαν τα ερωτήματα, με αποτέλεσμα να δημιουργηθούν και πάλι (όπως και στο περυσινό θέμα Δ) προβλήματα σύγχυσης και πιθανών παρανοήσεων από τους μαθητές της θετικής κατεύθυνσης που κλήθηκαν να τα απαντήσουν.

Αξίζει δε να προσεχθεί, ότι τέτοια φαινόμενα σύγχυσης και προβληματισμού εμφανίζονται κυρίως στους λεγάμενους κάλους μαθητές, σε εκείνους που έχουν μοχθήσει ειλικρινώς ολόκληρη τη σχολική χρονιά και όχι απαραίτητα μόνο στην γ΄ λυκείου για να κατανοήσουν και να εμπεδώσουν την Βιολογία του λυκείου – και όχι μόνο του λυκείου πολλές φορές-. οι μαθητές αυτοί που διαβάζουν με μεγάλη προσοχή την κάθε ερώτηση και παρατηρούν κάθε λέξη και το νόημα της πρότασης που σχηματίζεται, μπορεί να βρεθούν σε δίλημμα για το τι ακριβώς ζητείται από ένα ερώτημα, αν αυτό δεν είναι διατυπωμένο με προσοχή ώστε να γίνεται σαφές και ακριβές, στο ποιο είναι το ζητούμενο στο οποίο καλείται να εξεταστεί ο μαθητής .

Δυστυχώς και φέτος τα θέματα της Βιολογίας θετικής κατεύθυνσης δεν ήταν απαλλαγμένα από αυτή την έλλειψη ακρίβειας και σαφήνειας στην διατύπωση των δεδομένων και των ερωτημάτων που τα ακολουθούσαν.

Προκειμένου να προλάβω ορισμένους αναγνώστες, θα ήθελα να επισημάνω οτι θέματα όπως τα φετινά  (θεμα Γ και Δ, χωρίς ασάφειες και προβληματισμούς) έχω συμπεριλάβει απο το 2007 στο βιβλίο μου κριτήρια αξιολόγησης για την βιολογία θετικής κατευθύνσης εκδόσεις Λιβάνη.

Πιο συγκεκριμένα όσον αφορά τα προβλήματα που παρουσίασαν τα φετινά θέματα:

Θέμα Β1

Στήλη Ι: Πρόταση 6: «οι μεταλλάξεις στο DNA δεν κληρονομούνται στην επόμενη γενιά.»

Παρατήρηση: Αναφέρεται άραγε η πρόταση στην επόμενη γενεά οργανισμών (πολυκύτταρων, αμφιγονικά αναπαραγόμενων) ή στην επόμενη γενεά κυττάρων ενός πολυκύτταρου οργανισμού (προϊόντα μίτωσης);

Στήλη Ι: Πρόταση 8: » Οι μεταλλάξεις στο DNA τους κληρονομούνται στην επόμενη γενιά.»

Παρατήρηση : Αναφέρεται άραγε και εδώ στην επόμενη γενεά οργανισμών όπως παραπάνω η πρόταση 6 ή στην επόμενη γενεά κυττάρων προϊόντων της κυτταρικής διαίρεσης;

Είναι φανερό πως αναλόγως με την ερμηνεία που δίνεται κάθε φορά σε κάθε πρόταση η απάντηση που κρίνεται ως σωστή είναι διαφορετική. Για παράδειγμα στην πρόταση 6 εάν αυτή ερμηνευθεί ως επόμενη γενεά οργανισμών τότε η σωστή απάντηση είναι η αντιστοίχηση της με την στήλη ΙΙ Α: Σωματικά κύτταρα. Εάν όμως θεωρηθεί ως : Επόμενη γενεά κυττάρων, η σωστή αντιστοίχιση της είναι στην στήλη ΙΙ Β: Γαμέτες, καθώς γνωρίζουμε ότι οι γαμέτες είναι τα τελικά προϊόντα της μείωσης και δεν υφίστανται οι ίδιοι καμιά κυτταρική διαίρεση. Ομοίως προβληματίζει και η πρόταση 8.

ΘΕΜΑ Γ1.

– «Να ονομάσετε τη διαδικασία που βρίσκεται σε εξέλιξη».

Μπορούμε να υποθέσουμε ότι η διαδικασία αυτή είναι η αντιγραφή. Εδώ κάποιος μαθητής μπορεί να αναρωτηθεί αν η διαδικασία που απεικονίζεται είναι in vivo σε ζωντανό κύτταρο ή in vitro για παράδειγμα, σε εκχύλισμα κυττάρων προκαρυωτικού ή ευκαρυωτικού κυττάρου (διαφορά στον βαθμό ικανότητας επιδιόρθωσης, όπως προκύπτει από το σχολικό βιβλίο –« Τα λάθη που δεν επιδιορθώνονται από τις DNA πολυμεράσες επιδιορθώνονται σε μεγάλο ποσοστό από ειδικά επιδιορθωτικά ένζυμα. Έτσι ο αριθμός των λαθών περιορίζεται στους ευκαρυωτικούς οργανισμούς στο ένα στα 1010» σελ. 30). Ο όρος εκχύλισμα ορίζεται στην άσκηση 10 του σχολικού βιβλίου, σελ. 39.

– «Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1».

Εδώ, απαιτείται διερεύνηση του όρου τελικό δίκλωνο μόριο.

Το τελικό μόριο ορίζεται πριν ή μετά την αντικατάσταση των ριβονουκλεοτιδίων από τις DNA πολυμεράσες και πριν ή μετά μιας πιθανής επιδιόρθωσης στις κακοζευγαρωμενές βάσεις C=C;

Βεβαίως όλα τα παραπάνω δεχόμενοι ορισμένες παραδοχές:

α. Η διαδικασία που απεικονίζεται στην εικόνα 1 λαμβάνει χώρα in vivo κάτι που δεν γίνεται σαφές από την εκφώνηση. Αν η διαδικασία συνέβαινε σε δοκιμαστικό σωλήνα, τότε δεν είναι απαραίτητο ότι μπορούσαν να συμβούν, η αντικατάσταση των ριβονουκλεοτιδίων από δεοξυνουκλεοτίδια ούτε και η επιδιόρθωση των κακοζευγαρωμένων βάσεων καθώς αυτά εξαρτώνται από τα ένζυμα που είναι διαθέσιμα και την λειτουργικότητα αυτών μέσα στο δοκιμαστικό σωλήνα.

β. Ακόμα και αν η διαδικασία που απεικονίζεται στην εικόνα 1 συμβαίνει σε ζωντανό κύτταρο πρέπει να εξεταστεί αν είναι δυνατή όχι μόνο η απομάκρυνση των ριβονουκλεοτιδίων του πρωταρχικού τμήματος, αλλά και η συμπλήρωση του τμήματος που απέμεινε με δεοξυνουκλεοτίδια, κάτι που σημαίνει ότι το δοθέν τμήμα που αντιγράφεται δεν είναι το 3΄ακρο ενός χρωμοσώματος αλλά ότι είναι τμήμα στο εσωτερικό ενός χρωμοσώματος (τμήμα ασυνεχούς σύνθεσης ή η θέση έναρξης της αντιγραφής στο κλώνο που συντίθεται συνεχώς), το οποίο όμως δεν φαίνεται να προκύπτει το ένα ή το άλλο συμπέρασμα από την εικόνα 1.

Στην περίπτωση που δεχθεί ο μαθητής ότι πρόκειται για 3΄ άκρο ενός χρωμοσώματος (έτσι απεικονίζεται στην εικόνα 1) τότε θα έπρεπε, για μπορέσει να απαντήσει σωστά από επιστημονικής απόψεως, να γνωρίζει την ύπαρξη των τελομερασών για να υποθέσει ότι μπορεί συμπληρωθεί το άκρο του χρωμοσώματος με δεοξυνουκλεοτίδια μετά την απομάκρυνση του πρωταρχικού τμήματος. Στο σχολικό βιβλίο βεβαίως δεν γίνεται κανένας υπαινιγμός για τα τελομερή των χρωμοσωμάτων, αντιθέτως καθίσταται σαφές στο σχολικό βιβλίο ότι οι DNA πολυμεράσες δεν μπορούν να ξεκινήσουν την αντιγραφή ενός κλώνου de novo, δηλαδή χωρίς την ύπαρξη προϋπάρχοντος ελεύθερου 3΄ακρο στο νεοσυντιθέμενο κλώνο.

Σχολικό βιβλίο σελ. 28 και 30 «Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA  ονομάζονται DNA πολυμερασες. Επειδή τα ένζυμα αυτά δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποιο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. Ένα είδος DNA πολυμεράσης επιμηκύνει τα πρωταρχικά τμήματα,… . Ταυτόχρονα ένα άλλο είδος DNA πολυμεράσης απομακρύνει τα πρωταρχικά τμήματα RNA και τα αντικαθιστά με τμήματα DNA.» και «Οι DNA πολυμεράσες λειτουργούν μόνο προς καθορισμένη κατεύθυνση και τοποθετούν τα νουκλεοτίδια στο ελεύθερο 3΄ακρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου κάθε αναπτυσσόμενης αλυσίδας».

ΘΕΜΑ Γ2.

– «Να ονομάσετε τα ένζυμα που είναι απαραίτητα για τη δημιουργία του τελικού δίκλωνου μορίου του ερωτήματος Γ1 και να αναφέρετε τη δράση του κάθε ενζύμου.»

Εδώ και πάλι απαιτείται ερμηνεία του όρου για τη δημιουργία του τελικού δίκλωνου μορίου, υποθέτοντας την in vivo αντιγραφή και όχι την in vitro έτσι αυθαίρετα, καθώς δεν προκύπτει με οποιοδήποτε τρόπο από τα θέματα ότι πράγματι είναι in vivo διαδικασία.

α. Η δημιουργία του τελικού δίκλωνου μορίου αναφέρεται από την στιγμή που παρουσιάζεται στην εικόνα 1 και μετά; Θεωρούμε δυνατή ή όχι την αντικατάσταση του πρωταρχικού τμήματος από δεοξυνουκλεοτίδια;

Σε αυτή την περίπτωση και θεωρώντας δυνατή την αντικατάσταση του πρωταρχικού τμήματος, θα δράσουν μόνο τα ένζυμα DNA πολυμεράσες (αντικατάσταση πρωταρχικού τμήματος, επιμήκυνση νεοσυντιθέμενου κλώνου DNA και επιδιόρθωση), η DNA δεσμάση, για να συνδέσει την τελευταία θυμίνη (Τ) που αντικατάστησε την τελευταία ουρακίλη (U) του πρωταρχικού τμήματος με την πρώτη θυμίνη (Τ) που φαίνεται στην εικόνα 1 όταν διαβάζουμε τον πάνω κλώνο που δίνεται με προσανατολισμό 5΄–>3΄ από τα αριστερά προς τα δεξιά. Τέλος πιθανόν να δράσουν τα επιδιορθωτικά ένζυμα για το κακοζευγαρώμα που ήδη υπάρχει (C=C) ή για κάποιο άλλο λάθος της αντιγραφής του τμήματος που δίνεται και που μπορεί να συμβεί.

β. Η δημιουργία του τελικού δίκλωνου μορίου, αναφέρεται από την στιγμή της έναρξης της αντιγραφής του μητρικού κλώνου που απεικονίζεται στην εικόνα 1.

Σε αυτή την περίπτωση θα πρέπει να θεωρηθεί ότι θα δράσουν επιπλέον της α. περίπτωσης και τα ένζυμα: DNA ελικάσες για να αποδιατάξουν τους δυο μητρικούς κλώνους, ένας από τους οποίους φαίνεται να αντιγράφεται στην εικόνα 1 και πριμόσωμα που δημιούργησε το πρωταρχικό τμήμα που φαίνεται στην εικόνα 1.

Στην περίπτωση που θεωρηθεί ότι η διαδικασία που απεικονίζεται στην εικόνα 1 λαμβάνει χώρα in vitro, τότε:

Αν συμβαίνει σε κυτταρικό εκχύλισμα και εφόσον θεωρήσουμε ότι η διαδικασία συμβαίνει στο μόριο που φαίνεται στην εικόνα 1 και όχι ότι αυτό δημιουργείται στο εκχύλισμα, τότε εφόσον τα ένζυμα της αντιγραφής των εκχυλιζόμενων κυττάρων είναι όλα πλήρως λειτουργικά (εάν αυτό είναι βεβαίως εφικτό, αναλόγως των συνθηκών δημιουργίας του εκχυλίσματος) τότε τα ένζυμα που θα δράσουν μπορούμε να θεωρήσουμε ότι θα είναι εκείνα που θα είναι και στην in vivo αντιγραφή.

Αξίζει να σημειωθεί πως ένα ερώτημα στο ερώτημα Β στα περυσινά θέματα των Ημερήσιων και Εσπερινών λυκείων της Βιολογίας θετικής κατεύθυνσης εξέταζε τα ένζυμα της αντιγραφής και την δράση τους.

Είναι φανερό από τα παραπάνω ότι η ασάφεια των ερωτημάτων Γ1 και Γ2 δημιουργούσε σύγχυση και έντονο προβληματισμό στους μαθητές. Η επιστημονικώς ορθή απάντηση είναι να πάρει ένας μαθητής όλες τις δυνατές περιπτώσεις και να τις εξετάσει ξεχωριστά. Σε μια τέτοια περίπτωση ο μαθητής θα έρθει αντιμέτωπος με προβλήματα που δεν είναι υποχρεωμένος να γνωρίζει τις απαιτούμενες γνώσεις για να τα απαντήσει (π.χ. τελομέρη) και φυσικά ο χρόνος που έχει στη διάθεση του δεν θα επαρκούσε.

Ποια είναι λοιπόν η σωστή απάντηση για την Επιστήμη της Βιολογίας; Είναι άραγε η απάντηση αυτή και σωστή για τις πανελλήνιες εξετάσεις; Μήπως η σωστή επιστημονικώς απάντηση δεν είναι απαραιτήτως και σωστή για τις πανελλήνιες εξετάσεις ( δεν είναι η πρώτη φορά που συμβαίνει αυτό!) ; Πώς είναι δυνατόν η σωστή για της εξετάσεις απάντηση να μην ταυτίζεται με την ορθή επιστημονικώς απάντηση;

Μήπως απλώς η σωστή απάντηση είναι μόνο η απάντηση που σκεφτήκανε οι θεματοδότες ή μήπως θα πρέπει να θεωρηθεί σωστή οποιαδήποτε απάντησης καλύπτει μερικώς ορθά μια – δυο περιπτώσεις ή μήπως ως επιστήμη που είναι η Βιολογία η ορθή απάντηση είναι μόνο μια, αυτή που εξετάζει όλα τα ενδεχόμενα καλύπτει πλήρως καθένα από αυτά ακόμη και αν δεν λήφθηκε υπόψη από τους θεματοδότες ότι όλα τα ενδεχόμενα δεν απαντώνται με γνώσεις μέσα από το σχολικό εγχειρίδιο; Πόσο λοιπόν αντικειμενικοί μπορούν να είναι οι διορθωτές στο μάθημα που παίζει τον κυρίαρχο ρόλο για την εισαγωγή των μαθητών στην πλέον υψηλόβαθμη σχολή της Ελλάδας και ανεξάρτητα από αυτό;

Πάντως είναι βέβαιο, ότι είναι άδικο να πριμοδοτούνται οι μέτριοι και να αδικούνται οι πραγματικά ικανοί μαθητές. Επίσης δεν είναι σωστό να καλλιεργείται αντιεπιστημονική σκέψη επειδή αυτή κατά κανόνα επιβραβεύεται στις εξετάσεις στα πλαίσια της απλούστευσης που πολλές φορές παραβιάζει τα όρια της επιστημονικής ορθότητας. Άλλωστε η απλούστευση έχει αξία όταν πραγματικά απλουστεύει δύσκολες επιστημονικές έννοιες χωρίς να στερείται επιστημονικότητας.

Μπορεί ο ρόλος της δευτεροβάθμιας εκπαίδευσης να μην είναι να δημιουργήσει επιστήμονες είναι όμως υποχρέωση της να βάλει στους αυριανούς επιστήμονες που θα αποφοιτήσουν από τα πανεπιστήμια, τα πρώτα και γερά θεμέλια της επιστημονικής σκέψης και αντίληψης!

.

ΘΕΜΑ Δ

Το θέμα Δ εμφανίζει πολλά προβλήματα, με κυρίαρχα τα έξης που πηγάζουν από τις πληροφορίες που δίνονται στο σχολικό βιβλίο για τον ορισμό των δομικών χρωμοσωμικών ανωμαλιών και των γονιδιακών μεταλλάξεων σε συνδυασμό με την εικόνα 2 και τα δεδομένα του θέματος.

Σύμφωνα με το σχολικό βιβλίο σελ. 89″ οι γενετιστές κατατάσσουν τις μεταλλάξεις σε δύο μεγάλες κατηγορίες: τις γονιδιακές και τις χρωμοσωμικές. Ο τυπικός αυτός διαχωρισμός σχετίζεται με την έκταση της αλλαγής. Αν αυτή αφορά μικρό αριθμό βάσεων, στις οποίες συμβαίνει αντικατάσταση, προσθήκη, ή έλλειψη, τότε ονομάζεται γονιδιακή μετάλλαξη. αν αφορά αλλαγές σε μεγαλύτερο τμήμα του χρωμοσώματος, ονομάζεται χρωμοσωμική ανωμαλία.» και σελ. 97-98″ οι δομικές χρωμοσωμικές ανωμαλίες είναι αλλαγές στη δομή ενός ή περισσοτέρων χρωμοσωμάτων. Οι δομικές αλλαγές στο χρωμόσωμα μπορεί να αφορούν, μερικά γονίδια ή ένα μεγάλο τμήμα του χρωμοσώματος.» «οι δομικές χρωμοσωμικές ανωμαλίες έχουν ως αποτέλεσμα την αλλαγή στην ποσότητα ή στη διάταξη της γενετικής πληροφορίας στα χρωμοσώματα.» » Η μετατόπιση είναι αποτέλεσμα θραύσης ενός τμήματος του χρωμοσώματος και στη συνέχεια ένωσης του σε ένα άλλο μη ομόλογο χρωμόσωμα. Στις αμοιβαίες μετατοπίσεις έχουμε ανταλλαγή χρωμοσωμικών τμημάτων ανάμεσα σε μη ομόλογα χρωμοσώματα. Στις αμοιβαίες μετατοπίσεις δεν χάνεται γενετικό υλικό και τα άτομα που τις φέρουν εμφανίζουν συνήθως φυσιολογικό φαινότυπο. Ταυτόχρονα όμως εμφανίζουν κίνδυνο απόκτησης απογόνων με χρωμοσωμικές ανωμαλίες, επειδή κατά το ζευγάρωμα των χρωμοσωμάτων στη μειωτική διαίρεση προκύπτουν και μη φυσιολογικοί γαμέτες.»

Από όσα αναφέρει το σχολικό βιβλίο και γνωρίζει ο μαθητής σε σχέση με το σχήμα που δίνεται στην εικόνα 2 του θέματος Δ, ο παρατηρητικός και διαβασμένος μαθητής προβληματίζεται για το αν οι εικονιζόμενες αλλαγές στα χρωμοσώματα χαρακτηρίζονται ως γονιδιακές μεταλλάξεις (πολύ μικρής έκτασης αλλαγές στο γενετικό υλικό μη ομολόγων χρωμοσωμάτων) ή ως αμοιβαία μετατόπιση (επειδή γίνεται αντάλλαγη DNA τμημάτων μεταξύ μη ομολόγων χρωμοσωμάτων). Αξίζει να σημειωθεί ότι τα τμήματα που ανταλλάσσονται είναι στα άκρα των χρωμοσωμάτων και δεν γίνεται πουθενά φανερό αν αποτελούν τμήματα γονιδίων.

