Αρχείο κατηγορίας Ερωτήσεις κατανόησης

Ερωτήσεις κατανόησης κεφάλαιο 6 -Μεταλλάξεις

1.

α. Πόσοι διαφορετικοί γενετικοί τόποι κωδικοποιούν την HbF;

β. Πόσα διαφορετικά γονίδια κωδικοποιούν την φυσιολογική HbF;

γ. Πόσα διαφορετικά mRNAs κωδικοποιούν την φυσιολογική HbF;

δ. Πόσα αλληλόμορφα γονίδια διαθέτουμε για την φυσιολογική HbF;

ε. Ποσά αλληλόμορφα γονίδια διαθέτουμε στον καρυότυπο για την φυσιολογική HbF;

στ. Ποιος είναι ο γονότυπος μας για την φυσιολογική HbF;

2. Ονομάστε τουλάχιστον ένα γονίδιο μας που γνωρίζετε και μπορεί να είναι εμβρυακό θνησιγόνο εάν υποστεί μετάλλαξη.

3. Ένα ενήλικο άτομο με γονότυπο ββs τι είδους αιμοσφαιρίνες διαθέτει;Τι είδους και σε τι ποσοστό πολυπεπτιδικές αλυσίδες που συμμετέχουν στις αιμοσφαιρίνες διαθέτει;Σε ποιο ποσοστό αναμένονται αυτές;

4. Σε ένα θηλυκό άτομο του οποίου αναλύθηκε το DNA διαπιστώθηκε ότι διαθέτει δύο φυσιολογικά αντίγραφα για κάθε γονίδιο του. Μάλιστα διαπιστώθηκε ότι δεν φέρει επικρατή παθολογικά αλληλόμορφα ούτε είναι ομόζυγο για καποιο παθολογικό υπολειπόμενο αλληλόμορφο, ούτε φέρει γενικότερα κάποιο παθολογικό αλληλόμορφο, ενώ η μητέρα του δεν νοσεί από καμιά ασθένεια που οφείλεται σε μιτοχονδριακό DNA. Ωστόσο το άτομο αυτό νοσεί από μη λοιμώδες νόσημα. Τι είδους ασθένεια μπορεί να έχει ;

5. Έστω το άτομο Ν που είναι ομόζυγο για το αλληλόμορφο β’ του γονιδίου β (παντελή ανικανότητα μεταγραφής) και το άτομο Ρ είναι ομόζυγο για το αλληλόμορφο β” (παντελής ανικανότητα μετάφρασης). Τι είδους αιμοσφαιρινοπάθεια και τι είδους αιμοσφαιρίνες, έχουν τα άτομα Ν και Ρ; Τι είδους αιμοσφαιρίνες έχουν τα άτομα Χ, Υ και Ζ με γονότυπους β΄β¨, ββ΄, ββ” αντίστοιχα;

6. Έστω ένα ζευγάρι, στο οποίο ο σύζυγος είναι φορέας της δρεπανοκυτταρικής αναιμίας και η σύζυγος νοσεί από ήπια μορφή θαλασσαιμίας α και ήπια μορφή β θαλασσαιμίας ( ετεροζυγη). Να βρεθεί η πιθανότητα να αποκτήσουν υγιές παιδί. Τα γονίδια α και β εδράζονται σε διαφορετικά αυτοσωμικά χρωμοσώματα στο απλοειδείς γονιδίωμα μας.

7. Τα γονίδια των αλυσίδων β και γ των αιμοσφαιρινών είναι αυτοσωμικά και εδράζονται σε διαδοχικούς γενετικούς τόπους στο χρωμόσωμα που φέρονται.Ένας ετερόζυγος άνδρας και για τα δυο γονίδιά και η σύζυγος του επίσης ετερόζυγη και για τα δυο γονίδια, έχουν ιστορικό τριών συνεχόμενων πρωίμων αποβολών στην προσπάθεια τους να τεκνοποιήσουν. Το ζευγάρι ζήτησε γενετική καθοδήγηση. Τι πιθανότητα υπολόγισε ο γενετιστής, ότι έχει το ζευγάρι να αποκτήσει υγιή απόγονο;