Θέμα Δ1.

«Να γράψετε όλα τα πιθανά χρωμοσώματα που θα προκύψουν μετά την αμοιβαία μετατόπιση, με τις αντίστοιχες αλληλουχίες DNA (μονάδες 4).»

Όλα τα πιθανά χρωμοσώματα που θα προκύψουν είναι οκτώ!

Τα οκτώ αυτά χρωμοσώματα είναι:

Τμήμα Α- Τμήμα Β και Τμήμα Β-Τμήμα Α

Τμήμα Α-Τμήμα Β ανεστραμμένο και Τμήμα Β – τμήμα Α ανεστραμμένο

Τμήμα Α- Τμήμα Β και Τμήμα Β- τμήμα Α ανεστραμμένο

Τμήμα Α- τμήμα Β ανεστραμμένο και Τμήμα Β- τμήμα Α

Θέμα Δ2

«Να γράψετε όλους τους πιθανούς γαμέτες αυτού του ενήλικα (προέκυψε από ζυγωτό με μια από τις παραπάνω αμοιβαίες μετατοπίσεις και έχει φυσιολογικό φαινότυπο) χρησιμοποιώντας τους συμβολισμούς των χρωμοσωμάτων, όπως σας έχουν δοθεί».

Ποια μπορεί να είναι άραγε η σωστή απάντηση σε αυτήν την ερώτηση;

α) Σύμφωνα με τις γνώσεις που μπορεί να έχει ο μαθητής από το σχολικό βιβλίο για την αμοιβαία μετατόπιση και τον 2ο νομό Mendel.

β) Σύμφωνα με τα πραγματικά γεγονότα που λαμβάνουν χώρα στη μείωση ενός ατόμου ετερόζυγου για αμοιβαία μετατόπιση.

γ) Να θεωρήσει ο μαθητής σύμφωνα με τους ορισμούς του σχολικού βιβλίου (που είναι αυτοί που οφείλει να γνωρίζει) ότι δεν πρόκειται για δομική χρωμοσωμική ανωμαλία (παρόλο που σε ολόκληρο το θέμα Δ γίνεται φανερό ότι ο θεματοδότης, είτε αγνοώντας είτε αδιαφορώντας για τους ορισμούς των διαφορετικών τύπων μεταλλάξεων του σχολικού βιβλίου, θεωρεί ότι πρόκειται για δομική χρωμοσωμική ανωμαλία) αλλά ο μαθητής να θεωρήσει ότι πρόκειται για δυο γονιδιακές μεταλλάξεις στα άκρα δύο μη ομολόγων χρωμοσωμάτων που δεν επηρεάζουν γονίδια ή την λειτουργικότητα γονιδίων.

Προφανώς ένας μαθητής θα μπορούσε να εξετάσει μόνο τις περιπτώσεις α και γ.

Περιπτώσεις α και γ.

Η περίπτωση β δεν εξετάζεται διότι είναι πόλυ μικρά τα τμήματα των χρωμοσωμάτων Α και Β που ανταλλάσσονται και επομένως δεν έχει νόημα αφού δεν θα υπάρξουν κατά την σύναψη των ομολόγων χρωμοσωμάτων προβλήματα, επιπλέον ο μαθητής δεν οφείλει να γνωρίζει αυτόν τον τρόπο.

Άτομο με χρωμοσωμική σύσταση 42+ΑαΒβ θα αποκτήσει τους εξής γαμέτες: 21+ΑΒ και 21+αβ ή 21+Αβ και 21+ αΒ. Όπου 42 τα υπόλοιπα από τα 46 χρωμοσώματα των σωματικών κυττάρων του ανθρώπου.

Θέμα Δ3.

«Κάθε γαμέτης που προκύπτει στο ερώτημα Δ2 γονιμοποιείται με φυσιολογικό γαμέτη. Να εξηγήσετε τι ποσοστό των απογόνων θα είχε φυσιολογικό φαινότυπο (μονάδες 5) και τι ποσοστό των απογόνων θα έχει φυσιολογικό καρυότυπο (μονάδες 4).»

Σύμφωνα με όσα αναφέρθηκαν προηγουμένως οι πιθανοί απόγονοι θα είναι οι έξης:

42+ΑΑΒΒ ή 42+ΑαΒβ ή 42+ΑΑΒβ ή 42+ΑαΒΒ.

Ο φυσιολογικός γαμέτης έχει χρωμοσωμική σύσταση : 21+ΑΒ

Περίπτωση 1: Τα τμήματα που ανταλλάχθηκαν μεταξύ των χρωμοσωμάτων Α και Β δεν αποτελούν τμήματα γονιδίων.

Το ποσοστό των απογόνων με φυσιολογικό φαινότυπο είναι 100% διότι το τμήμα του χρωμοσώματος Α που βρίσκεται στο χρωμόσωμα β καθώς και το τμήμα του χρωμοσώματος Β που βρίσκεται στο χρωμόσωμα α είναι τόσο μικρό (λιγότερο σε κάθε περίπτωση από 10 ζεύγη βάσεων) και στο άκρο του χρωμοσώματος ωστε δεν μπορεί να επηρεάσει με κάποιο τρόπο τον φαινότυπο των ατόμων με χρωμοσωμική σύσταση 42+ΑΑΒβ ή 42+ΑαΒΒ. Τα άτομα με χρωμοσωμική σύσταση 42+ΑΑΒΒ και 42+ΑαΒβ είναι φυσιολογικά όπως προκύπτει άμεσα από την εκφώνηση.

Το ποσοστό των απογόνων με φυσιολογικό καρυότυπο θα είναι επίσης 100%.

Σύμφωνα με τον ορισμό του σχολικού βιβλίου για τον καρυότυπο αυτός αποτελεί την απεικόνιση κατά ελλατούμενο μέγεθος των ζευγων των μεταφασικών χρωμοσωμάτων διαιρούμενων ευκαρυωτικών κυττάρων και η παρατήρηση τους γίνεται στο οπτικό μικροσκόπιο. Σελ. 20 σχολικό βιβλίο.

Τα τμήματα που ανταλλάχθηκαν μεταξύ των χρωμοσωμάτων Α και Β είναι πολύ μικρά και δεν μπορεί η διαφορά των χρωμοσωμάτων Α και α καθώς και Β και β να είναι παρατηρήσιμη με το οπτικό μικροσκόπιο. Το σχολικό βιβλίο αναφέρει στη σελίδα 20 ότι τα μεταφασικά χρωμοσώματα είναι η μόνη μορφή των χρωμοσωμάτων όπου καθίστανται ορατά ως μεμονωμένες δομές στο οπτικό μικροσκόπιο. Επίσης το σχολικό βιβλίο αναφέρει και εμφανίζει μάλιστα και εικόνα από ηλεκτρονικό μικροσκόπιο, ότι το νουκλεόσωμα (πρώτος βαθμός πακεταρίσματος του ευκαρυωτικού  πυρηνικού DNA) αποτελείται από 146!! ζεύγη βάσεων τυλιγμένων γύρω από τις ιστόνες και είναι παρατηρήσιμο ΜΟΝΟ στο ηλεκτρονικό μικροσκόπιο. Γι αυτό άλλωστε και ο καρυότυπος αφορά μεταφασικά χρωμοσώματα. (Για να είναι παρατηρήσιμες οι δομικές αλλαγές στα χρωμοσώματα στον καρυότυπο πρέπει να έχουν μέγεθος μεγαλύτερο από 10.000 ζεύγη βάσεων. Αυτό βεβαίως δεν οφείλει να το γνωρίζει ο μαθητής).

Περίπτωση 2. Στα άκρα των χρωμοσωμάτων Α και Β που συνέβει η ανταλλαγή των τμημάτων υπήρχαν γονίδια που η έκφραση τους είναι ικανή να παρατηρηθεί στο φαινότυπο, συνεπώς τα χρωμοσώματα α και β φέρουν υπολειπόμενες μεταλλάξεις έναντι των χρωμοσωμάτων Α και Β ως προς τα ακραία αυτά γονίδια καθώς από την εκφώνηση της άσκησης το άτομο με χρωμοσωμική σύσταση 42+ΑαΒβ είναι φυσιολογικό.

Στην περίπτωση αυτή το ποσοστό των φυσιολογικών απογόνων είναι 100%.

Και για τους λογούς που αναπτύχθηκαν στην προηγουμένη περίπτωση το ποσοστό των φυσιολογικων καρυτυπικώς απογόνων είναι πάλι 100%.

Το ποσοστό να είναι 50 % οι φυσιολογικοί απόγονοι ( 42+ ΑΑΒΒ και 42+ ΑαΒβ) και 25% οι φυσιολογικά καρυοτυπικώς απόγονοι (μόνο οι 42+ΑΑΒΒ) αποκλείεται διότι τα τμήματα που ανταλλάσσονται μεταξύ των χρωμοσωμάτων Α και Β είναι πολύ μικρά.

Θέμα Δ4.

«Να εξηγήσετε τα ειδή των δομικών χρωμοσωμικών ανωμαλιών που σίγουρα θα έχει κάθε απόγονος με μη φυσιολογικό καρυότυπο.»

Προηγουμένως, καταλήξαμε ότι αποκλείεται να υπάρχουν απόγονοι με μη φυσιολογικό καρυότυπο καθώς οι αλλαγές στα χρωμοσώματα α και β είναι αδύνατον να παρατηρηθούν με το οπτικό μικροσκόπιο. Αν ωστόσο θεωρήσουμε ότι το ερώτημα αφορά τα άτομα με χρωμοσωμική σύσταση 42+ ΑαΒβ και 42+ΑΑΒβ και 42+ΑαΒΒ τα οποία φέρουν τα μεταλλαγμένα χρωμοσώματα α και β, και αν θεωρήσουμε ότι το ερώτημα ορίζει ως δομικές χρωμοσωμικές ανωμαλίες τις αλλαγές αυτές στα χρωμοσώματα α και β -κατά παράβαση του ορισμού του σχολικού βιβλίου για τις δομικές χρωμοσωμικές ανωμαλίες, που αναφέρθηκε παραπάνω- τότε τα άτομα :

42+ΑαΒβ, θα φέρουν φυσιολογική ποσότητα DNA, αλλά αμοιβαία μετατόπιση μικρών ακραίων τμημάτων μεταξύ των χρωμοσωμάτων Α και Β (χρωμοσώματα α και β).

42+ΑαΒΒ, θα φέρουν μια επιπλέον φορά το ακραίο τμήμα του χρωμοσώματος Β όπως δίνεται στην εικόνα 2 (διπλασιασμός!;) και μια μόνο φορά το ακραίο τμήμα του χρωμοσώματος Α όπως δίνεται στην εικόνα 2 (έλλειψη!).

42+ΑΑΒβ , θα φέρουν μια επιπλέον φορά το τμήμα του χρωμοσώματος Α όπως δίνεται στην εικόνα 2 (διπλασιασμός!;) και μια μόνο φορά το τμήμα του χρωμοσώματος Β όπως δίνεται στην εικόνα 2 (έλλειψη!).

Στο σχολικό βιβλίο οι ορισμοί του διπλασιασμού και της έλλειψης που είναι δομικές χρωμοσωμικές ανωμαλίες δίνονται στη σελ 97. «Η έλλειψη είναι η απώλεια γενετικού υλικού.» και «Ο διπλασιασμός είναι η επανάληψη ενός χρωμοσωμικού τμήματος στο χρωμόσωμα.». Ως δομικές χρωμοσωμικές ανωμαλίες αφορούν μερικά γονίδια ή μεγάλο τμήμα χρωμοσώματος.

Φυσικά και εδώ ισχύει , ποια άραγε απάντηση θα θεωρηθεί σωστή…..;

Είναι πράγματι απορίας άξιο με ποιο πνεύμα προτείνονται τα θέματα!

Ας ελπίζουμε ότι η πρόταση « κάθε απάντηση επιστημονικώς τεκμηριωμένη είναι ΠΡΑΓΜΑΤΙ αποδεκτή.»

ίσως η νεα ηγεσία του Υπουργείου Παιδείας θα πρέπει να εξετάσει το ενδεχόμενο να δημοσιοποιεί τα ονόματα των μελών των επιτροπών των θεμάτων των πανελληνίων εξετάσεων μετά το πέρας των εξετάσεων.

Βιολογία Θετικής κατεύθυνσης το Δ θέμα στις εξετάσεις 2014!

 

Επιστημονικά λάθη φέτος στη Βιολογία κατεύθυνσης!

 

Τα φετινά θέματα της βιολογίας θετικής κατεύθυνσης μέχρι το ερώτημα Δ2 δεν χαρακτηρίζονται από καμιά πρωτοτυπία. Συγκεκριμένα το Α θέμα όπως πάντα από το 2003 και μετά αποτελούνταν από 5 ερωτήσεις πολλαπλής επιλογής που απαιτούσαν απλή ανάκληση γνώσεων από το σχολικό βιβλίο. Το Β θέμα βεβαίως αυτή τη φορά δεν απαιτούσε την παράθεση αυτούσιων τμημάτων του σχολικού βιβλίου αλλά, σε δυο ερωτήματα ζητούσε τοποθέτηση κατά χρονική σειρά και αντιστοίχηση και πάλι όμως αρκούσε η αυτούσια γνώση του σχολικού βιβλίου για να απαντηθεί. Το θέμα Γ για άλλη μια χρονιά ήταν μια κλασσική άσκηση του 5ου κεφαλαίου. Για άλλη μια φορά ήταν ένα πολύ απλό και εύκολο γενεαλογικό δένδρο που αφορούσε ένα κληρονομικό χαρακτηριστικό που όπως συνήθως ακολουθούσε αυτοσωμικό υπολειπόμενο τρόπο κληρονόμησης. Το θέμα Δ, μέχρι το ερώτημα Δ2 στερούνταν και πάλι πρωτοτυπίας αφού ζητούσε να βρεθεί η κωδική αλυσίδα του δοθέντος τμήματος γονιδίου, το mRNA και ο προσανατολισμός τους.

Είναι πράγματι άξιο απορίας γιατί τα θέματα της Bιολογίας εμφανίζουν τόσο μεγάλη επαναληψιμότητα, Μήπως δεν είναι η Βιολογία ένα επιστημονικό πεδίο ακόμα και σε επίπεδο λυκείου που έχει ποικιλία ασκήσεων και ερωτήσεων που απαιτούν κριτική σκέψη;

Πέραν όμως της στερούμενης πρωτοτυπίας των θεμάτων μέχρι το ερώτημα Δ2, στα επόμενα τρία ερωτήματα που ακολουθούσαν στο θέμα Δ τα ζητούμενα παρουσίαζαν πρωτοφανή πρωτοτυπία! Ζητούνταν από τους μαθητές να απαντήσουν στα ερωτήματα με επιστημονικώς λανθασμένες απαντήσεις!!!

Ας δούμε όμως καθένα από αυτά τα ερωτήματα ξεχωριστά:

 

Ερώτημα Δ3: Να γράψετε το τμήμα του mRNA στο οποίο θα συνδεθεί η μικρή ριβοσωμική υπομονάδα κατά την έναρξη της μετάφρασης.

 

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

 

1) το τμήμα του σχολικού βιβλίου που αφορά την έναρξη της μετάφρασης.

” κατά την έναρξη της μετάφρασης το mRNA προσδένεται, μεσώ μιας αλληλουχίας που υπάρχει στην 5′ αμετάφραστη περιοχή του με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος σύμφωνα με τους κανόνες της συμπληρωματικότητας των βάσεων.”

2) Το τμήμα του mRNA που προκύπτει από το δοθέν τμήμα του πρώτου γονιδίου του οπερονίου της λακτόζης (απάντηση ερωτήματος Δ2):

 

5′ AGCUAUGACCAUGUUACGGAUUCACUG3′

Σύμφωνα με αυτά, ο μαθητής παρατηρεί ότι το μόνο τμήμα 5′ αμετάφραστης περιοχής που του δίνεται είναι τα 4 νουκλεοτίδια που προηγούνται του κωδικονίου έναρξης της μετάφρασης (AUG), όποτε δεν του μένει άλλη επιλογή από το δώσει αυτήν την τετράδα νουκλεοτιδίων της 5′ αμετάφραστης περιοχής ως απάντηση, ανεξάρτητα από το αν τον προβληματίζει η διατύπωση του σχολικού βιβλίου “μεσώ μιας αλληλουχίας που υπάρχει στην 5′ αμετάφραστη περιοχή του”, το οποίο ορθώς αφήνει να εννοηθεί ότι αυτή η αλληλουχία δεν είναι ολόκληρη η 5΄αμετάφραστη περιοχή, όποτε δεν σημαίνει απαραίτητα ότι είναι σωστή η μοναδική απάντηση που μπορεί να δοθεί, δηλαδή τα 4 τελευταία νουκλεοτίδια της 5΄αμετάφραστης περιοχής.

Πράγματι, όπως όφειλε να γνωρίζει ο θεματοδότης, τα 4 τελευταία νουκλεοτίδια της 5΄αμετάφραστης περιοχής των mRNAs του βακτηρίου E. coli, δεν αποτελούν την αλληλουχία σύνδεσης τους με το τμήμα του rRNA της μικρής ριβοσωμικής υπομονάδας. Η αλληλουχία αυτή στην 5′ αμετάφραστη περιοχή ονομάζεται Shine-Delgarno και είναι μια συντηρημένη αλληλουχία συνήθως 7-9 νουκλεοτιδίων πλουσίων σε Α και G (5’UAAGGAGGU3′)(πολλά textbooks βιολογίας π.χ. GeneVIII, άλλα και πιο ειδικά επιστημονικά άρθρα όπως JinH, ZhaoQ, GonzalezdeValdiviaEI, ArdellDH, StenströmM, IsakssonLA. Mol Microbiol. 2006 Apr; 60(2):480-92.καιDetermination of the optimal aligned spacing between the Shine-Dalgarno sequence and the translation initiation codon of Escherichia coli mRNAs.Nucleic Acids Research. Nov 25, 1994; 22(23)4953) και η αλληλουχία αυτή (S-D) του mRNA απέχει από το κωδικόνιο έναρξης 4-5 νουκλεοτίδια! (Determination of the optimal aligned spacing between the Shine-Dalgarno sequence and the translation initiation codon of Escherichia coli mRNAs.Nucleic Acids Research. Nov 25, 1994; 22(23)4953).

 

Ερώτημα Δ4: Η φυσιολογική πρωτεΐνη, που παράγεται από την έκφραση του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης, αποτελείται από 1024 αμινοξέα. Μια γονιδιακή μετάλλαξη αντικατάστασης μιας βάσης στο παραπάνω τμήμα DNA οδηγεί στην παραγωγή μιας πρωτεΐνης με 1022 αμινοξέα, δηλαδή μικρότερης κατά δυο αμινοξέα . Να εξηγήσετε με ποιο τρόπο μπορεί να συμβεί αυτό.

 

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

 

1)τον ορισμό του οπερονίου της λακτόζης από το σχολικό βιβλίο.

2)τον ορισμό των μεταλλάξεων και ειδικότερα των γονιδιακών μεταλλάξεων και συγκεκριμένα τον ορισμό και τις επιπτώσεις των γονιδιακών μεταλλάξεων αντικατάστασης βάσης.

3)να διερευνήσει την ερμηνεία της φράσης στην εκφώνηση του ερωτήματος “..στο παραπάνω τμήμα DNA.. “

 

Διερεύνηση

 

Ερμηνεία Ι). Η φράση της εκφώνησης “στο παραπάνω τμήμα DNA αναφέρεται στο δοθέν από την εκφώνηση του Δ θέματος τμήμα DNA, του πρώτου δομικού γονιδίου του οπερονίου μήκους 28 ζευγών βάσεων, που κωδικοποιεί τα 8 πρώτα αμινοξέα του ενζύμου της β-γαλακτοσιδάσης.

Σε αυτή την περίπτωση η ζητούμενη απάντηση είναι ότι η αναφερόμενη στην εκφώνηση μετάλλαξη οδήγησε στην κατάργηση του πρώτου κωδικονίου 5’ATG3′ στην κωδική αλυσίδα του γονιδίου και αντίστοιχα της τριπλέτας 3’ΤΑC5′ της μη κωδικής αλυσίδας του γονιδίου με συνεπεία την παράγωγη ενός μεταλλαγμένου μορίου mRNA που προέκυψε από την μεταγραφή του οπερονίου. Το μεταλλαγμένο αυτό mRNA, όταν μεταφράζεται το τμήμα του που κωδικοποιεί για την β-γαλακτοσιδάση να έχει ως συνεπεία η μετάφραση, εάν είναι βεβαίως αυτό εφικτό να γίνει , εξαιτίας των συγκεκριμένων διαστάσεων και του τρόπου δράσης του ριβοσώματος με το mRNA, να ξεκινήσει από το επόμενο 5’AUG3′ που υπάρχει στο μεταλλαγμένο mRNA. Η θέση του 5’AUG3′ αυτού εντοπίζεται ακριβώς ένα κωδικόνιο μετά το φυσιολογικό εναρκτήριο κωδικόνιο της μετάφρασης, όποτε η παραγόμενη πολυπεπτιδική αλυσίδα που θα προκύψει από την μετάφραση του μεταλλαγμένου τμήματος του mRNA του οπερονίου να είναι κατά δυο αμινοξέα μικρότερη.

Ωστόσο ο θεματοδότης όφειλε να γνωρίζει ότι αυτή η πιθανή απάντηση δεν είναι απαραίτητα σωστή επιστημονικώς. Σύμφωνα με όσα αναφέρθηκαν στο προηγούμενο ερώτημα, η έναρξη της μετάφρασης στα γονίδια το βακτηρίου E. coli είναι εφικτή όταν πληρούνται συγκεκριμένες προϋποθέσεις, όπως είναι η ύπαρξη άλλα και η σωστή απόσταση της αλληλουχίας S-D από την τριπλέτα 5’AUG3′ στο mRNA καθώς οι διαστάσεις του ριβοσώματος και ο τρόπος με τον οποίο αυτό συνδέεται με το mRNA είναι συγκεκριμένες/ος.

 

Ερμηνεία ΙΙ). Η φράση της εκφώνησης “στο παραπάνω τμήμα DNA αναφέρεται σε ολόκληρο το δομικό γονίδιο Ζ του οπερονίου της λακτόζης πέραν του δοθέντος τμήματος του, το οποίο εξετάστηκε αμέσως παραπάνω.

Σε αυτή την περίπτωση η απάντηση θα μπορούσε να είναι ότι η αναφερόμενη στην εκφώνηση μετάλλαξη αντικατάστασης βάσης οδήγησε σε ένα μεταλλαγμένο γονίδιο Ζ του οπερονίου. Όταν μεταγράφεται αυτό το μεταλλαγμένο οπερονίο οδηγεί σε να μόριο mRNA του οποίου το τμήμα του που κωδικοποιεί την β-γαλακτοσιδάση να διαφέρει από το φυσιολογικό λόγω αντικατάστασης μιας βάσης στο 1023ο κωδικονίο, με αποτέλεσμα να υπάρχει σε αυτή τη θέση κωδικονίο λήξης (κωδικονίο χωρίς νόημα). Το μεταλλαγμένο αυτό mRNA όταν μεταφράζεται το τμήμα του που κωδικοποιεί για τη β-γαλακτοσιδάση οδηγεί σε ένα μεταλλαγμένο ένζυμο μικρότερο από το φυσιολογικό στο καρβοξιτελικό άκρο του κατά δυο αμινοξέα.

Σε αυτή την περίπτωση, σύμφωνα με τα δεδομένα της εκφώνησης του ερωτήματος, αφού η μετάλλαξη που συνέβει είναι αντικατάστασης βάσης και η παραγόμενη πρωτεΐνη είναι κατά δυο αμινοξέα μικρότερη, μπορεί ο μαθητής να υποθέσει με ασφάλεια ότι το φυσιολογικό 1023ο κωδικονίο έχει τέτοια αλληλουχία που είναι δυνατό με μια αντικατάσταση βάσης να σχηματιστεί κωδικόνιο λήξης.

Με αυτή την ερμηνεία ο μαθητής δεν κινδυνεύει να δώσει επιστημονικώς λανθασμένη απάντηση, ανεξάρτητα από το αν δεν είναι υποχρεωμένος – είναι όμως οπωσδήποτε ο θεματοδότης που επιλεγεί αυτό το ερώτημα – να γνωρίζει σε βάθος επιστημονικές λεπτομέρειες για την έναρξη της μετάφρασης (βλέπε π.χ. παραπομπές παραπάνω).

 

Ερώτημα Δ5. Μια γονιδιακή μετάλλαξη που συνέβει στο ρυθμιστικό γονίδιο του οπερόνιου της λακτόζης οδηγεί στην παραγωγή ενός τροποποιημένου mRNA. Το mRNA αυτό φέρει τέσσερις επιπλέον διαδοχικές βάσεις μεταξύ του 3ο και 4ο κωδικονίου του. Να εξηγήσετε ποια θα είναι η συνεπεία στην παράγωγη των ενζύμων που μεταβολίζουν τη λακτόζη όταν το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

1)    Από το 7ο κεφάλαιο « όπως και όλοι οι υπόλοιποι οργανισμοί…διάφορες οργανικές ενώσεις όπως οι υδατάνθρακες.»

2)    Από το 2ο κεφάλαιο οτιδήποτε αναφέρει το σχολικό βιβλίο για το οπερόνιο της λακτόζης στο βακτήριο E.coli. και την τελευταία άσκηση του σχολικού βιβλίου στο 2ο κεφάλαιο.

3)    Από το 6ο κεφάλαιο τον ορισμό των μεταλλάξεων και ειδικότερα των γονιδιακών μεταλλάξεων και συγκεκριμένα τον ορισμό και τις επιπτώσεις των γονιδιακών μεταλλάξεων προσθήκης βάσεων, εντός της κωδικής περιοχής του γονιδίου, σε πλήθος που είναι μη ακέραιο πολλαπλάσιο του τρία.

4)    Να διερευνήσει την ερμηνεία της φράσης στην εκφώνηση «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης

 

Διερεύνηση:

 

Ερμηνεία Ι). Η φράση της εκφώνησης «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.» αναφέρεται στην μεταφορά και τον εμβολιασμό του μεταλλαγμένου στελέχους σε θρεπτικό υλικό απουσία πηγής άνθρακα με σκοπό την ανάπτυξη του σε αυτό το θρεπτικό μέσο.

Σε αυτήν την περίπτωση δεδομένου ότι το βακτήριο E. coli είναι ετερότροφο και σύμφωνα με τα παραπάνω αποσπάσματα του σχολικού βιβλίου, είναι βέβαιο ότι το βακτηριακό αυτό στέλεχος θα αδυνατεί να αναπτυχθεί σε αυτό το θρεπτικό υλικό, αφού δεν θα είναι δυνατή η τροφοδότηση του με άνθρακα. Η αδυναμία αυτή είναι ανεξάρτητη από την μετάλλαξη που φέρει το βακτηριακό αυτό στέλεχος στο ρυθμιστικό γονίδιο του οπερονίου της λακτόζης. Ωστόσο εάν η μετάλλαξη αυτή είχε ως συνεπεία έναν μη λειτουργικό καταστολέα που θα αδυνατεί να συνδεθεί με τον χείριστη του οπερονίου, θα επιβάρυνε ακόμη περισσότερο την αδυναμία του βακτηρίου να αναπτυχθεί σε θρεπτικό υλικό που στερείται πηγής άνθρακα καθώς σε αυτή την περίπτωση το οπερόνιο της λακτόζης θα εκφραζόταν συνεχώς, γεγονός ιδιαίτερα ενεργοβόρο, για όσο χρονικό διάστημα μπορούσε να παραμείνει στη ζωή το βακτηριακό κύτταρο μέχρι να εξαντληθούν τα αποθέματα ενέργειας του κυττάρου.

 

Ερμηνεία ΙΙ) . Η φράση της εκφώνησης «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.» αναφέρεται στο γεγονός ότι το βακτηριακό αυτό στέλεχος με το μεταλλαγμένο ρυθμιστικό γονίδιο έχει ήδη αναπτυχθεί και συνεχίζει να αναπτύσσεται σε θρεπτικό υλικό, το οποίο δεν διαθέτει ως πηγή άνθρακα ούτε γλυκόζη ούτε λακτόζη, αλλά υποθέτει ο μαθητής ότι περιέχει μια άλλη πηγή άνθρακα την οποία μπορεί να προμηθεύεται το βακτήριο από το θρεπτικό του υλικό.

Σε αυτή την περίπτωση διακρίνονται δυο περιπτώσεις:

περίπτωση Α). Η μετάλλαξη του ρυθμιστικού γονιδιού του οπερονίου της λακτόζης όπως περιγράφεται από την εκφώνηση του ερωτήματος και σε συνδυασμό με τα παραπάνω τμήματα του σχολικού βιβλίου που έλαβε ο μαθητής υπόψη του οδήγησε πιθανότατα σε μια πρωτεΐνη καταστολέα που είναι μη λειτουργική και αδυνατεί να αναγνωρίσει ή/και να προσδεθεί στον χείριστη του οπερονίου, οπότε το οπερόνιο της λακτόζης σε αυτή την περίπτωση θα εκφράζεται συνεχώς και θα παράγονται συνεχώς τα τρία ένζυμα που αυτό κωδικοποιεί, ανεξάρτητα από την παρουσία ή όχι λακτόζης στο θρεπτικό υλικό ανάπτυξης του βακτηρίου.

Περίπτωση Β). Η αναφερόμενη στην εκφώνηση μετάλλαξη δεν αποκλείεται να οδηγήσει σε έναν τροποποιημένο καταστολέα που μπορεί να συνδέεται στον χείριστη του οπερονίου , όμως δεν μπορεί να απομακρυνθεί από αυτόν είτε υπάρχει είτε δεν υπάρχει στο κύτταρο επαγωγέας του οπερονίου της λακτόζης. Σε αυτή την περίπτωση το οπερονιο της λακτόζης θα βρίσκεται μονίμως σε καταστολή και δεν θα παράγονται καθόλου τα ένζυμα που αυτό κωδικοποιεί.

Αυτές λοιπόν τις σκέψεις και τις παρατηρήσεις κλήθηκε να πραγματοποιήσει, προκείμενου να απαντήσει σωστά, φέτος ο υποψήφιος της θετικής κατεύθυνσης στα ερωτήματα Δ3, Δ4, Δ5!

Αξίζει να αναλογιστεί και να συνυπολογίσει κάνεις το γεγονός ότι η Βιολογία κατεύθυνσης έχει τον μεγαλύτερο συντελεστή βαρύτητας (1,3) για τις ιατρικές και τις συναφείς με τις ιατρικές σχόλες της χώρας!

Μήπως όμως δεν είναι τελικά έτσι; Μήπως η απαίτηση της επιτροπής που έβαλε τα θέματα ήταν απλώς ο μαθητής να μην ξέρει τίποτα, μα τίποτα άλλο πέρα από την στεγνή αποστήθιση του σχολικού βιβλίου και του τρόπου λύσης δυο κατηγοριών ασκήσεων χωρίς απαραίτητα να έχει πολυκαταλαβεί, διότι αν είχε καταλάβει κινδύνευε να μην απαντήσει “σωστά”;

Ας αναρωτηθεί όμως και κυρίως ας απαντήσει επισήμως και η Πανελληνία Ένωση Βιοεπιστημόνων, μελή της οποίας είναι οι θεματοδότες και οι διορθωτές των γραπτών των εξετάσεων, γιατί θα πρέπει να σιωπά όταν συμβαίνουν τέτοια πράγματα στις πανελλαδικές εξετάσεις στο μάθημα της Βιολογίας θετικής κατεύθυνσης!!!

Ποιοι είναι πιο ειδικοί για να απαντήσουν, αν όχι η επιτροπή παιδείας της Πανελληνίας Ένωσης Βιοεπιστημόνων;

Πόσα παιδιά θα τιμωρηθούν φέτος επειδή σκεφτήκαν σωστά και δεν στάθηκαν μόνο στο να αποστηθίσουν το σχολικό βιβλίο και δυο τύπους ασκήσεων ;

Πόσα παιδιά θα επιβραβευτούν φέτος επειδή το μόνο που έμαθαν στην Βιολογία θετικής κατεύθυνσης ήταν το σχολικό βιβλίο απέξω λέξη προς λέξη και τίποτα περισσότερο;

Είναι άδικο να επιβραβεύονται λαμβάνοντας ακόμα και τον ίδιο βαθμό εκείνοι οι μαθητές που απλώς μάντεψαν την απάντηση που θα ήθελε η επιτροπή, με εκείνα τα παιδιά που ανέπτυξαν κριτική σκέψη και παρατηρητικότητα και αιτιολόγησαν την απάντηση τους!

 

 

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑ 1ο
Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως
5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την
ημιτελή πρόταση.
1. Η διπλή έλικα του DNA ξετυλίγεται κατά τη μεταγραφή από το ένζυμο
α. RNA πολυμεράση
β. DNA πολυμεράση
γ. DNA ελικάση
δ. DNA δεσμάση.
Μονάδες 5
2. Οι ιστόνες είναι
α. DNA
β. RNA
γ. πρωτεΐνες
δ. υδατάνθρακες.
Μονάδες 5
3. Ασθένεια που μπορεί να διαγνωστεί με καρυότυπο είναι
α. η φαινυλκετονουρία
β. η δρεπανοκυτταρική αναιμία
γ. η β-θαλασσαιμία
δ. το σύνδρομο Cri du chat.
Μονάδες 5
4. Σύνδεση κωδικονίου με αντικωδικόνιο πραγματοποιείται κατά την
α. αντιγραφή
β. μετάφραση
γ. μεταγραφή
δ. αντίστροφη μεταγραφή.
Μονάδες 5
5. Ο αλφισμός οφείλεται σε γονίδιο
α. αυτοσωμικό επικρατές
β. φυλοσύνδετο επικρατές
γ. αυτοσωμικό υπολειπόμενο
δ. φυλοσύνδετο υπολειπόμενο.
Μονάδες 5
ΘΕΜΑ 2ο
Να απαντήσετε στις παρακάτω ερωτήσεις:
1. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα για την επιλογή οργάνων συμβατών στις μεταμοσχεύσεις;
Μονάδες 6
2. Να περιγράψετε τη διαδικασία κλωνοποίησης με την οποία δημιουργήθηκε το πρόβατο Dolly.
Μονάδες 7
3. Πού οφείλεται η αυξημένη συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β-θαλασσαιμία σε χώρες όπου εμφανιζόταν ελονοσία;
Μονάδες 6
4. Να αναφέρετε ποια θρεπτικά συστατικά είναι απαραίτητα για να αναπτυχθεί ένας μικροοργανισμός σε μια καλλιέργεια.
Μονάδες 6
ΘΕΜΑ 3ο
Να απαντήσετε στα παρακάτω:
1. Μια αρσενική μύγα Drosophila με λευκά μάτια διασταυρώθηκε με μια θηλυκή με κόκκινα μάτια. Από τη διασταύρωση αυτή πήραμε 280 απογόνους στην F1 γενιά που είχαν όλοι κόκκινα μάτια. Διασταυρώνοντας δύο άτομα από την F1 γενιά προκύπτουν 319 απόγονοι στην F2 γενιά. Μια ανάλυση των απογόνων της F2 γενιάς έδειξε ότι υπάρχουν: 159 θηλυκά με κόκκινα μάτια, 82 αρσενικά με κόκκινα μάτια και 78 αρσενικά με λευκά μάτια. Με βάση τα δεδομένα να εξηγήσετε τον τρόπο με τον οποίο κληρονομείται το παραπάνω γνώρισμα.
Για τα άτομα που διασταυρώθηκαν δίνεται ότι τα θηλυκά έχουν ένα ζευγάρι X χρωμοσωμάτων (ΧΧ) και τα αρσενικά έχουν ένα Χ και ένα Υ χρωμόσωμα (ΧΥ). Να μη ληφθεί υπόψη η περίπτωση μετάλλαξης.
Μονάδες 5
Δίνεται το παρακάτω γενεαλογικό δέντρο, όπου απεικονίζεται ο τρόπος με τον οποίο κληρονομείται μια μονογονιδιακή ασθένεια. Τα άτομα ΙΙ2, ΙΙ3, ΙΙΙ3, και ΙV3 πάσχουν από την ασθένεια αυτή. Για όλα τα παρακάτω ερωτήματα να μη ληφθεί υπόψη η περίπτωση μετάλλαξης.
2012_1
2. Με βάση τα δεδομένα του γενεαλογικού δένδρου να εξηγήσετε τον τρόπο με τον οποίο κληρονομείται η ασθένεια.
Μονάδες 6
3. Να προσδιορίσετε την πιθανότητα το ζευγάρι ΙΙΙ1, III2 να αποκτήσει αγόρι που θα πάσχει
(μονάδα 1).
Να αιτιολογήσετε την απάντησή σας (μονάδες 7).
Μονάδες 8
4. Αν τα άτομα Ι1 και Ι4 πάσχουν από μια ασθένεια που οφείλεται σε γονίδιο μιτοχονδριακού DNA, να αναφέρετε ποια άτομα του γενεαλογικού δένδρου θα κληρονομήσουν το γονίδιο αυτό (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4).
Μονάδες 6
ΘΕΜΑ 4ο
Δίνεται το παρακάτω τμήμα βακτηριακού DNA, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο.
Αλυσίδα 1: G T T G A A T T C T T A G C T T A A G T C G G G C A T G A A T T C T C
Αλυσίδα 2: C A A C T T A A G A A T C G A A T T C A G C C C G T A C T T A A G A G
1. Να προσδιορίσετε την κωδική και τη μη κωδική αλυσίδα του παραπάνω τμήματος DNA, επισημαίνοντας τα 5΄ και 3΄ άκρα των αλυσίδων του (μονάδες 1).
Να αιτιολογήσετε την απάντησή σας (μονάδες 5).
Μονάδες 6
2. Το παραπάνω τμήμα DNA αντιγράφεται, και κατά τη διαδικασία της αντιγραφής δημιουρ-
γούνται τα παρακάτω πρωταρχικά τμήματα:
i) 5΄- G A G A A U U C -3΄
ii) 5΄- U U A A G C U A -3΄
iii) 5΄- G U U G A A U U -3΄
Να προσδιορίσετε ποια αλυσίδα αντιγράφεται, με συνεχή και ποια με ασυνεχή τρόπο
(μονάδες 1).
Να αιτιολογήσετε την απάντησή σας (μονάδες 5).
Μονάδες 6
3. To παραπάνω τμήμα DNA κόβεται με το ένζυμο EcoRI, προκειμένου να ενσωματωθεί σε ένα από τα δύο πλασμίδια Α και Β που δίνονται παρακάτω.
2012_2
Ποιο από τα δύο πλασμίδια θα επιλέξετε για τη δημιουργία ανασυνδυασμένου πλασμιδίου (μονάδα 1);
Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Πόσοι φωσφοδιεστερικοί δεσμοί θα διασπαστούν στο πλασμίδιο που επιλέξατε και πόσοι θα δημιουργηθούν κατά το σχηματισμό του ανασυνδυασμένου πλασμιδίου (μονάδες 2);
Μονάδες 7