8. Ένας ομόζυγος άνδρας για ένα μεταλλαγμένο αλληλόμορφο του γονιδίου α των αιμοσφαιρινών, ο οποίος υποφέρει από α- θαλασσαιμία, παντρεύεται μια γυναικά που υποφέρει από την ίδια ακριβώς νόσο άλλα διαπιστώθηκε ότι είναι ετερόζυγη για το μεταλλαγμένο παθολογικό αλληλόμορφο α.Το παθολογικό αλληλόμορφο α έχει υποστεί μετάλλαξη στην 5΄αμετάφραστη περιοχή και η μικρή ριβοσωμική υπομονάδα αδυνατεί να συνδεθεί με το mRNA που παράγεται από αυτό το αλληλόμορφο. Με ποια πιθανότητα το ζευγάρι θα αποκτήσει υγιείς απόγονους;

9. Ένα ζευγάρι που και οι δυο διαθέτουν δυο αντίγραφα για κάθε αυτοσωμικό γονίδιο τους και οι δυο είναι φορείς της β θαλασσαιμίας, ποια πιθανότητα έχουν να αποκτήσουν φυσιολογικούς απόγονους ως προς τις θαλασσαιμίες;

10. Ο πατέρας και ο γιος του κυρίου Χ εμφάνισαν ρετινοβλάστωμα στην παιδική τους ηλικία ενώ ο κ. Χ δεν εμφάνισε. Δώστε μια πιθανή ερμηνεία, εάν γνωρίζετε ότι το ρετινοβλάστωμα συνήθως ακολουθεί αυτωσωμικό επικρατή τρόπο κληρονομικότητας, όμως το ρετινοβλάστωμα εξελίσσεται μόνο όταν ένα άτομο χάσει την λειτουργικότητα και των δυο γονιδίων που ελέγχουν για το ρετινοβλάστωμα.

11. Άνδρας με αιμοροφιλία Α απέκτησε παιδί με σύνδρομο 44+ΧΟ από φυσιολογική γυναικά. Το παιδί δεν νοσεί από αιμοροφιλία. Σε ποιον από τους δυο γονείς έγινε το λάθος κατά την μειωτική διαίρεση;

12. Μια γυναικά που η μητέρα και η αδελφή της εμφάνισαν καρκίνο του μαστού και η ίδια είναι ετερόζυγη για το παθολογικό υπολειπόμενο γονίδιο για τον καρκίνο του μαστού, ποια πιθανότητα έχει να αποκτήσει υγιή παιδιά με έναν άνδρα του οποίου η μητέρα νοσεί από καρκίνο του μαστού και ο πατέρας του δεν είχε πότε καμιά εξ΄αίματος συγγενή γυναίκα που νόσησε από καρκίνο του μαστού;

13. Για ποια γονίδια των αιμοσφαιρινών ισχύει ο πρώτος νόμος του Μεντέλ;

14. Για ποια ζεύγη γονιδίων των αιμοσφαιρινών ισχύει ο δεύτερος νόμος του Μέντελ;

15. Η αιμοσφαιρίνη Α είναι πολυγονιδιακός χαρακτήρας αφού ελέγχεται από δυο διαφορετικά γονίδια.

16. Η αιμοσφαιρινοπάθεια α δεν μπορεί να οφείλεται σε γονιδιακή μετάλλαξη που συνέβει σε γονίδιο α.

17. Όταν δύο αλληλόμορφα του ίδιου γονιδίου οδηγούν σε δύο διαφορετικά πολυπεπτίδια που το καθένα είναι όμοιο με το άλλο εκτός από τα 16 πρώτα αμινοξέα, μπορούμε να συνάγουμε ότι τα δυο αλληλόμορφα έχουν υποστεί διαφορετική γονιδιακή μετάλλαξη προσθήκης ή έλλειψης νουκλεοτιδίων μέσα στα πρώτα 16 κωδικόνια.

18. Τα αλληλόμορφα βs και βc φέρουν διαφορετική μετάλλαξη στο ίδιο κωδικόνιο (έβδομο) του γονιδίου που κωδικοποιεί για τις πολυπεπτιδικές αλυσίδες β της αιμοσφαιρίνης Α. Αυτό σημαίνει ότι δύο διαφορετικά ετερόζυγα άτομα φορείς αυτών των αλληλομόρφων εμφανίζουν ίδιου μήκους και ίδιου πλήθους τμήματα (ζώνες μετά από ηλεκτροφόρηση σε πήκτωμα αγαρόζης) γονιδίων β, όταν επιδράσει στα γονίδια β που φέρει κάθε άτομο:

α) η ίδια περιοριστική ενδονουκλεάση που αναγνωρίζει το φυσιολογικό γονίδιο β σε θέση περιορισμού που περιλαμβάνει και το εβδομο κωδικόνιο του γονιδίου.