4. Από τη μύγα Drosophila απομονώθηκαν τρία διαφορετικά φυσιολογικά κύτταρα στα οποία προσδιορίστηκε το μέγεθος του γονιδιώματος σε ζεύγη βάσεων. Στο πρώτο κύτταρο το μέγεθος του γονιδιώματος υπολογίστηκε σε 3,2 x108 ζεύγη βάσεων, στο δεύτερο κύτταρο σε 1,6 x 108 ζεύγη βάσεων και στο τρίτο κύτταρο σε 6,4 x 108 ζεύγη βάσεων. Να δικαιολογήσετε γιατί υπάρχουν οι διαφορές αυτές στο μέγεθος του γονιδιώματος των τριών κυττάρων.
Μονάδες 6

ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2012
ΘΕΜΑ 1o
Οι σωστές απαντήσεις είναι:
1. α
2. γ
3. δ
4. β
5. γ
ΘΕΜΑ 2o
1. Κάθε είδος αντισώματος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται από μια ομάδα όμοιων Β-λεμφοκυττάρων, που αποτελούν έναν κλώνο. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων ονομάζονται μονοκλωνικά. Τα μονοκλωνικά αντισώματα είναι πολύ σημαντικά στην Ιατρική, για την επιλογή οργάνων συμβατών για μεταμόσχευση. Τα κύτταρα των οργάνων έχουν στην επιφάνειά τους ειδικά αντιγόνα επιφανείας, που αναγνωρίζονται από ειδικά μονοκλωνικά αντισώματα. Με τα μονοκλωνικά αντισώματα μπορεί να γίνει έλεγχος των οργάνων δωρητών, για να διαπιστωθεί αν ταιριάζουν ανοσολογικά με τα αντίστοιχα των ασθενών. Έτσι, είναι δυνατόν να αποφευχθεί η απόρριψη και οι μεταμοσχεύσεις να είναι επιτυχείς.
2. Το πρόβατο Dolly δημιουργήθηκε, όταν ο πυρήνας ενός κυττάρου του μαστικού αδένα ενός εξάχρονου πρόβατου τοποθετήθηκε στο ωάριο ενός άλλου πρόβατου. Από το ωάριο είχε προηγουμένως αφαιρεθεί ο πυρήνας. Το έμβρυο το οποίο δημιουργήθηκε ύστερα από 3-4 διαιρέσεις εμφυτεύτηκε στη μήτρα θετής μητέρας-προβατίνας, η οποία γέννησε τη Dolly.
3. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β-θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής Αφρικής και της Ν. Α. Ασίας, όπου εμφανιζόταν ελονοσία. Η αυξημένη συχνότητα οφείλεται στην ανθεκτικότητα των φορέων στην προσβολή από το πλασμώδιο (πρωτόζωο) που προκαλεί την ελονοσία, επειδή τα ερυθροκύτταρά τους δεν ευνοούν τον πολλαπλασιασμό του. Συνεπώς, η προστασία που προσδίδει η μετάλλαξη ως προς την ελονοσία αποτελεί ένα πλεονέκτημα, που τους παρέχει αυξημένη πιθανότητα επιβίωσης και δυνατότητα αναπαραγωγής.
4. Όπως όλοι οι υπόλοιποι οργανισμοί, για να αναπτυχθεί ένας μικροοργανισμός είναι απαραίτητο να μπορεί να προμηθεύεται από το περιβάλλον στο οποίο αναπτύσσεται μια σειρά θρεπτικών συστατικών. Σ’ αυτά περιλαμβάνονται ο άνθρακας, το άζωτο, διάφορα μεταλλικά ιόντα και το νερό. Η πηγή άνθρακα για τους αυτότροφους μικροοργανισμούς είναι το CΟ2 της ατμόσφαιρας, ενώ για τους ετερότροφους διάφορες οργανικές ενώσεις όπως οι υδατάνθρακες. Η πηγή αζώτου για τους περισσότερους μικροοργανισμούς είναι τα αμμωνιακά ή τα νιτρικά ιόντα (ΝΟ3 -). Σήμερα οι μικροοργανισμοί οι οποίοι χρησιμοποιούνται για την παραγωγή χρήσιμων προϊόντων, όπως αντιβιοτικά ή ένζυμα, μπορούν να αναπτυχθούν στο εργαστήριο και σε μεγάλη κλίμακα στις βιομηχανικές μονάδες κάτω από αυστηρά ελεγχόμενες συνθήκες καλλιέργειας. Για την ανάπτυξή τους χρησιμοποιούνται τεχνητά θρεπτικά υλικά. Αυτά πρέπει να περιέχουν πηγή άνθρακα, πηγή αζώτου και ιόντα. Στην περίπτωση αερόβιων μικροοργανισμών, είναι απαραίτητη η παρουσία οξυγόνου. Τα θρεπτικά υλικά που χρησιμοποιούνται για την ανάπτυξη των μικροοργανισμών στο εργαστήριο μπορεί να είναι υγρά ή στερεά. Τα υγρά θρεπτικά υλικά περιέχουν όλα τα θρεπτικά συστατικά που αναφέρθηκαν προηγουμένως διαλυμένα σε νερό. Τα στερεά θρεπτικά υλικά παρασκευάζονται με ανάμιξη του υγρού θρεπτικού υλικού με έναν πολυσακχαρίτη που προέρχεται από φύκη, το άγαρ.

Προτεινόμενες απαντήσεις για τα θέματα των πανελλήνιων εξετάσεων στην βιολογία γενικής παιδείας ημερήσιων λυκείων 2012

ΘΕΜΑ Α

  1. β
  2. δ
  3. δ
  4. β
  5. α

ΘΕΜΑ Β

Β1. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.11 και κυρίως 18 του σχολικού βιβλίου.

Μεταξύ των παθογόνων μικροοργανισμών συγκαταλέγονται  και οι ιοί, που αποτελούν ακυτταρικές μη αυτοτελείς μορφές ζωής.

Η πολιομυελίτιδα είναι μια σοβαρή νόσος που προκαλείται από ιο, ο οποίος προσβάλλει τα νευρικά κύτταρα του νωτιαίου μυελού.

Οι πληροφορίες για την απάντηση αντλούνται από την σελ.39 του σχολικού βιβλίου.

« το εμβόλιο, όπως…μνήμης.»  Συνεπώς ένα άτομο εμβολιασμένο για τον ιο της πολιομυελίτιδας, την δεύτερη και κάθε επόμενη φορά που θα μολυνθεί από τον ιο αυτό, θα αντιδράσει με δευτερογενή ανοσοβιολογική απόκριση. « Στην περίπτωση…ότι  μολύνθηκε.»

Β2. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.104 και κυρίως 85 του σχολικού βιβλίου.

« Οι αυξανόμενες ενεργειακές ανάγκες… κλίμα του πλανήτη.»

Υπολογίζεται ότι η ποσότητα του διοξειδίου του άνθρακα που προστίθεται στην ατμόσφαιρα αυξάνεται με ρυθμό 0,3% το χρόνο με συνέπεια να εντείνεται το φαινόμενο του θερμοκηπίου.

Β3. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.47 του σχολικού βιβλίου.

« Ο ΗΙV… έλυτρο.»

Β5. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.48 του σχολικού βιβλίου.

«Αυτές είναι…σεξουαλική επαφή.»

ΘΕΜΑ Γ

Γ1. Οι πληροφορίες για την απάντηση αντλούνται από την σελ.126 κυρίως, αλλά και από την  129 του σχολικού βιβλίου.

Οι δυο πληθυσμοί εμφανίζουν διαφορές στα χαρακτηριστικά τους εξαιτίας της δράσης της Φυσικής Επιλογής  σε αυτούς καθόλη την χρονική περίοδο που αυτοί επιβιώνουν και διαιωνίζονται σε διαφορετικά περιβάλλοντα (στις δυο μικρότερες λίμνες που προέκυψαν μετά το γεωλογικό γεγονός που έλαβε χώρα και που υποθέτουμε ότι οι δυο αυτές νέες λίμνες δεν επιτρέπουν με κανένα τρόπο την επικοινωνία των δυο πληθυσμών που καταμερίστηκαν σε αυτές).

Σύμφωνα με την θεωρία της Φυσικής Επιλογής του Δαρβίνου, η οποία αποτελεί την διαδικασία με την οποία οι οργανισμοί που είναι περισσότερο προσαρμοσμένοι στο περιβάλλον τους επιβιώνουν και αναπαράγονται περισσότερο από τους λιγότερο προσαρμοσμένους, γνωρίζουμε ότι ισχύει:

Συμπέρασμα 1. «Μεταξύ των οργανισμών …επιβίωσης.»

Παρατήρηση 3. « Τα άτομα…μελών τους.»

Παρατήρηση 4. «Τα περισσότερα…απογόνων τους.»

Συνεπώς οδηγούμαστε στο Συμπέρασμα 2. «Η επιτυχία…χαρακτηριστικά.»

« Επειδή οι διαφορές…περιβάλλον.»

Σύμφωνα με τα παραπάνω λοιπόν, καθώς τα άτομα του αρχικού πληθυσμού, ο οποίος μετά το γεωλογικό γεγονός που συνέβη κατανεμήθηκαν, όσα επιβίωσαν, στις μικρότερες, χωρίς να επικοινωνούν μεταξύ τους, νέες λίμνες, εμφάνιζαν ποικιλότητα σε πολλά χαρακτηριστικά τους, πολλά μάλιστα από τα οποία ήταν και κληρονομήσιμα και με δεδομένο ότι στην καθεμιά από τις δυο λίμνες επικρατούσαν διαφορετικές συνθήκες (πιέσεις περιβάλλοντος) που επέτρεπαν διαφορετικές ευκαιρίες επιβίωσης, θα πρέπει διαφορετικοί οργανισμοί (άτομα του πληθυσμού κάθε λίμνης) να επιλεγόταν από την Φυσική Επιλογή ως οι πιο κατάλληλα προσαρμοσμένοι στο εκάστοτε δεδομένο περιβάλλον (χώρο –χρονικά) κάθε λίμνης από τις δυο.

Ανάλογα με τις περιβαλλοντικές πιέσεις που ασκούνταν σε κάθε λίμνη από τις δυο, διαφορετικά άτομα του κάθε  πληθυσμού που βρισκόταν  σε αυτές μπορούσαν να επιβιώσουν ή /και να αναπαραχθούν. Τα άτομα που επιβίωναν και είχαν την δυνατότητα να διαιωνισθούν ήταν εκείνα που στον δεδομένο χρόνο στην κάθε λίμνη έφεραν εκείνα τα χαρακτηριστικά που αποδεικνύονταν περισσότερο προσαρμοστικά για το εκάστοτε περιβάλλον της κάθε λίμνης σε δεδομένο χρόνο. Καθώς όμως διέφεραν οι περιβαλλοντικές πιέσεις από λίμνη σε λίμνη διέφεραν και τα προσαρμοστικά χαρακτηριστικά των ατόμων των δυο πληθυσμών σε κάθε λίμνη στην ίδια χρονική στιγμή.

Γ2.  Οι πληροφορίες για την απάντηση αντλούνται από την σελ.126 και 129 του σχολικού βιβλίου.

Σύμφωνα με την δαρβινική θεωρία για την εξέλιξη των ειδών στον πλανήτη, ισχύει ότι:

Συμπέρασμα 3. «Τα ευνοϊκά…νέου είδους.»

Γνωρίζουμε ότι η φυσική επιλογή δρα επί του πληθυσμού καθώς η συσσώρευση πολλών νέων κληρονομήσιμων χαρακτηριστικών που έχουν εδραιωθεί σε έναν πληθυσμό μέσω διαδοχικών γενεών μπορεί να οδηγήσει τελικά στην εμφάνιση ενός νέου είδους.

Έτσι είναι δυνατόν σε κάθε μια από τις δυο λίμνες να εμφανιστεί ενα νέο είδος, τα δυο αυτά νεα είδη (ένα στην μια λίμνη και ένα στην άλλη), έχουν ως κοινούς προγόνους τα άτομα του αρχικού πληθυσμού που υπήρχε στην λίμνη πριν την γεωλογική δράση που δημιούργησε τις δυο ξεχωριστές λίμνες, στις οποίες κατανεμήθηκαν όσα από τα άτομα του αρχικού πληθυσμού επιβίωσαν αυτού του γεωλογικού γεγονότος.

Γ3.  Οι πληροφορίες για την απάντηση αντλούνται από την σελ. 73 του σχολικού βιβλίου.

Το οικοσύστημα της λίμνης Α καθώς εμφανίζει μεγαλύτερη ποικιλότητα (15 διαφορετικά είδη ψαριών) σε σχέση με το «οικοσύστημα» της λίμνης Β (3 διαφορετικά είδη ψαριών) αναμένεται να είναι περισσότερο ισορροπημένο καθώς γνωρίζουμε ότι «όσο μεγαλύτερη…τρέφονται από αυτό.»

ΘΕΜΑ Δ

Δ1. Σχόλιο: Στο συγκεκριμένο θέμα οι ερμηνείες που αφορούν τις καμπύλες Α και Β εξαρτώνται από δεδομένα που δεν εμφανίζονται στο δοθέν διάγραμμα ούτε διευκρινίζονται στο κείμενο της εκφώνησης του ερωτήματος. Τα δεδομένα αυτά είναι:

Α. Τα επίπεδα των ποσοτήτων των αποικοδομητών και του διαλυμένου οξυγόνου στη λίμνη πριν από την απόρριψη των λυμάτων του ξενοδοχείου. Το δεδομένο αυτό είναι απαραίτητο προκειμένου να είναι δυνατή η αξιόπιστη εκτίμηση των μεταβολών των δυο αυτών ποσοτήτων μετά από την απόρριψη των λυμάτων.

Β. Δεν προσδιορίζεται η απόσταση από το σημείο της απόρριψης των λυμάτων σε σχέση με τη μεταβολή των δυο ποσοτήτων που εξετάζονται, οπότε δεν είναι δυνατόν από τις δοθείσες καμπύλες να εξαχθούν ασφαλή συμπεράσματα καθώς φαίνεται να μένει σταθερά μειωμένη η τιμή της μιας μεταβλητής και σταθερά αυξημένη η τιμή της άλλης μεταβλητής, όσο αυξάνεται η απόσταση απομάκρυνσης από σημείο απόρριψης των λυμάτων. Είναι ωστόσο λογικό να αναμένεται μείωση των ποσοτήτων των λυμάτων αυξανόμενης της απόστασης από το σημείο απόρριψης τους, οπότε θα πρέπει το φαινόμενο της ρύπανσης των υδάτων να εξασθενεί με την απόσταση και να αποκαθίσταται σταδιακά η αρχική ισορροπία που υπήρχε πριν από το σημείο απόρριψης των λυμάτων.

Συνεπώς με βάση τα παραπάνω δεν υπάρχει μονοσήμαντη απάντηση στο ερώτημα ποια καμπύλη εκφράζει την μεταβολή ποιας μεταβλητής.

1η ερμηνεία: Η καμπύλη Α εκφράζει την μεταβολή στην ποσότητα των αποικοδομητών.

Η καμπύλη Β εκφράζει την μεταβολή στην ποσότητα του διαλυμένου οξυγόνου στο ποτάμι.

Αιτιολόγηση: Τα λύματα του ξενοδοχείου που απορρίπτονται στο ποτάμι συνιστούν αστικά λύματα καθώς περιέχουν ουσίες καθημερινής χρήσης όπως π.χ. απορρυπαντικά κ.ά καθώς και παραπροϊόντα του ανθρώπινου μεταβολισμού όπως περιττώματα κ.ά. Τα λύματα αυτά αυξάνουν το μικροβιακό φορτίο στο σημείο απόρριψης τους στο ποτάμι και σε κοντινή απόσταση από αυτό και επομένως αναμένεται εμφάνιση του φαινομένου του ευτροφισμού. « Όσον αφορά το φαινόμενο …ολοένα μικρότερη.» Σελ. 108-109 σχολικό βιβλίο.

2η ερμηνεία: Η καμπύλη Α εκφράζει την μεταβολή στην ποσότητα του διαλυμένου οξυγόνου στο ποτάμι.

Η καμπύλη Β εκφράζει την μεταβολή στην ποσότητα των αποικοδομητών.

Αιτιολόγηση: Στο σημείο του ποταμού όπου απορρίπτονται τα λύματα του ξενοδοχείου  η καμπύλη Α μπορεί να απεικονίζει την ποσότητα του διαλυμένου οξυγόνου που θα πρέπει να είναι μειωμένη σε αυτό το σημείο και κοντά σε αυτό λόγω της υψηλής ποσότητας του μικροβιακού φορτίου των λυμάτων και των αποικοδομητών που αυξάνονται καθώς υπάρχει αρκετή διαθέσιμη τροφή για αυτούς από το περιεχόμενο των λυμάτων. Το  διαλυμένο οξυγόνο όμως πρέπει να αυξάνεται καθώς απομακρυνόμαστε από το σημείο απόρριψης των λυμάτων λόγω αραίωσης των αστικών λυμάτων. Αντίστοιχα η καμπύλη Β μπορεί  απεικονίζει την ποσότητα των αποικοδομητών η οποία θα πρέπει να είναι αυξημένη στο σημείο απόρριψης των αστικών λυμάτων για τους λόγους που αναφέρθηκαν και να μειώνεται στο φυσιολογικό καθώς απομακρυνόμαστε από αυτό.

Δ2.Οι πληροφορίες για την απάντηση αντλούνται από την σελ. 105 του σχολικού βιβλίου.

Η καμπύλη Α εκφράζει την μεταβολή της συγκέντρωσης των οξείδιων του αζώτου, τα οποία συνιστούν πρωτογενείς ρύπους.

Η καμπύλη Β εκφράζει την μεταβολή της συγκέντρωσης του όζοντος στα χαμηλά στρώματα της ατμόσφαιρας οπού συνιστά δευτερογενή ρύπο.

Αιτιολόγηση: «Στην ατμόσφαιρα της Αθηνάς…όζον.»

Για την δημιουργία των δευτερογενών ρύπων όπως είναι και το όζον απαιτείται η παρουσία στην ατμόσφαιρα των πρωτογενών ρύπων όπως είναι τα οξείδια του αζώτου και ηλιοφάνεια ώστε να είναι δυνατή η πραγματοποίηση της αντίδρασης:

πρωτογενείς ρύποι + οξυγόνο της ατμόσφαιρας——–> δευτερογενείς ρύποι.

Λόγω των παραπάνω, παρατηρείται πρώτα αύξηση των οξειδίων του αζώτου (με μέγιστη τιμή περίπου στις 8 πμ που σε μια πόλη όπως είναι η Αθήνα, παρατηρείται αυξημένη κίνηση αυτοκινήτων και παράλληλα έχει ξεκινήσει η λειτουργιά των μηχανών των εργοστασίων) ενώ έπεται η συνακόλουθη αύξηση του όζοντος, που ως προϊόν της αντίδρασης των οξειδίων του αζώτου με το οξυγόνο της ατμόσφαιρας παρουσία της ηλιακής ακτινοβολίας, εμφανίζει μέγιστη τιμή περί τις 4 μμ, οπότε έχει προηγηθεί η μέγιστη τιμή των πρωτογενών ρύπων και η μέγιστη ηλιοφάνεια της ημέρας που σημειώνεται το μεσημέρι.

Δ3.Οι πληροφορίες για την απάντηση αντλούνται από την σελ. 105 του σχολικού βιβλίου.

« τα οξείδια του αζώτου προκαλούν καταστροφές…πρόκληση εμφυσήματος.»

Τα φετινά θέματα της Βιολογίας γενικής παιδείας εμφανίζουν διαβαθμισμένη δυσκολία και απαιτούν από τον μαθητή σφαιρική γνώση της εξεταζόμενης ύλης καθώς και κριτική-συνδυαστική σκέψη, το οποίο πρέπει να είναι άλλωστε και το ζητούμενο των εξετάσεων. Η διατύπωση ορισμένων ερωτημάτων που εγείρει πολλαπλές ερμηνείες έχει ιδιαίτερο ενδιαφέρον καθώς θα πρέπει ο μαθητής να μην σκεφτεί μονοσήμαντα αλλά να σκεφτεί λαμβάνοντας υπόψιν του όλες τις πιθανές ερμηνείες.

Εύχομαι επιτυχία στην συνέχεια των φετινών εξετάσεων σε όλους τους υποψηφίους.

Βιολογία θετικής κατεύθυνσης και γενικής παιδείας – Τι πρέπει να προσέξω για να πετύχω!

α. Λίγο πριν από τις εξετάσεις:

1ο  θέμα

Το πρώτο θέμα συνίσταται από ερωτήσεις κλειστού τύπου, συνήθως πολλαπλής επιλογής ή σπανιότερα σωστού λάθους και ορισμένες φορές απαιτείται αιτιολόγηση της επιλογής σας.

Σε αυτό το θέμα απαντάμε σωστά όταν γνωρίζουμε άριστα την θεωρία της εξεταστέας ύλης του σχολικού βιβλίου.

Είναι σημαντικό, όταν μαθαίνουμε την θεωρία του σχολικού βιβλίου, να μην παραλείπουμε κανένα τμήμα της, ούτε τις λεπτομέρειές που αναφέρονται ακόμα και στις παρενθέσεις του κείμενου και  ειδικότερα για την Βιολογία Θετικού Προσανατολισμού, προσοχή ακόμη και στις εικόνες και στους πίνακες, ενώ τα μπλε (ή πράσινα, αναλόγως την έκδοση του σχολικού βιβλίου) πλαίσια και το ένθετο στο τέλος του σχολικού βιβλίου, περιέχουν χρήσιμες πληροφορίες, που μπορούν να φανούν πολύτιμες, όχι τόσο για το 1ο θέμα, όσο για το 3ο και το 4ο θέμα (βλέπε 3ο θέμα 2012 και  4ο θεμα 2015 Ημερησίων Λυκείων Θετικής κατεύθυνσης).

Μην Ξεχνάτε ότι έχετε και το δικαίωμα να ζητήσετε διευκρίνηση! Βεβαίως, κατά κανόνα, η απάντηση που θα δεχθείτε είναι: » όλα είναι σαφή»! Άλλα, εάν έχετε διατυπώσει το ερώτημα σας με ορθά επιχειρήματα που πηγάζουν άμεσα από την ύλη του σχολικού βιβλίου, πιθανόν να δεχθείτε ουσιαστική απάντηση, που να διευκρινίζει πραγματικά την ερώτησή σας.

2ο θέμα

Το δεύτερο θέμα συνίσταται από ερωτήσεις ανάπτυξής, που αφορούν συνήθως αυτούσια αποσπάσματά του σχολικού βιβλίου. Από το 2014 έχει εισαχθεί και ένας πίνακας αντιστοίχησης, που και πάλι όμως, απαντάται πολύ εύκολα, με βάση την γνώση αυτούσια από την θεωρία του σχολικού βιβλίου.

Συνεπώς και σε αυτό το θέμα, απαντάμε σωστά όταν γνωρίζουμε άριστα την θεωρία του σχολικού βιβλίου.

3ο θέμα

Το τρίτο θέμα συνίσταται συνήθως πριν από το 2011, από συνδυαστικές ερωτήσεις που αφορούν μια ή περισσότερες βιολογικές έννοιές ή φαινόμενα. Μέτα το 2011, αποτελείται κυρίως από ασκήσεις με περισσότερα του ενός υποερωτήματα, συνήθως από το πέμπτο κεφάλαιο ή/και από το δεύτερο κεφάλαιο, αλλά συχνά και από το έκτο κεφάλαιο ή και συνδυασμό αυτών, στην περίπτωση της Βιολογίας θετικού Προσανατολισμού.

Στην Βιολογία Γενικής Παιδείας, οι ασκήσεις του τρίτου θέματος, είναι συνήθως από την ενότητα της Ανοσοβιολογίας ή/και την Οικολογία (ροή ενέργειας ή βιογεωχημικοί κύκλοι ή/και βιοσυσσώρευση), αλλά συχνά και από την εξέλιξη (μετά το 2010, οπότε και η εξέλιξη είναι εντός ύλης).

Για να απαντήσουμε σε αυτό το θέμα, απαιτείται και πάλι άριστη γνώση της ύλης του σχολικού βιβλίου καθώς και να έχουμε κατανοήσει σε βάθος τις έννοιές και τα βιολογικά φαινόμενα που αναφέρονται σε αυτή, ώστε να είμαστε ικανοί, να συνδυάζουμε στην απάντησή μας, εκείνα τα τμήματά του σχολικού βιβλίου που αναφέρονται στην προς εξέτασή έννοια ή φαινόμενο και να αναπτύξουμε με λογική αλληλοδιαδοχή την απάντηση μας.

4ο θέμα

Το τέταρτο θέμα  είναι μια άσκηση με περισσότερα του ενός υποερωτήματα.

Κατά κανόνα αφορά συνηθέστερα  την ύλη του 2ου και του 5ου κεφαλαίου, αλλά και σπανιότερα του 6ου ή του 4ου κεφαλαίου, αλλά συχνά αποτελεί και συνδυασμό ορισμένων από αυτά τα κεφάλαια. Ελάχιστες φορές μόνο, από το 2000 μέχρι και το 2015, υπήρχε ερώτημα που αφορούσε το 8ο κεφάλαιο, ενώ ποτέ δεν υπήρξε ερώτημα από το 1ο το 7ο και το 9ο κεφάλαιο (στα Ημερήσια Λύκεια)  της Βιολογίας θετικού προσανοτολισμού.

Στην Βιολογία Γενικής Παιδείας, οι ασκήσεις του 4ου  θέματος, είναι συνήθως από την ενότητα της Ανοσοβιολογίας ή/και την Οικολογία (ροή ενέργειας ή βιογεωχημικοί κύκλοι ή/και βιοσυσσώρευση), αλλά συχνά και από την εξέλιξη (μετά το 2010, οπότε και η εξέλιξη είναι εντός ύλης).

Για να λύσουμε το θέμα αυτό, χρειάζεται όχι μόνο άριστη γνώση της θεωρίας άλλα και των τύπων των ασκήσεων που βρίσκονται στο σχολικό βιβλίο. Η απάντησή μας πρέπει να περιλαμβάνει τον ορισμό των εννοιών ή των βιολογικών φαινομένων που εξετάζονται από την άσκηση καθώς και την μετά από λογική αλληλουχία συλλογισμών, απόδειξή του ζητουμένου (ομοίως όπως και στο τρίτο θέμα).

Το τέταρτο θέμα συνεπώς, απαιτεί αναλυτική και συνθετική ικανότητά από τον μαθητή προκείμενου να απαντηθεί σωστά, επομένως θα πρέπει να εστιάσετε την προσοχή σας στην κατανόηση της θεωρίας και στην γνώση της μεθοδολογίας για την λύση των ασκήσεων.

Μην ξεχνάτε!

Στο μάθημά της Βιολογίας, σπουδαίο ρολό παίζει η σωστή και πολύ προσεκτική διατύπωση, ιδιαίτερα καθώς μια λέξη ή ακόμη και ένα γράμμα (π. χ. DNA αντί για RNA στη μεταγραφή ή στο γενετικό υλικό του ιού HIV) είναι δυνατό να οδηγήσει σε εσφαλμένη απάντηση.

Οι απαντήσεις μας πρέπει να διέπονται από ακρίβειά και σαφήνεια!

Δεν είναι αναγκαία η πίστη αναπαραγωγή τμημάτων του σχολικού βιβλίου, εφόσον ο μαθητής είναι ικανός να διατυπώσει την απάντησή του με λόγο ορθά επιστημονικό και η απάντησή του είναι πλήρης, καλύπτοντας τουλάχιστον όσα αναφέρει το σχολικό βιβλίο για όσα ζητούνται από την ερώτησή.

Οι απαντήσεις πρέπει να περιορίζονται εντός των πλαισίων της εξεταστέας ύλης του σχολικού βιβλίου. Ενίοτε, τα δεδομένα της άσκησης μπορεί να έρχονται σε αντίθεση με την γνώση του σχολικού βιβλίου!!! (βλέπε θέματα Ημερησίων Λυκείων 2014-2015 4ο θέμα Βιολογία Θετικής κατεύθυνσης), ακόμη  και σε αυτή την περίπτωση, οι απαντήσεις πρέπει να περιοριορίζονται εντός της εξεταστέας ύλης από το σχολικό εγχειρίδιο, επισημαίνοντας τα τμήματα του σχολικού βιβλίου που υποστηρίζουν την απάντηση σας ακόμα και αν έρχονται σε διάσταση, με τα ατυχώς δοσμένα δεδομένα της ερώτησης-άσκησης.

 

β. Κατά την διάρκειά των εξετάσεων:

1.  Διαβάζουμε προσεκτικά όλα τα θέματα και επιλέγουμε να ξεκινήσουμε να απαντάμε από εκείνα που γνωρίζουμε καλύτερα. Όσα μας δυσκολεύουν τα αφήνουμε τελευταία.

2.  Όταν ξεκινήσουμε να απαντάμε μια ερώτηση, την διαβάζουμε πολύ προσεκτικά ώστε να προσέξουμε όλες τις λεπτομέρειές της και βρισκόμαστε σε διαρκή επαφή μαζί της (διαβάζοντάς την ξανά και ξανά) ώστε να μη μας διαφύγει τίποτα από όσα ζητούνται, αλλά και να έχουμε κατανοήσει και συγκρατήσει καλά στην μνήμη μας κάθε λεπτομέρεια από τα δεδομένα. Όταν τελειώσουμε την απάντησή μας, ξαναδιαβάζουμε την ερώτηση και την απάντησή μας, ελέγχοντας ότι δεν έχουμε παραλείψει κανένα υποερώτημα και διορθώνουμε τυχόν λάθη μας.

3.  Οι απαντήσεις μας ως προς το περιεχόμενό τους:

  • Φροντίζουμε να είναι πλήρεις εξαντλώντας όλα τα στοιχεία που ζητούνται και τα οποία είναι δυνατόν να βρίσκονται σε διαφορετικά σημεία του βιβλίου.
  • Στο πρόβλημα πρέπει να αναπτύξουμε με σαφήνεια όλες τις πιθανές περιπτώσεις που είναι δυνατόν να υπάρχουν.

4.  Οι απαντήσεις μας ως προς την έκφρασή τους:

Φροντίζουμε να χαρακτηρίζονται από ακρίβεια και σαφήνεια ενώ κάθε μας σκέψη πρέπει να απορρέει λογικά από την προηγούμενη ώστε στο κείμενο να υπάρχει λογική αλληλουχία.

5.  Πριν παραδώσουμε το γραπτό μας είναι απαραίτητο να διαβάσουμε τουλάχιστον άλλη μια φορά τα θέματα και να εξετάσουμε πολύ σχολαστικά τις απαντήσεις μας  σε συσχετισμό με τις ερωτήσεις.

Εύχομαι επιτυχία και ανταμοιβή των κόπων σας !!!

 

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2000

ΒΙΟΛΟΓΙΑΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑ 1o

Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

1. Σε μια συνεχή καλλιέργεια η ανάπτυξη των μικροοργανισμών βρίσκεται διαρκώς σε:

α. λανθάνουσα φάση

β. στατική φάση

γ. εκθετική φάση

δ. φάση θανάτου

Mονάδες 5

2. Το πλασμίδιο Ti χρησιμοποιείται στη διαδικασία:

α. δημιουργίας διαγονιδιακών ζώων

β. δημιουργίας διαγονιδιακών φυτών

γ. παραγωγής ιντερφερόνης

δ. παραγωγής ινσουλίνης

Mονάδες 5

3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

α. γραμμικό δίκλωνο DNA

β. γραμμικό μονόκλωνο DNA

γ. κυκλικό δίκλωνο DNA

δ. κυκλικό μονόκλωνο DNA

Mονάδες 5

4. Στη μικροέγχυση χρησιμοποιούνται:

α. Τ-λεμφοκύτταρα

β. μετασχηματισμένα βακτήρια

γ. γονιμοποιημένα ωάρια ζώων

δ. καρκινικά κύτταρα

Mονάδες 5

5. Οι περιοριστικές ενδονουκλεάσες:

α. συμμετέχουν στην ωρίμανση του RNA

β. είναι απαραίτητες για την έναρξη της αντιγραφής

γ. συμμετέχουν στη μεταγραφή του DNA

δ. κόβουν το DNA σε καθορισμένες θέσεις

Mονάδες 5

ΘΕΜΑ 2o

Να απαντήσετε στις παρακάτω ερωτήσεις:

Α. Η διαδικασία της αντιγραφής του DNA χαρακτηρίζεται από μεγάλη ταχύτητα και ακρίβεια, που οφείλεται κυρίως στη δράση ενζύμων και συμπλόκων ενζύμων.

1. Ποια από τα παρακάτω συμμετέχουν στην αντιγραφή του DNA: DNA πολυμεράσες, DNA ελικάσες, περιοριστικές ενδονουκλεάσες, πριμόσωμα, επιδιορθωτικά ένζυμα, DNA δεσμάση;

Mονάδες 5

2. Να γράψετε ονομαστικά τα ένζυμα που παίρνουν μέρος στην επιδιόρθωση του DNA.

Mονάδες 5

B.

1. Πότε ένας μικροοργανισμός χαρακτηρίζεται υποχρεωτικά αερόβιος;

Mονάδες 5

2. Τι είναι το πολύσωμα;

Mονάδες 5

3. Ποια κωδικόνια ονομάζονται συνώνυμα;

Mονάδες 5

ΘΕΜΑ 3o

Η Βιοτεχνολογία συμβάλλει αποτελεσματικά στην έγκαιρη διάγνωση, πρόληψη και θεραπεία διαφόρων ασθενειών.

1. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Mονάδες 9

2. Να γράψετε τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Mονάδες 9

3. Να περιγράψετε τη διαδικασία παραγωγής των εμβολίων υπομονάδων.

Mονάδες 7

Ένα ανθρώπινο σωματικό κύτταρο έχει 46 χρωμοσώματα.

Α. 1. Πόσα μόρια DNA συνολικά υπάρχουν στα χρωμοσώματα του συγκεκριμένου κυττάρου, στα στάδια της μετάφασης της μίτωσης;

Mονάδες 2

2. Να δικαιολογήσετε την απάντησή σας.

Mονάδες 4

Β. Να περιγράψετε τις χαρακτηριστικές μορφές, με τις οποίες εμφανίζεται το γενετικό υλικό ενός ευκαρυωτικού κυττάρου, ανάλογα με το στάδιο του κυτταρικού κύκλου που βρίσκεται.

Mονάδες 9

Γ. Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων:

5΄ TCA CGG AAT TTC TAG CAT 3΄

1. Με δεδομένο ότι δε μεσολαβεί στάδιο ωρίμανσης, να γράψετε το m-RNA που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος DNA, σημειώνοντας ταυτόχρονα τη θέση του 5΄ και 3΄ άκρου του m-RNA.

Mονάδες 3

2. Nα γραφούν τα αντικωδικόνια των t-RNA με τη σειρά που συμμετέχουν στη μετάφραση του παραπάνω m-RNA.

Mονάδες 7

 

ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2000

ΘΕΜΑ 1o

Οι σωστές απαντήσεις είναι:

1. γ

Σημείωση: Η συνεχής καλλιέργεια μικροοργανισμών εμφανίζει συνήθως στην αρχή

λανθάνουσα φάση και κατόπιν ακολουθεί η εκθετική φάση.

2. β

3. γ

4. γ

5. δ

Σημείωση: Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν και κόβουν καθορισμένες δίκλωνες αλληλουχίες DNA τεσσάρων με οκτώ ζευγών νουκλεοτιδίων.

ΘΕΜΑ 2o

Α. 1. Όλα εκτός από τις περιοριστικές ενδονουκλεάσες. Η διαδικασία της αντιγραφής, όπως υποδηλώνεται από τη δομή της διπλής έλικας και τον ημισυντηρητικό μηχανισμό, φαίνεται απλή. Όμως, ύστερα από πολύχρονη ερευνητική μελέτη, διαπιστώθηκε ότι η διαδικασία στην πραγματικότητα είναι ιδιαίτερα πολύπλοκη. Τα κύτταρα διαθέτουν ένα σημαντικό «οπλοστάσιο» εξειδικευμένων ενζύμων και άλλων πρωτεϊνών, που λειτουργούν ταυτόχρονα και καταλύουν τις χημικές αντιδράσεις της αντιγραφής με μεγάλη ταχύτητα και με εκπληκτική ακρίβεια. Η αντιγραφή του DNA αρχίζει από καθορισμένα σημεία που ονομάζονται θέσεις έναρξης της αντιγραφής. Για να αρχίσει η αντιγραφή του DNA, είναι απαραίτητο να ξετυλιχθούν στις θέσεις έναρξης της αντιγραφής οι δύο αλυσίδες. Αυτό επιτυγχάνεται με τη βοήθεια ειδικών ενζύμων, που σπάζουν τους δεσμούς υδρογόνου μεταξύ των δύο αλυσίδων. Τα ένζυμα αυτά ονομάζονται DNA ελικάσες. Όταν ανοίξει η διπλή έλικα, δημιουργείται μια «θηλιά» η οποία αυξάνεται και προς τις δύο κατευθύνσεις. Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA ονομάζονται DNA πολυμεράσες. Επειδή τα ένζυμα αυτά δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. DNA πολυμεράσες επιμηκύνουν τα πρωταρχικά τμήματα, τοποθετώντας συμπληρωματικά δεοξυριβονουκλεοτίδια απέναντι από τις μητρικές αλυσίδες του DNA. DNA πολυμεράσες επιδιορθώνουν επίσης λάθη που συμβαίνουν κατά τη διάρκεια της αντιγραφής. Μπορούν, δηλαδή, να «βλέπουν» και να απομακρύνουν νουκλεοτίδια που οι ίδιες τοποθετούν, κατά παράβαση του κανόνα της συμπληρωματικότητας, και να τοποθετούν τα σωστά. Ταυτόχρονα DNA πολυμεράσες απομακρύνουν τα πρωταρχικά τμήματα RNA και τα αντικαθιστούν με τμήματα DNA. Kάθε νεοσυντιθέμενη αλυσίδα θα έχει προσανατολισμό 5΄→3΄. Έτσι, σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες θα είναι αντιπαράλληλες. Για να ακολουθηθεί αυτός ο κανόνας σε κάθε τμήμα DNA που γίνεται η αντιγραφή, η σύνθεση του DNA είναι συνεχής στη μια αλυσίδα και ασυνεχής στην άλλη. Τα κομμάτια της ασυνεχούς αλυσίδας συνδέονται μεταξύ τους με τη βοήθεια ενός ενζύμου, που ονομάζεται DNA δεσμάση. Το ίδιο ένζυμο συνδέει και όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής. Η αντιγραφή του DNA είναι απίστευτα ακριβής, μόνο ένα νουκλεοτίδιο στα 100.000 μπορεί να ενσωματωθεί λάθος. Τα λάθη που δεν επιδιορθώνονται από τις DNA πολυμεράσες, επιδιορθώνονται σε μεγάλο ποσοστό από ειδικά επιδιορθωτικά ένζυμα. Έτσι ο αριθμός των λαθών περιορίζεται στους ευκαρυωτικούς οργανισμούς στο ένα στα 1010!