β) η ίδια περιοριστική ενδονουκλεάση που αναγνωρίζει αλληλουχία έξι νουκλεοτιδίων στην οποία περιλαμβάνεται το κωδικόνιο που κωδικοποιεί για το αμινοξύ βαλίνη.

19. Οι δυο γενετικοί τόποι του γονιδιου α έχουν τον ίδιο ρυθμό έκφρασης.

20. Τα ομόζυγα άτομα για δρεπανοκυτταρική αναιμία εμφανίζουν αύξηση της HbF, όπως και τα ομόζυγα για την μεσογειακή αναιμία. Επίσης τα ετερόζυγα άτομα φορείς για την δρεπανοκυτταρική αναιμία εμφανίζουν αυξημένα επίπεδα HbA2.

21.  Οι βιοχημικές αναλύσεις μπορούν να γίνουν και με ανασοδιαγνωστικές τεχνικές.

22. Μετάλλαξη στις αλληλουχίες λήξης της μεταγραφής ενός προκαρυωτικού γονιδίου δεν επηρεάζει το παραγόμενο πρωτεϊνικό μόριο, σε αντίθεση με αντίστοιχη μετάλλαξη σε ασυνεχές γονίδιο.

23. Απο τα εμβρυακα κυτταρα μπορουμε να δημιουργησουμε και γονιδιωματικη και cDNA βιβλιοθηκη για το εμβρυο.

24. Εξηγηστε με ποιο τροπο ειναι δυνατο να προκυψουν μονοζυγωτικα διδυμα διαφορετικού φυλου.

25. Ο πρώτος νομος του Μεντελ ισχύει και για δυο αυτοσωμικα αλληλόμορφα ενός γονιδιου του 21ου χρωμοσώματος ενός ατόμου με σύνδρομο Down.

26. Ο πρώτος νομος του Μεντελ ισχύει για δυο αυτοσωμικα αλληλόμορφα ενός γονιδιου του 21ου χρωμοσώματος ενός ατόμου με αμοιβαια μετατόπιση 14-21.

27. Σε έναν τυπικό ενήλικα υπάρχουν περίπου 4*10^13 γονίδιά αλυσίδων α, 2*10^13 γονίδιά που ελέγχουν την ασθένεια του αλφισμου και 10^13 η 2*10^13 γονίδιά για την αιμορροφιλία.

28. Για ένα άτομο που νοσεί από ρετινοβλαστωμα ισχύει ο νόμος του διαχωρισμού των αλληλόμορφων ως προς τον συγκεκριμένο γενετικό τόπο.

29. Η δρεπανοκυτταρική αναιμία κληρονομείται πάντα ως  αυτοσωμική υπολειπόμενη νόσος.

30. Η δρεπανοκυτταρική αναιμία θα μπορούσε να θεραπευτεί αν ήταν δυνατή η εισαγωγή ενός φυσιολογικού αλληλομορφου β στα πρόδρομα ευθροκυτταρα ενός ατόμου που νοσεί από αυτή την ασθένεια.

31. Ο καρκίνος των ερυθροκυτταρων του αίματος δεν μπορεί να γινει μεταστατικός.

32. Εφόσον τα νευρικά κύτταρα δεν διαιρούνται δεν μπορούν να μετασχηματιστούν σε καρκινικά.

33. Ενα άτομο με σύνδρομο Down έχει τον ίδιο λόγο A+T/G+C με το αν ήταν φυσιολογικό.

34. Η παραπάνω πρόταση είναι λανθασμένη για ένα άτομο με σύνδρομο ΧΥΥ.

35. Τα βακτήρια μπορεί να νοσήσουν από καρκίνο.

36. Τα πρωτόζωα και οι μύκητες μπορεί να αναπτύξουν καρκίνο.

37. Τα φυτά νοσούν από καρκίνο ως λοιμώδες νόσημα.

Ερωτήσεις κατανοήσεις κεφαλαίου 5-Μενδελική Κληρονομικότητα.