Οι περιοριστικές ενδονουκλεάσες παράγονται από βακτήρια και ο φυσιολογικός τους ρόλος είναι να τα προστατεύουν από την εισβολή «ξένου» DNA. Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν και κόβουν σε συγκεκριμένες θέσεις ειδικές αλληλουχίες 4-8 νουκλεοτιδίων στο δίκλωνο DNA.

2. Τα ένζυμα που παίρνουν μέρος στην επιδιόρθωση του DNA είναι οι DNA πολυμεράσες και τα ειδικά επιδιορθωτικά ένζυμα.

Β. 1. Ο ρυθμός ανάπτυξης ενός πληθυσμού μικροοργανισμών, δηλαδή ο ρυθμός με τον οποίο διαιρούνται τα κύτταρα του, καθορίζεται από το χρόνο διπλασιασμού. Κάθε είδος μικροοργανισμού έχει χαρακτηριστικό χρόνο διπλασιασμού. Οι παράγοντες που επηρεάζουν το χρόνο διπλασιασμού και συνεπώς το ρυθμό ανάπτυξης των μικροοργανισμών, είναι η διαθεσιμότητα των θρεπτικών συστατικών, το pH, το Ο2 και η θερμοκρασία. Η παρουσία ή απουσία O2 μπορεί να βοηθήσει ή να αναστείλει την ανάπτυξη των μικροοργανισμών. Υπάρχουν μικροοργανισμοί που για την ανάπτυξή τους απαιτούν υψηλή συγκέντρωση O2 (υποχρεωτικά αερόβιοι) όπως τα βακτήρια του γένους Mycobacterium.

2. Η μετάφραση του mRNA, δηλαδή η αντιστοίχιση των κωδικονίων σε αμινοξέα και η διαδοχική σύνδεση των αμινοξέων σε πολυπεπτιδική αλυσίδα, πραγματοποιείται στα ριβοσώματα με τη βοήθεια των tRNA και τη συμμετοχή αρκετών πρωτεϊνών και ενέργειας. Ένα από τα στάδια της ρύθμισης της έκφρασης της γενετικής πληροφορίας σε επίπεδο μετάφρασης, είναι ότι πολλά ριβοσώματα μπορούν να μεταφράζουν ταυτόχρονα ένα mRNA, το καθένα σε διαφορετικό σημείο κατά μήκος του μορίου. Αμέσως μόλις το ριβόσωμα έχει μεταφράσει τα πρώτα κωδικόνια, η θέση έναρξης του mRNA είναι ελεύθερη για την πρόσδεση ενός άλλου ριβοσώματος. Το σύμπλεγμα των ριβοσωμάτων με το mRNA ονομάζεται πολύσωμα. Έτσι, η πρωτεϊνοσύνθεση είναι μία «οικονομική διαδικασία». Ένα κύτταρο μπορεί να παραγάγει μεγάλα ποσά μιας πρωτεΐνης από ένα ή από δύο αντίγραφα ενός γονιδίου.

3. Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο mRNA με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η αλληλουχία των βάσεων του mRNA καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση ένα κώδικα αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. Ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος. Με εξαίρεση δύο αμινοξέα (μεθειονίνη και τρυπτοφάνη) τα υπόλοιπα 18 κωδικοποιούνται από δύο μέχρι και έξι διαφορετικά κωδικόνια. Τα κωδικόνια που κωδικοποιούν το ίδιο αμινοξύ ονομάζονται συνώνυμα.

ΘΕΜΑ 3o

1. Τα αντισώματα είναι πρωτεϊνικά μόρια, που παράγονται από τα Β-λεμφοκύτταρα του ανοσοποιητικού μας συστήματος, όταν ένα αντιγόνο (παθογόνος μικροοργανισμός, ιός ή ξένο υλικό) προσβάλλει τον οργανισμό. Τα αντισώματα αντιδρούν με το αντιγόνο και το εξουδετερώνουν.

Ο οργανισμός μας είναι ικανός να παράγει αντισώματα εναντίον κάθε ξένου αντιγόνου. Στην πραγματικότητα, ένα αντίσωμα αναγνωρίζει μόνο μία περιοχή του αντιγόνου, η οποία ονομάζεται αντιγονικός καθοριστής. Ένα μεγάλο αντιγόνο, π.χ. ένας μικροοργανισμός, έχει πολλούς αντιγονικούς καθοριστές γι’ αυτό παράγονται πολλά είδη αντισωμάτων εναντίον του.

Κάθε είδος αντισώματος που αναγνωρίζει ένα αντιγονικό καθοριστή παράγεται από μία ομάδα όμοιων Β-λεμφοκυττάρων, που αποτελούν ένα κλώνο. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων ονομάζονται μονοκλωνικά.

Τα μονοκλωνικά αντισώματα είναι πολύ σημαντικά στην Ιατρική και χρησιμοποιούνται ως διαγνωστικά για την ανίχνευση ασθενειών ή ως εξειδικευμένα φάρμακα εναντίον παθογόνων μικροοργανισμών ή ακόμη εναντίον καρκινικών κυττάρων. Ήταν, επομένως σημαντικό να γίνει δυνατή η παραγωγή τους στο εργαστήριο σε μεγάλες ποσότητες. Όμως τα Β-λεμφοκύτταρα δεν επιβιώνουν για πολύ έξω από το σώμα και δε μπορούν να διατηρηθούν σε κυτταροκαλλιέργειες. Την ιδιότητα αυτή την αποκτούν ύστερα από σύντηξη με καρκινικά κύτταρα. Τα υβριδικά κύτταρα που παράγονται ονομάζονται υβριδώματα και μπορούν να παράγουν μεγάλες ποσότητες ενός μονοκλωνικού αντισώματος. Η τεχνική της παραγωγής μονοκλωνικών αντισωμάτων αναπτύχθηκε το 1975 και ακολουθεί την εξής διαδικασία: Ένα επιλεγμένο αντιγόνο χορηγείται με ένεση σε ποντίκι και προκαλεί ανοσολογική αντίδραση με αποτέλεσμα να αρχίσει η παραγωγή αντισωμάτων από εξειδικευμένα Β-λεμφοκύτταρα. Ύστερα από δύο εβδομάδες αφαιρείται ο σπλήνας και απομονώνονται τα Β-λεμφοκύτταρα. Τα κύτταρα αυτά συντήκονται με καρκινικά κύτταρα και παράγονται τα υβριδώματα που παράγουν μονοκλωνικά αντισώματα. Τα υβριδώματα μπορούν να φυλάσσονται για μεγάλα χρονικά διαστήματα στην κατάψυξη (-80ο C) και να παράγουν οποιαδήποτε στιγμή το συγκεκριμένο μονοκλωνικό αντίσωμα σε μεγάλες ποσότητες.

2. Τα ζώα που έχουν υποστεί γενετική αλλαγή με τη χρήση μεθόδων της Γενετικής Μηχανικής ονομάζονται διαγονιδιακά. Τα διαγονιδιακά ζώα χρησιμοποιούνται για την παραγωγή χρήσιμων φαρμακευτικών πρωτεϊνών σε μεγάλη ποσότητα. Σήμερα είναι δυνατή η παραγωγή πρωτεϊνών, όπως η ινσουλίνη και η ανθρώπινη αυξητική ορμόνη, από βακτήρια. Οι πρωτεΐνες αυτές χρησιμοποιούνται για τη θεραπεία διαφόρων ασθενειών. Στις περισσότερες όμως περιπτώσεις οι πρωτεΐνες αυτές δεν είναι ακριβώς ίδιες με τις πρωτεΐνες του ανθρώπου, επειδή τα βακτήρια δε διαθέτουν τους μηχανισμούς τροποποίησης των πρωτεϊνών που διαθέτουν οι ευκαρυωτικοί οργανισμοί. Μια πολλά υποσχόμενη ιδέα είναι η παραγωγή φαρμακευτικών πρωτεϊνών από κύτταρα των μαστικών αδένων των ζώων, για παράδειγμα των προβάτων και των αγελάδων. Με αυτό τον τρόπο θα είναι δυνατή η συλλογή της πρωτεΐνης από το γάλα των ζώων. Αυτός ο τρόπος παραγωγής ονομάζεται παραγωγή φαρμακευτικών πρωτεϊνών από διαγονιδιακά ζώα (gene pharming). Συνοπτικά, θα μπορούσαμε να αναφέρουμε ότι τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο είναι τα παρακάτω:

• Απομόνωση του ανθρώπινου γονιδίου που κωδικοποιεί τη φαρμακευτική πρωτεΐνη που μας ενδιαφέρει.

• Μικροέγχυση του γονιδίου στον πυρήνα ενός γονιμοποιημένου ωαρίου του ζώου.

• Τοποθέτηση του γενετικά τροποποιημένου ζυγωτού στη μήτρα ενήλικου ζώου για κυοφορία.

• Γέννηση του διαγονιδιακού ζώου.

• Διασταυρώσεις με σκοπό να περάσει η τροποποιημένη γενετική πληροφορία στους απογόνους.

• Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

3. Εκτός σημερινής εξεταστέας ύλης. Εντούτοις, το θέμα απαντάται στη σελ. 121 του σχολικού βιβλίου: “Η παραγωγή των εμβολίων-υπομονάδων … ως εμβόλιο.”.

ΘΕΜΑ 4o

Α. 1. Στο στάδιο της μετάφασης της μίτωσης θα υπάρχουν 92 μόρια DNA, σε ένα ανθρώπινο σωματικό κύτταρο που διαιρείται.

2. Στο στάδιο της μετάφασης της μίτωσης καθένα από τα 46 χρωμοσώματα του ανθρώπινου κυττάρου αποτελείται από δύο αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο. Καθεμία από τις δύο αδελφές χρωματίδες του χρωμοσώματος συνιστά ένα μόριο DNA, όπως και κάθε ινίδιο χρωματίνης κατά τη μεσόφαση του κυτταρικού κύκλου αποτελεί ένα μόριο DNA. Όμως τα ινίδια της χρωματίνης διπλασιάζονται στη μεσόφαση κατά τη διάρκεια της αντιγραφής του DNA, συσπειρώνονται και εμφανίζονται ως αδελφές χρωματίδες των χρωμοσωμάτων στη μίτωση. Επομένως, στη μετάφαση το κάθε χρωμόσωμα αποτελείται από δύο μόρια DNA. Άρα στα 46 χρωμοσώματα συνολικά υπάρχουν 92 μόρια DNA.

Β. Αν παρατηρήσουμε το γενετικό υλικό ενός ευκαρυωτικού σωματικού κυττάρου, βλέπουμε ότι εμφανίζεται με διαφορετικές χαρακτηριστικές μορφές, ανάλογα με το στάδιο του κυτταρικού κύκλου. Κατά τη μεσόφαση το γενετικό υλικό έχει μικρό βαθμό συσπείρωσης και σχηματίζει δίκτυο ινιδίων χρωματίνης. Κατά συνέπεια τα ινίδια χρωματίνης δεν είναι ορατά ως μεμονωμένες δομές, με το οπτικό μικροσκόπιο. Με το τέλος της αντιγραφής κάθε ινίδιο χρωματίνης έχει διπλασιαστεί. Τα δύο αντίγραφα κάθε ινιδίου συνδέονται μεταξύ τους με μια δομή που ονομάζεται κεντρομερίδιο.

Ο όρος αδελφές χρωματίδες χρησιμοποιείται για να περιγράψει τα διπλασιασμένα χρωμοσώματα κατά το χρονικό διάστημα που είναι συνδεδεμένα στο κεντρομερίδιο. Στην κυτταρική διαίρεση οι αδελφές χρωματίδες συσπειρώνονται και, κατά το στάδιο της μετάφασης, αποκτούν μέγιστο βαθμό συσπείρωσης. Στο στάδιο αυτό ο υψηλός βαθμός συσπείρωσης καθιστά τα μεταφασικά χρωμοσώματα ευδιάκριτα και έτσι είναι εύκολο να παρατηρηθούν με το οπτικό μικροσκόπιο. Στο τέλος της κυτταρικής διαίρεσης προκύπτουν δύο νέα κύτταρα, γενετικά όμοια μεταξύ τους και με το αρχικό, αφού το καθένα περιέχει τη μία από τις δύο «πρώην» αδελφές χρωματίδες από κάθε χρωμόσωμα.

Θα μπορούσαμε να πούμε ότι τα ινίδια της χρωματίνης, τα χρωμοσώματα και οι χρωματίδες αποτελούν «διαφορετικές όψεις του ίδιου νομίσματος». Τα ινίδια της χρωματίνης διπλασιάζονται στη μεσόφαση και «μετατρέπονται» σε αδελφές χρωματίδες, οι οποίες γίνονται ευδιάκριτες στην κυτταρική διαίρεση. Κατά το τέλος της κυτταρικής διαίρεσης αποχωρίζονται πλήρως, αποσυσπειρώνονται σταδιακά και «μετατρέπονται» πάλι σε ινίδια χρωματίνης στο μεσοφασικό πυρήνα των νέων κυττάρων κ.ο.κ. Παρ’όλες όμως τις μορφολογικές αυτές μεταβολές η χημική σύσταση του γενετικού υλικού παραμένει αμετάβλητη.

Γ. 1. Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο RNA με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η μεταγραφή του DNA σε mRNA γίνεται για τα γονίδια που κωδικοποιούν για πεπτίδια και πραγματοποιείται με προσανατολισμό 5΄→3΄, καθώς η RNA πολυμεράση συνθέτει το mRNA δημιουργώντας 3΄→5΄ φωσφοδιεστερικό δεσμό μεταξύ του τελευταίου ριβονουκλεοτιδίου του αναπτυσσόμενου mRNA και του επόμενου ριβονουκλεοτιδίου που πρόκειται να συνδεθεί με αυτό όπως καθορίζεται από τον κανόνα της συμπληρωματικότητας με τον μεταγραφόμενο (μη κωδικό) κλώνο του γονιδίου. Ο κλώνος λοιπόν του mRNA που παράγεται είναι αντιπαράλληλος με το μεταγραφόμενο κλώνο του DNA, εφόσον ο κλώνος του mRNA συντίθεται με προσανατολισμό 5΄→3΄, ο μεταγραφόμενος κλώνος του DNA “διαβάζεται” με προσανατολισμό από 3΄ προς το 5΄ άκρο ως προς τον υποκινητή του γονιδίου. Ξαναγράφουμε το τμήμα του μεταγραφόμενου κλώνου του DNA που δίνεται, από το άκρο 3΄ προς το άκρο 5΄.

DNA: 3΄ …TAC GAT CTT TAA GGC ACT… 5΄

Επομένως η αλληλουχία του παραγόμενου mRNA είναι:

mRNA: 5΄…AUG CUA GAA AUU CCG UGA… 3΄

(Παρατηρούμε το κωδικόνιο έναρξης 5΄AUG3΄ στη θέση της 1ης τριπλέτας και το κωδικόνιο λήξης 5΄UGA3΄ στη θέση της τελευταίας τριπλέτας).

2. Με τη μετάφραση του mRNA πραγματοποιείται αντιστοίχιση των κωδικονίων σε αμινοξέα και διαδοχική σύνδεση των αμινοξέων σε πεπτιδική αλυσίδα. Η μετάφραση πραγματοποιείται στα ριβοσώματα με τη βοήθεια των tRNA και τη συμμετοχή αρκετών πρωτεϊνών και ενεργείας. Κάθε μόριο tRNA που συμμετέχουν στη μετάφραση του συγκεκριμένου mRNA έχει μια ειδική τριπλέτα νουκλεοτιδίων, το αντικωδικόνιο, με την οποία προσδένεται, λόγω συμπληρωματικότητας, με το αντίστοιχο κωδικόνιο του mRNA.

Κάθε κωδικόνιο του mRNA έχει ένα συμπληρωματικό αντικωδικόνιο εκτός από το κωδικόνιο λήξης για το οποίο δεν υπάρχει αντικωδικόνιο και συνεπώς tRNA. Επομένως, τα αντικωδικόνια των tRNA που συμμετέχουν στη μετάφραση του συγκεκριμένου mRNA θα είναι (με τη σειρά των κωδικονίων του mRNA που αναγράφονται παραπάνω):

3΄UAC5΄, 3΄GAU5΄, 3΄CUU5΄, 3΄UAA5΄, 3΄GGC5΄

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2008 – ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑ 1ο

Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

1. Ο πνευμονιόκοκκος, τα δύο στελέχη του οποίου χρησιμοποίησε ο Griffith στο γνωστό πείραμα, είναι:

α. μύκητας.

β. βακτήριο.

γ. ιός.

δ. πρωτόζωο.

Μονάδες 5

2. Η ομάδα αίματος του ανθρώπου ελέγχεται από:

α. πολλαπλά αλληλόμορφα, όλα ισοεπικρατή.

β. δύο αλληλόμορφα με σχέση υποτελούς-επικρατούς.

γ. δύο υπολειπόμενα και ένα επικρατές.

δ. δύο συνεπικρατή γονίδια και ένα υπολειπόμενο.

Μονάδες 5

3. Η μεταγραφή στα προκαρυωτικά κύτταρα πραγματοποιείται:

α. στον πυρήνα.

β. στο κυτταρόπλασμα.

γ. στα μιτοχόνδρια.

δ. στο κυτταρικό τοίχωμα.

Μονάδες 5

4. Οι περιοριστικές ενδονουκλεάσες:

α. είναι απαραίτητες για την έναρξη της μεταγραφής.

β. κόβουν τις πολυνουκλεοτιδικές αλυσίδες του RNA σε ειδικές θέσεις.

γ. περιορίζουν τη μεταγραφή του DNA.

δ. κόβουν το DNA σε ειδικές θέσεις.

Μονάδες 5

5. Τα ζώα, που έχουν υποστεί γενετική τροποποίηση λέγονται:

α. πολυγενετικά.

β. διαγονιδιακά.

γ. πολυπλοειδικά.

δ. πολυγονικά.

Μονάδες 5

ΘΕΜΑ 2ο

Να απαντήσετε στις παρακάτω ερωτήσεις:

1. Πώς αναστέλλεται η δράση των ογκοκατασταλτικών γονιδίων; Να αναφέρετε ένα χαρακτηριστικό παράδειγμα.

Μονάδες 5

2. Πώς ονομάζεται η αλλαγή που παρουσιάζεται στον καρυότυπο ενός ανθρώπου, όταν εμφανίζεται ένα επιπλέον χρωμόσωμα 21 και πώς προκύπτει αυτό;

Μονάδες 8

3. Πώς συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος στη μελέτη της εξέλιξής του και στη μαζική παραγωγή προϊόντων;

Μονάδες 7

4. Πώς χρησιμοποιείται ο όρος αδελφές χρωματίδες, σε ποιο στάδιο της κυτταρικής διαίρεσης εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και πώς μοιράζονται στα δύο νέα κύτταρα;

Μονάδες 5

ΘΕΜΑ 3ο

Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία με την οποία ένα γονίδιο ενεργοποιείται για να παραγάγει μία πρωτεΐνη.

1. Πού αποσκοπεί κυρίως η ρύθμιση αυτή στην περίπτωση των βακτηρίων;

Μονάδες 5

2. Τα κύτταρα ενός ευκαρυωτικού πολύπλοκου οργανισμού, όπως τα νευρικά και τα μυϊκά, αν και έχουν το ίδιο γενετικό υλικό, διαφέρουν στη μορφή και τη λειτουργία. Πώς ονομάζεται αυτή η διαδικασία εξειδίκευσης και τι κάνει τα κύτταρα να διαφέρουν τόσο πολύ;

Μονάδες 8

3. Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Ποια είναι τα ρυθμιστικά στοιχεία της μεταγραφής του DNA, ποιο το ένζυμο που καταλύει τη μεταγραφή και πώς λειτουργεί αυτό κατά τη γονιδιακή ρύθμιση στο επίπεδο της μεταγραφής των ευκαρυωτικών οργανισμών;

Μονάδες 12

ΘΕΜΑ 4ο

Σε μια θέση τμήματος μορίου DNA με κλώνους Α και Β, έχει ξεκινήσει η αντιγραφή, όπως φαίνεται στο παρακάτω σχήμα.

Η DNA-δεσμάση εκτός του ότι συνδέει όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής, δρα κατά την αντιγραφή του κλώνου Β. Σε κάθε κλώνο να συμπληρώσετε τον προσανατολισμό της αντιγραφής και να χαρακτηρίσετε τον τρόπο σύνθεσης των νέων αλυσίδων DNA (Μονάδες 4). Ποιά ένζυμα τοποθετούν τα συμπληρωματικά νουκλεοτίδια και ποιους άλλους ρόλους έχουν; (Μονάδες 7).

Στην κωδική αλυσίδα Α το γονίδιο, που είναι υπεύθυνο για την παραγωγή ενός πεπτιδίου, έχει την εξής αλληλουχία βάσεων:

5΄… ATG CCA TGC AAA CCG AAA TGA …3΄

Να γράψετε την αλληλουχία του mRNA που προκύπτει (Μονάδες 2).

Κάποια αλλαγή που συνέβη στην παραπάνω κωδική αλυσίδα του DNA, έχει ως αποτέλεσμα το 4ο κωδικόνιο στο μεταγραφόμενο mRNA να έχει τις βάσεις UAA και ο αριθμός των κωδικονίων να παραμένει σταθερός. Αφού γράψετε το νέο mRNA που προκύπτει, να εξηγήσετε ποια είναι η συγκεκριμένη αλλαγή που συνέβη και τι συνέπειες μπορεί να έχει για το πεπτίδιο; (Μονάδες 8).

Γιατί η πρωτεϊνοσύνθεση στους ευκαρυωτικούς οργανισμούς είναι μια «οικονομική διαδικασία»; (Μονάδες 4).

Μονάδες 25

 

 

ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2008

ΘΕΜΑ 1o

Οι σωστές απαντήσεις είναι:

1. β

2. δ

3. β

4. δ

Σημείωση: Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν και κόβουν δίκλωνες αλ-

ληλουχίες DNA.

5. β

ΘΕΜΑ 2o

1. Τα γονίδια αποτελούν τις λειτουργικές μονάδες της κληρονομικότητας. Στα γονίδια περιέχονται οι γενετικές πληροφορίες που καθορίζουν όλα τα χαρακτηριστικά ενός οργανισμού.

Τα γονίδια αποτελούν τμήματα του DNA του οργανισμού με συγκεκριμένη ακολουθία νουκλεοτιδίων.

Ο καρκίνος χαρακτηρίζεται από τον ανεξέλεγκτο πολλαπλασιασμό των κυττάρων ενός ιστού. Αυτά σχηματίζουν μάζες κυττάρων (καρκινικοί όγκοι) ή μεταναστεύουν στο αίμα όπως στις διάφορες μορφές λευχαιμιών. Αποτελέσματα μελετών έχουν οδηγήσει στο συμπέρασμα ότι σχεδόν όλες οι περιπτώσεις καρκίνου προέρχονται από μεταλλάξεις γονιδίων σωματικών κυττάρων.

Υπάρχουν δύο τύποι γονιδίων που σχετίζονται με την εμφάνιση καρκίνου. Τα ογκογονίδια και τα ογκοκατασταλτικά γονίδια. Σχετικές έρευνες οδηγούν στο συμπέρασμα ότι ο καρκίνος σε γενετικό επίπεδο είναι το αποτέλεσμα:

• Μετατροπής πρωτο-ογκογονιδίων σε ογκογονίδια.

• Απουσίας λειτουργικότητας των ογκοκατασταλτικών γονιδίων και

• Αδρανοποίησης των μηχανισμών επιδιόρθωσης του DNA.

Τα ογκοκατασταλτικά γονίδια είναι γονίδια που ελέγχουν την κυτταρική διαίρεση, καταστέλλοντάς την, όποτε είναι απαραίτητο. Η αναστολή της δράσης τους που είναι συνήθως αποτέλεσμα μετάλλαξης, κυρίως έλλειψης γονιδίου, αφαιρεί από το κύτταρο τη δυνατότητα ελέγχου του πολλαπλασιασμού και οδηγεί σε καρκινογένεση. Χαρακτηριστικό παράδειγμα αποτελεί ο καρκίνος του αμφιβληστροειδούς (ρετινοβλάστωμα) που είναι αποτέλεσμα έλλειψης ενός ογκοκατασταλτικού γονιδίου.

2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών χρωμοσωμάτων ενός είδους κατά ελλατώμενο μέγεθος, δεδομένου ότι τα μεταφασικά χρωμοσώματα ενός κυττάρου ενός οργανισμού διαφέρουν μεταξύ τους ως προς το μέγεθος και ως προς τη θέση του κεντρομεριδίου. Ο αριθμός και η μορφολογία των χρωμοσωμάτων είναι ιδιαίτερο χαρακτηριστικό κάθε είδους.

Οι μεταλλάξεις είναι αλλαγές στην ακολουθία και στον αριθμό των βάσεων στο γονιδίωμα ενός οργανισμού. Οι μεγάλες σε έκταση αλλαγές αποτελούν τις χρωμοσωμικές ανωμαλίες.

Η ανάλυση των χρωμοσωμικών ανωμαλιών έγινε δυνατή μετά την ανάπτυξη τεχνικών που επιτρέπουν την παρατήρηση και τη λεπτομερή μελέτη των χρωμοσωμάτων. Οι αλλαγές στον αριθμό των χρωμοσωμάτων ονομάζονται αριθμητικές χρωμοσωμικές ανωμαλίες, ενώ οι αλλαγές στη δομή αποτελούν τις δομικές χρωμοσωμικές ανωμαλίες. Οι αλλαγές αυτές έχουν συνήθως ως αποτέλεσμα την τροποποίηση του φαινοτύπου του ατόμου.

Αν κατά τη διάρκεια της μειωτικής διαίρεσης δεν πραγματοποιηθεί φυσιολογικά ο διαχωρισμός των ομόλογων χρωμοσωμάτων ή αδελφών χρωματίδων, ένα φαινόμενο που ονομάζεται μη-διαχωρισμός, τότε δημιουργούνται γαμέτες με αριθμό χρωμοσωμάτων μεγαλύτερο ή μικρότερο του φυσιολογικού. Η γονιμοποίηση των μη φυσιολογικών γαμετών, που προκύπτουν, με φυσιολογικό γαμέτη έχει ως αποτέλεσμα τη δημιουργία ζυγωτού με «λανθασμένη» ποσότητα γενετικού υλικού, το οποίο δεν αναπτύσσεται φυσιολογικά. Τα άτομα που προκύπτουν και έχουν περίσσεια ή έλλειψη μικρού αριθμού χρωμοσωμάτων ονομάζονται ανευπλοειδή. Η απουσία ενός μόνο χρωμοσώματος ονομάζεται μονοσωμία, ενώ η ύπαρξη ενός επιπλέον τρισωμία. Η μονοσωμία είναι συνήθως θανατηφόρος για τον οργανισμό, διότι τα χρωμοσώματα με τα γονίδια που περιέχουν, με εξαίρεση τα φυλετικά, πρέπει να υπάρχουν σε δύο «δόσεις», για να εξασφαλιστεί η σωστή ανάπτυξη του ζυγωτού.

Οι αριθμητικές χρωμοσωμικές ανωμαλίες δημιουργούνται στα αυτοσωμικά ή στα φυλετικά χρωμοσώματα.

Το σύνδρομο Down είναι η πιο κοινή αριθμητική χρωμοσωμική ανωμαλία. Τα άτομα που πάσχουν από σύνδρομο Down παρουσιάζουν καθυστέρηση στην ανάπτυξη, χαρακτηριστικές δυσμορφίες στο πρόσωπο και διανοητική καθυστέρηση. Στον καρυότυπο των ατόμων που πάσχουν, σε όλες σχεδόν τις περιπτώσεις, εμφανίζεται ένα επιπλέον χρωμόσωμα 21. Η ύπαρξη του επιπλέον χρωμοσώματος είναι αποτέλεσμα μη διαχωρισμού των χρωμοσωμάτων του 21ου ζεύγους ή μη διαχωρισμού των αδελφών χρωματίδων ενός τουλάχιστον 21ου χρωμοσώματος κατά το σχηματισμό των γαμετών στη μείωση. Με αυτό τον τρόπο δημιουργείται ωάριο, και σε σχετικά λιγότερες περιπτώσεις σπερματοζωάριο, με δύο χρωμοσώματα 21. Γονιμοποίηση του γαμέτη που έχει το επιπλέον χρωμόσωμα 21 με ένα φυσιολογικό θα δημιουργήσει στο ζυγωτό τρισωμία 21. Η πιθανότητα γέννησης παιδιού με σύνδρομο Down σχετίζεται με την ηλικία της μητέρας. Μελέτες δείχνουν ότι μια μέλλουσα μητέρα ηλικίας 45 ετών έχει πολύ μεγαλύτερη πιθανότητα να αποκτήσει παιδί με σύνδρομο Down σε σχέση με μια μέλλουσα μητέρα ηλικίας 19 ετών.

3. Το γενετικό υλικό ενός κυττάρου αποτελεί το γονιδίωμά του. Το ανθρώπινο γονιδίωμα σε ένα απλοειδές κύτταρο (γαμέτη) αποτελείται από περίπου 3 x 109 ζεύγη βάσεων DNA που είναι οργανωμένα σε 23 χρωμοσώματα.

Η αποκρυπτογράφηση της αλληλουχίας βάσεων του DNA πιστεύεται ότι θα μας βοηθήσει να κατανοήσουμε πώς έχει «κατασκευαστεί» και λειτουργεί ο ανθρώπινος οργανισμός. Για το σκοπό αυτό το 1986 ξεκίνησε μια διεθνής συνεργασία με σκοπό τη χαρτογράφηση, δηλαδή τον εντοπισμό της θέσης των γονιδίων στα χρωμοσώματα, και τον προσδιορισμό της αλληλουχίας των βάσεων του DNA στο ανθρώπινο γονιδίωμα. Το πρόγραμμα, που φυσικά απαιτούσε τη συμβολή πολλών ερευνητών και γενναία χρηματοδότηση, ξεκίνησε το 1990 υπό την αιγίδα του Εθνικού Ινστιτούτου Υγείας και του Τμήματος Ατομικής Ενέργειας των ΗΠΑ. Αρχικά υπήρχε η εκτίμηση ότι το πρόγραμμα θα ολοκληρωνόταν το 2005, όμως, χάρη στην αυτοματοποίηση των εργαστηριακών μεθόδων και την ανάπτυξη της πληροφορικής, ολοκληρώθηκε το 2001.

Η ανάλυση του ανθρώπινου γονιδιώματος θα συμβάλλει εκτός από τη μελέτη της οργάνωσης και λειτουργίας του ανθρώπινου γονιδιώματος (εύρεση ποσοστού δομικών και ρυθμιστικών γονιδίων, ποσοστού επαναλαμβανόμενων αλληλουχιών, εύρεση του συνόλου των γονιδίων και της χαρτογράφησής τους καθώς και τον προσδιορισμό της λειτουργίας τους κ.ά.) και τον προσδιορισμό των γονιδίων που σχετίζονται με ασθένειες, στη μαζική παραγωγή προϊόντων και στη μελέτη της εξέλιξης του ανθρώπινου γονιδιώματος.

Πιο συγκεκριμένα όσον αφορά τους δύο τελευταίους στόχους, το πρόγραμμα του ανθρώπινου γονιδιώματος σε συνδυασμό με άλλα προγράμματα προσδιορισμού της αλληλουχίας άλλων ειδών οργανισμών και προγραμμάτων σύγκρισης γονιδιωμάτων διαφορετικών ομάδων πληθυσμών που βρίσκονται σε εξέλιξη, θα συμβάλλει στην αποκάλυψη των εξελικτικών σχέσεων που υπάρχουν μεταξύ των ειδών. Σήμερα βρίσκονται σε εξέλιξη προγράμματα χαρτογράφησης γονιδιωμάτων οργανισμών, όπως είναι το πρόβατο, ο σκύλος, η αγελάδα, διάφορα έντομα, ο γεωσκώληκας καθώς και πολλοί μικροοργανισμοί.

Επίσης το πρόγραμμα του ανθρωπίνου γονιδιώματος θα συμβάλλει στη μαζική παραγωγή προϊόντων με τις μεθόδους που χρησιμοποιεί η Βιοτεχνολογία, μετά την απομόνωση των γονιδίων, τα οποία είναι χρήσιμα στη φαρμακοβιομηχανία, στη βιομηχανία, στη γεωργία και την κτηνοτροφία.

4. Το συνολικό DNA που υπάρχει σε κάθε ευκαρυωτικό κύτταρο δεν είναι ένα ενιαίο μόριο, αλλά αποτελείται από πολλά γραμμικά μόρια, ο αριθμός και το μήκος των οποίων είναι χαρακτηριστικά για τα διάφορα είδη των οργανισμών.

Αν παρατηρήσουμε το γενετικό υλικό ενός ευκαρυωτικού σωματικού κυττάρου, βλέπουμε ότι εμφανίζεται με διαφορετικές χαρακτηριστικές μορφές, ανάλογα με το στάδιο του κυτταρικού κύκλου. Κατά τη μεσόφαση το γενετικό υλικό έχει μικρό βαθμό συσπείρωσης και σχηματίζει δίκτυο ινιδίων χρωματίνης. Κατά συνέπεια τα ινίδια χρωματίνης δεν είναι ορατά ως μεμονωμένες δομές, με το οπτικό μικροσκόπιο. Με το τέλος της αντιγραφής κάθε ινίδιο χρωματίνης έχει διπλασιαστεί. Τα δύο αντίγραφα κάθε ινιδίου συνδέονται μεταξύ τους με μια δομή που ονομάζεται κεντρομερίδιο.

Ο όρος αδελφές χρωματίδες χρησιμοποιείται για να περιγράψει τα διπλασιασμένα χρωμοσώματα κατά το χρονικό διάστημα που είναι συνδεδεμένα στο κεντρομερίδιο. Στην κυτταρική διαίρεση οι αδελφές χρωματίδες συσπειρώνονται και, κατά το στάδιο της μετάφασης, αποκτούν μέγιστο βαθμό συσπείρωσης. Στο στάδιο αυτό ο υψηλός βαθμός συσπείρωσης καθιστά τα μεταφασικά χρωμοσώματα ευδιάκριτα και έτσι είναι εύκολο να παρατηρηθούν με το οπτικό μικροσκόπιο. Στο τέλος της κυτταρικής διαίρεσης προκύπτουν δύο νέα κύτταρα, γενετικά όμοια μεταξύ τους και με το αρχικό, αφού το καθένα περιέχει τη μία από τις δύο «πρώην» αδελφές χρωματίδες από κάθε χρωμόσωμα.

Σημείωση: Ο όρος διπλασιασμένα χρωμοσώματα, όπως χρησιμοποιείται εδώ από το σχολικό βιβλίο είναι ανακριβής καθώς χρωμόσωμα συνιστούν οι ενωμένες στο κεντρομερίδιο αδελφές χρωματίδες. Το χρωμόσωμα με τη μορφή αδελφών χρωματίδων ενωμένων στο κεντρομερίδιο έχει προκύψει από το διπλασιασμό του χρωμοσώματος όταν αυτό ήταν με τη μορφή ινιδίου χρωματίνης.

ΘΕΜΑ 3o

1. Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία με την οποία ένα γονίδιο ενεργοποιείται, για να παράγει μια πρωτεΐνη. Όμως σε κάθε κύτταρο δεν παράγονται όλες οι πρωτεΐνες σε κάθε χρονική στιγμή. Επιπλέον, επειδή το κύτταρο χρειάζεται κάθε πρωτεΐνη σε συγκεκριμένη ποσότητα, οι πρωτεΐνες ενός κυττάρου δεν παράγονται σε ίσες ποσότητες. Αν λοιπόν όλα τα γονίδια δούλευαν με τον ίδιο ρυθμό, ορισμένες πρωτεΐνες θα παράγονταν σε μεγάλες ποσότητες και άλλες σε ποσότητες που δε θα επαρκούσαν. Έτσι, είναι απαραίτητη η ύπαρξη και η λειτουργία ενός προγράμματος ρύθμισης της γονιδιακής έκφρασης, που παρέχει τις οδηγίες για το είδος και την ποσότητα των πρωτεϊνών οι οποίες πρέπει να παραχθούν σε κάθε συγκεκριμένη χρονική στιγμή.

Στα βακτήρια η ρύθμιση της γονιδιακής έκφρασης αποσκοπεί κυρίως στην προσαρμογή του οργανισμού στις εναλλαγές του περιβάλλοντος, έτσι ώστε να εξασφαλίζονται οι καλύτερες συνθήκες για τη βασική λειτουργία του που είναι η αύξηση και η διαίρεση.

Ένα βακτηριακό κύτταρο E.coli έχει περισσότερα από 4.000 γονίδια. Μερικά γονίδια μεταγράφονται συνεχώς και κωδικοποιούν πρωτεΐνες, που χρειάζονται για τις βασικές λειτουργίες του κυττάρου. Άλλα γονίδια μεταγράφονται μόνο όταν το κύτταρο αναπτύσσεται σε ειδικές περιβαλλοντικές συνθήκες, επειδή τα προϊόντα των γονιδίων αυτών είναι απαραίτητα για την επιβίωση του κυττάρου στις συνθήκες αυτές.

2. Τα κύτταρα ενός πολυκύτταρου οργανισμού, σε αντίθεση με τα κύτταρα που ανήκουν σε ένα βακτηριακό στέλεχος και είναι πανομοιότυπα μεταξύ τους, διαφέρουν στη δομή και στη λειτουργία τους. Η ζωή αρχίζει, όταν ένα γονιμοποιημένο ωάριο διαιρείται με μίτωση και παράγει τρισεκατομμύρια κύτταρα, που έχουν τα ίδια γονίδια. Στα αρχικά στάδια της εμβρυογένεσης, τα κύτταρα εξειδικεύονται για να εκτελέσουν επιμέρους λειτουργίες και η διαδικασία αυτή ονομάζεται κυτταρική διαφοροποίηση. Τα κύτταρα ενός πολύπλοκου πολυκύτταρου οργανισμού, όπως τα νευρικά, τα μυϊκά, τα ηπατικά, διαφέρουν στη μορφή και στη λειτουργία τους, αλλά έχουν όλα το ίδιο γενετικό υλικό, άρα και τα ίδια γονίδια. Τι τα κάνει τότε να διαφέρουν τόσο πολύ; Μολονότι όλα τα κύτταρα έχουν τις ίδιες γενετικές οδηγίες, έχουν αναπτύξει μηχανισμούς που τους επιτρέπουν να εκφράζουν τη γενετική τους πληροφορία επιλεκτικά και να ακολουθούν μόνο τις οδηγίες που χρειάζονται κάθε χρονική στιγμή. Κάθε κυτταρικός τύπος έχει εξειδικευμένη λειτουργία και πρέπει να υπάρχει πλήρης συντονισμός των λειτουργιών όλων των κυττάρων. Γι’ αυτό, η τελειοποίηση των συστημάτων ελέγχου είναι αναγκαία και λόγω της μεγαλύτερης πολυπλοκότητας των ευκαρυωτικών κυττάρων, αλλά και επειδή πρέπει να ελεγχθεί προσεκτικά η ανάπτυξη των πολυκύτταρων οργανισμών. Κατά συνέπεια, η ρύθμιση των γονιδίων στα ευκαρυωτικά κύτταρα γίνεται σε πολλά επίπεδα.

Συγκεκριμένα στα ευκαρυωτικά κύτταρα η γονιδιακή έκφραση ρυθμίζεται σε τέσσερα επίπεδα: Στο επίπεδο της μεταγραφής, στο επίπεδο μετά τη μεταγραφή, στο επίπεδο της μετάφρασης και στο επίπεδο μετά τη μετάφραση.

3. Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Η μεταγραφή καταλύεται από ένα ένζυμο, την RNA πολυμεράση (στους ευκαρυωτικούς οργανισμούς υπάρχουν τρία είδη RNA πολυμερασών).

Η RNA πολυμεράση προσδένεται σε ειδικές περιοχές του DNA, που ονομάζονται υποκινητές, με τη βοήθεια πρωτεϊνών που ονομάζονται μεταγραφικοί παράγοντες. Οι υποκινητές και οι μεταγραφικοί παράγοντες αποτελούν τα ρυθμιστικά στοιχεία της μεταγραφής του DNA και επιτρέπουν στην RNA πολυμεράση να αρχίσει σωστά τη μεταγραφή. Οι υποκινητές βρίσκονται πάντοτε πριν από την αρχή κάθε γονιδίου.

Κατά την έναρξη της μεταγραφής ενός γονιδίου η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA.

Η μεταγραφή καθορίζει ποια γονίδια θα εκφράσουν, σε ποιους ιστούς (στους πολυκύτταρους ευκαρυωτικούς οργανισμούς), και σε ποια στάδια της ανάπτυξης.

Ένας αριθμός μηχανισμών ελέγχει ποια γονίδια θα μεταγραφούν ή/και με ποια ταχύτητα θα γίνει η μεταγραφή. Το DNA των ευκαρυωτικών κυττάρων δεν οργανώνεται σε οπερόνια αλλά κάθε γονίδιο έχει το δικό του υποκινητή και μεταγράφεται αυτόνομα. Η RNA πολυμεράση λειτουργεί (όπως και στους προκαρυωτικούς οργανισμούς) με τη βοήθεια πρωτεϊνών, που ονομάζονται μεταγραφικοί παράγοντες. Μόνο που στους ευκαρυωτικούς οργανισμούς οι μεταγραφικοί παράγοντες παρουσιάζουν τεράστια ποικιλία. Κάθε κυτταρικός τύπος περιέχει διαφορετικά είδη μεταγραφικών παραγόντων. Διαφορετικός συνδυασμός μεταγραφικών παραγόντων ρυθμίζει τη μεταγραφή κάθε γονιδίου. Μόνο όταν ο σωστός συνδυασμός των μεταγραφικών παραγόντων προσδεθεί στον υποκινητή ενός γονιδίου, αρχίζει η RNA πολυμεράση τη μεταγραφή αυτού του γονιδίου.

ΘΕΜΑ 4o

Η διαδικασία της αντιγραφής, όπως υποδηλώνεται από τη δομή της διπλής έλικας και τον ημισυντηρητικό μηχανισμό, φαίνεται απλή. Όμως, ύστερα από πολύχρονη ερευνητική μελέτη, διαπιστώθηκε ότι η διαδικασία στην πραγματικότητα είναι ιδιαίτερα πολύπλοκη. Τα κύτταρα διαθέτουν ένα σημαντικό «οπλοστάσιο» εξειδικευμένων ενζύμων και άλλων πρωτεϊνών, που λειτουργούν ταυτόχρονα και καταλύουν τις χημικές αντιδράσεις της αντιγραφής με μεγάλη ταχύτητα και με εκπληκτική ακρίβεια.

Τα βασικά στάδια του μηχανισμού της αντιγραφής παρουσιάζουν σημαντικές ομοιότητες μεταξύ προκαρυωτικών και ευκαρυωτικών κυττάρων.

Η αντιγραφή του DNA αρχίζει από καθορισμένα σημεία που ονομάζονται θέσεις έναρξης της αντιγραφής. Το βακτηριακό DNA που είναι κυκλικό έχει μόνο μία θέση έναρξης της αντιγραφής.

Στα ευκαρυωτικά κύτταρα πριν την αντιγραφή, το DNA κάθε χρωμοσώματος είναι ένα μακρύ γραμμικό μόριο, το οποίο έχει πολυάριθμες θέσεις έναρξης της αντιγραφής. Έτσι το DNA των ευκαρυωτικών κυττάρων αντιγράφεται ταυτόχρονα από εκατοντάδες σημεία σε όλο το μήκος του και στη συνέχεια τα τμήματα που δημιουργούνται ενώνονται μεταξύ τους.

Για να αρχίσει η αντιγραφή του DNA, είναι απαραίτητο να ξετυλιχθούν στις θέσεις έναρξης της αντιγραφής οι δύο αλυσίδες. Αυτό επιτυγχάνεται με τη βοήθεια ειδικών ενζύμων, που σπάζουν τους δεσμούς υδρογόνου μεταξύ των δύο αλυσίδων. Τα ένζυμα αυτά ονομάζονται DNA ελικάσες. Όταν ανοίξει η διπλή έλικα, δημιουργείται μια «θηλιά», η οποία αυξάνεται και προς τις δύο κατευθύνσεις.

Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA ονομάζονται DNA πολυμεράσες. Επειδή τα ένζυμα αυτά δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. DNA πολυμεράσες επιμηκύνουν τα πρωταρχικά τμήματα, τοποθετώντας συμπληρωματικά δεοξυριβονουκλεοτίδια απέναντι από τις μητρικές αλυσίδες του DNA. Τα νέα μόρια DNA αρχίζουν να σχηματίζονται, καθώς δημιουργούνται δεσμοί υδρογόνου μεταξύ των συμπληρωματικών αζωτούχων βάσεων των δεοξυριβονουκλεοτιδίων. DNA πολυμεράσες επιδιορθώνουν επίσης λάθη που συμβαίνουν κατά τη διάρκεια της αντιγραφής. Μπορούν, δηλαδή, να «βλέπουν» και να απομακρύνουν νουκλεοτίδια που οι ίδιες τοποθετούν, κατά παράβαση του κανόνα της συμπληρωματικότητας, και να τοποθετούν τα σωστά. Ταυτόχρονα DNA πολυμεράσες απομακρύνουν τα πρωταρχικά τμήματα RNA και τα αντικαθιστούν με τμήματα DNA.

Οι DNA πολυμεράσες λειτουργούν μόνο προς καθορισμένη κατεύθυνση και τοποθετούν τα νουκλεοτίδια στο ελεύθερο 3΄ άκρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου κάθε αναπτυσσόμενης αλυσίδας. Έτσι, λέμε ότι αντιγραφή γίνεται με προσανατολισμό 5΄ προς 3΄.

Kάθε νεοσυντιθέμενη αλυσίδα θα έχει προσανατολισμό 5΄→3΄. Έτσι, σε κάθε διπλή έλικα που παράγεται οι δύο αλυσίδες θα είναι αντιπαράλληλες. Για να ακολουθηθεί αυτός ο κανόνας σε κάθε τμήμα DNA που γίνεται η αντιγραφή, η σύνθεση του DNA είναι συνεχής στη μία αλυσίδα και ασυνεχής στην άλλη. Τα κομμάτια της ασυνεχούς αλυσίδας συνδέονται μεταξύ τους με τη βοήθεια ενός ενζύμου, που ονομάζεται DNA δεσμάση. Το ίδιο ένζυμο συνδέει και όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης της αντιγραφής.

Κατά την αντιγραφή του DNA λοιπόν, τα ένζυμα που τοποθετούν συμπληρωματικά ως προς τους μητρικούς κλώνους νουκλεοτίδια, προκειμένου να αναπτυχθούν οι θυγατρικοί κλώνοι κατά τον ημισυντηρητικό τρόπο αντιγραφής, είναι το πριμόσωμα (σύμπλοκο ενζύμων) και φυσικά οι DNA πολυμεράσες. Ακόμη συμπληρωματικά νουκλεοτίδια τοποθετούνται και από τα επιδιορθωτικά ένζυμα. Τα επιδιορθωτικά ένζυμα επιδιορθώνουν τα λάθη που συνέβησαν κατά την διαδικασία της αντιγραφής του DNA και δεν επιδιοθώθηκαν από την DNA πολυμεράση. Η δράση των επιδιορθωτικών ενζύμων περιορίζει τα λάθη της αντιγραφής σε 1 κάθε 1010 νουκλεοτίδια καθιστώντας την αντιγραφή μία εξαιρετικά ακριβής διαδικασία.

Με τη μεταγραφή, οι πληροφορίες που βρίσκονται στα γονίδια μεταφέρονται στο mRNA με βάση τη συμπληρωματικότητα των νουκλεοτιδικών βάσεων. Η αλληλουχία των βάσεων του mRNA καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση έναν κώδικα αντιστοίχησης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών, τον γενετικό κώδικα. Το μόριο RNA που συντίθεται κατά τη μεταγραφή είναι συμπληρωματικό προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή είναι η μεταγραφόμενη και ονομάζεται μη κωδική. Η συμπληρωματική αλυσίδα του DNA του γονιδίου ονομάζεται κωδική. Το RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Η μεταγραφή όπως και η αντιγραφή έχει προσανατολισμό 5΄→3΄.

Εφόσον η κωδική αλυσίδα του γονιδίου έχει την αλληλουχία:

5΄…ATG CCA TGC AAA CCG AAA TGA…3΄

Το μόριο mRNA που προκύπτει από τη μεταγραφή του γονιδίου θα είναι:

5΄…AUG CCA UGC AAA CCG AAA UGA…3΄

Η RNA πολυμεράση, το ένζυμο που επιτελεί τη μεταγραφή, τοποθετεί ριβονουκλεοτίδια απέναντι από τα δεοξυριβονουκλεοτίδια της μη κωδικής αλυσίδας του DNA του γονιδίου, σύμφωνα με τον κανόνα της συμπληρωματικότητας των βάσεων, όπως και στην αντιγραφή, μόνο που εδώ απέναντι από την αδενίνη τοποθετείται το ριβονουκλεοτίδιο ουρακίλη. Συνεπώς το παραγόμενο mRNA διαθέτει την ίδια αλληλουχία νουκλεοτιδίων (ριβονουκλεοτιδίων) με την κωδική αλυσίδα του γονιδίου (δεοξυριβονουκλεοτιδίων) και συμπληρωματική αλληλουχία νουκλεοτιδίων (ριβονουκλεοτιδίων) με τη μη κωδική αλυσίδα του γονιδίου (δεοξυριβονουκλεοτιδίων).

Το γενετικό υλικό μπορεί να υποστεί αλλαγές με πολλούς και διαφορετικούς τρόπους. Οι αλλαγές στην αλληλουχία του DNA ονομάζονται μεταλλάξεις. Οι μεταλλάξεις δημιουργούν συνήθως έναν διαφορετικό φαινότυπο χωρίς όμως αυτό να είναι πάντοτε απαραίτητο. Αυτό εξαρτάται από τον τρόπο με τον οποίο η αλλαγή επιδρά στο γονιδιακό προϊόν, δηλαδή την πρωτεΐνη.

Οι γενετιστές κατατάσσουν τις μεταλλάξεις σε δύο μεγάλες κατηγορίες: Τις γονιδιακές και τις χρωμοσωμικές. Ο τυπικός αυτός διαχωρισμός σχετίζεται με την έκταση της αλλαγής. Αν αυτή αφορά μικρό αριθμό βάσεων, στις οποίες συμβαίνει αντικατάσταση, προσθήκη ή έλλειψη, τότε ονομάζεται γονιδιακή μετάλλαξη. Αν αφορά αλλαγές σε μεγαλύτερο τμήμα του χρωμοσώματος, ονομάζεται χρωμοσωμική ανωμαλία.

Η αλλαγή που συνέβη στην κωδική αλυσίδα του γονιδίου που δίνεται και έχει ως αποτέλεσμα το 4ο κωδικόνιο στο παραγόμενο mRNA να έχει τις βάσεις 5΄UAA3΄ και ταυτόχρονα να διατηρείται σταθερός ο αριθμός των νουκλεοτιδίων του γονιδίου καθώς και το πλαίσιο ανάγνωσής του (διαδρομή με βήμα τριπλέτας από το κωδικόνιο έναρξης του γονιδίου μέχρι το κωδικόνιο λήξης) συνιστά μία σημειακή μετάλλαξη αντικατάστασης βάσης, όπου η πρώτη αδενίνη (Α) του 4ου κωδικονίου της κωδικής αλυσίδας του DNA του γονιδίου αντικαθίσταται από μία θυμίνη (Τ), με αποτέλεσμα το παραγόμενο mRNA κατά τη μεταγραφή να είναι τώρα:

5΄…AUG CCA UGC UAA CCG AAA UGA…3΄

Η μετάλλαξη αυτή που συνέβη στο γονίδιο οδηγεί στο σχηματισμό πρόωρου κωδικονίου λήξης της μετάφρασης (το φυσιολογικό κωδικόνιο λήξης είναι το 5΄UGA3΄ που συνιστά την 7η τριπλέτα του mRNA που προκύπτει από τη μεταγραφή του δοθέντος κλώνου του γονιδίου) καθώς το κωδικόνιο 5΄ΤΑΑ3΄ που δημιουργείται στην κωδική αλυσίδα μεταγράφεται στο κωδικόνιο 5΄UAA3΄, στο παραγόμενο mRNA. Το κωδικόνιο 5΄UAA3΄ στο mRNA όπως και το κωδικόνιο 5΄ΤΑΑ3΄ στην κωδική αλυσίδα του DNA συνιστά κωδικόνιο λήξης για τον γενετικό κώδικα.

Η παρουσία του κωδικονίου λήξης στο μόριο του mRNA οδηγεί στον τερματισμό της πρωτεϊνοσύνθεσης επειδή δεν υπάρχουν tRNA που να αντιστοιχούν σε αυτό.

Το αποτέλεσμα λοιπόν αυτής της μετάλλαξης που συνέβη είναι ένα μικρότερο και πιθανόν μη λειτουργικό πεπτίδιο.

Πολλά ριβοσώματα μπορούν να μεταφράζουν ταυτόχρονα ένα mRNA, το καθένα σε διαφορετικό σημείο κατά μήκος του μορίου. Αμέσως μόλις το ριβόσωμα έχει μεταφράσει τα πρώτα κωδικόνια, η θέση έναρξης του mRNA είναι ελεύθερη για την πρόσδεση ενός άλλου ριβοσώματος. Το σύμπλεγμα των ριβοσωμάτων με το mRNA ονομάζεται πολύσωμα. Έτσι, η πρωτεϊνοσύνθεση είναι μία “οικονομική διαδικασία”. Ένα κύτταρο μπορεί να παράγει μεγάλα ποσά μίας πρωτεΐνης από ένα ή από δύο αντίγραφα ενός γονιδίου.

Σχόλια: Στο σχήμα της διχάλας αντιγραφής που δίνεται στην εκφώνηση, δεν προσδιορίζεται η θέση έναρξης της αντιγραφής, οπότε δεν μπορούμε να γνωρίζουμε τα όρια της συγκεκριμένης διχάλας. Έτσι είμαστε υποχρεωμένοι να αυθαιρετοποιήσουμε, δεχόμενοι ότι η θέση έναρξης της αντιγραφής βρίσκεται εκεί που έχει τοποθετηθεί το 3΄ άκρο της Α αλυσίδας της διχάλας.

Το ένζυμο DNA δεσμάση δεν δρα μόνο κατά την αντιγραφή του κλώνου Β, αλλά και κατά την αντιγραφή του κλώνου Α, όταν πραγματοποιείται η σύνδεση του τελευταίου νουκλεοτίδιου του πρωταρχικού τμήματος που αντικαταστάθηκε από την DNA πολυμεράση από ριβονουκλεοτίδιο σε δεοξυνουκλεοτίδιο, με το πρώτο δεοξυνουκλεοτίδιο που αναπτυσσόμενου κλώνου που τοποθετήθηκε από την DNA πολυμεράση μετά τη δράση του πριμοσώματος, κατά την αντιγραφή του Α κλώνου της δοθείσας διχάλας αντιγραφής.

Σύμφωνα με το σχολικό βιβλίο, οι τριπλέτες των νουκλεοτιδίων που ακολουθούν το κωδικόνιο λήξης δεν νοούνται ως κωδικόνια, αφού δεν κωδικοποιούν για κάποιο αμινοξύ. Τα νουκλεοτίδια που ακολουθούν αμέσως μετά το κωδικόνιο λήξης ανήκουν στην 3΄ αμετάφραστη περιοχή του γονιδίου, εκτός και αν είναι πολύ μακριά από το κωδικόνιο λήξης και μετά από αυτό, οπότε μπορεί να ανήκουν στις αλληλουχίες λήξης της μεταγραφής του γονιδίου. Συνεπώς η έκφραση στην εκφώνηση “… ο αριθμός των κωδικονίων να παραμείνει σταθερός.” είναι αδόκιμη.

Η λύση που δόθηκε παραπάνω βασίστηκε στο ότι ο αριθμός των νουκλεοτιδίων του γονιδίου παραμένει σταθερός και ταυτόχρονα δεν μεταβάλλεται το πλαίσιο ανάγνωσης του γονιδίου, υποθέτοντας ότι η έκφραση της εκφώνησης του θέματος που αναφέρθηκε παραπάνω, ήθελε να υποδηλώσει ότι δεν έγινε προσθήκη ή έλλειψη νουκλεοτιδίων στο γονίδιο, μετάλλαξη που θα οδηγούσε σε αλλαγή του αριθμού των νουκλεοτιδίων και σε αλλαγή και του αναγνωστικού πλαισίου από το σημείο της μετάλλαξης και μετά. Διαφορετικά θα μπορούσε να θεωρηθεί σωστή και η απάντηση που στηρίζεται στην προσθήκη μίας θυμίνης (Τ) αμέσως πριν το 4ο κωδικόνιο (5΄ΑΑΑ3΄) οπότε διαφοροποιείται ο αριθμός των νουκλεοτιδίων και αλλάζει το αναγνωστικό πλαίσιο του γονιδίου καθώς σχηματίζεται ως 4ο κωδικόνιο το 5΄ΤΑΑ3΄ στην κωδική αλυσίδα, που οδηγεί στο κωδικόνιο 5΄UΑΑ3΄ του mRNA και αυτό είναι κωδικόνιο λήξης.