  1. Ο πρώτος νόμος του Μέντελ ισχύει για όλα μας τα γονίδια.
  2. Ο πρώτος νόμος του Μέντελ ισχύει για το γονίδιο μας, της αχρωματοψίας στο κόκκινο χρώμα.
  3. Ο δεύτερος νόμος του Μέντελ ισχύει για δυο γονίδια που εδράζονται σε μη ομόλογη περιοχή των φυλετικών χρωμοσωμάτων μας Χ και Υ.
  4. Επειδή είμαστε διπλοειδείς οργανισμοί έχουμε όλα μας τα γονίδια σε δυο αντίγραφα.
  5. Το πλήθος των γενετικών μας τόπων είναι ίσο με το πλήθος των αλληλομόρφων των γονιδίων μας που διαθέτουμε.
  6. Όσα είναι τα γονίδια μας είναι και τα χαρακτηριστικά που διαθέτουμε.
  7. Άτομα με τον ίδιο γονότυπο θα έχουν και τον ίδιο φαινότυπο.
  8. Ο γονότυπος ενός ατόμου άφορα το είδος και το πλήθος των αλληλομόρφων του.
  9. Ο φαινότυπος ενός ατόμου προσδιορίζεται πάντα και από τον γονότυπο του.
  10. Ένα χαρακτηριστικό που ελέγχεται από γενετικό τόπο του Υ φυλετικού χρωμοσώματος κληρονομείται μόνο στους αρσενικούς απογόνους.
  11. Ο γονότυπος μας αφορά και τα γονίδια του μιτοχονδρικού γενετικού υλικού μας.
  12. Μια φυλοσύνδετη επικρατής νόσος εμφανίζεται στο 100% των θυγατέρων ενός ζευγαριού όταν νοσεί μόνο ο πατέρας και ποτέ στους υιούς.
  13. Ένα φυλοσύνδετο επικρατές χαρακτηριστικό μεταβιβάζεται με την ίδια πιθανότητα που μεταβιβάζεται ένα φυλοσύνδετο υπολειπόμενο χαρακτηριστικό όταν από τους γονείς είναι φορέας του υπεύθυνου αλληλόμορφου η μητέρα.
  14. Το χρωμόσωμα Υ του προ-προ-πάππου σας από την πλευρά του πάτερα σας το φέρει σίγουρα και ο αδελφός σας.
  15. Η πιθανότητα ένας απόγονος να είναι ετερόζυγος για ένα αυτοσωμικό υπολειπόμενο γνώρισμα όπως και οι γονείς του είναι 1/2.
  16. Η παραπάνω πιθανότητα είναι 2/3 αν είναι γνωστό ότι ο απόγονος δεν νοσεί.
  17. Ο Μέντελ ανακάλυψε τα γονίδια..
  18. Οι νόμοι της κληρονομικότητας του Μεντελ είναι καθολικοί στον έμβιο κόσμο όπως και ο γενετικός κώδικας.
  19. Ο Μέντελ με τα αποτελέσματα των πειραμάτων του υπέδειξε ποια πρέπει να είναι τα χαρακτηριστικά του γενετικού υλικού των οργανισμών.
  20. Ένα υπολειπόμενο φαινοτυπικό χαρακτηριστικό ελέγχεται πάντα από ένα αλληλόμορφο που δεν εκφράζεται στα κύτταρα.
  21. Τα δυο κύτταρα της πρώτης μειωτικής διαίρεσης ενός μειοκυττάρου ενός διπλοειδούς υβριδίου έχουν τον ίδιο λόγο A+T/C+G.
  22. Ένα φυσιολογικό αγόρι και ένα φυσιολογικό κορίτσι έχουν το ίδιο πλήθος διαφορετικών γονιδίων.
  23. Οι μιτοχονδριακές ασθένειες δεν αποκλείεται να ακολουθούν και μενδελικό τύπο κληρονομικότητας.
  24. Ένα φυσιολογικό κορίτσι έχει λιγότερους γενετικούς τόπους από ένα φυσιολογικό αγόρι αλλά έχει περισσότερα αλληλόμορφα από το αγόρι.
  25. Εάν αναπαραστήσουμε τα δυο αλληλόμορφα ενός γονίδιου με τα γράμματα Α και α και ορίσουμε ως p και q τις συχνότητες των αλληλομορφων αυτών αντίστοιχα μέσα στην γονιδιακή δεξαμενή, τότε οι συχνότητες των διαφορετικών γονότυπων είναι : p^2 + 2pq + q^2 =1, φυσικά p+q =1 και αναφερόμαστε σε παμμικτικό πληθυσμό με αόριστα μεγάλο μέγεθος που δεν υπάρχει μετανάστευση, και το περιβάλλον του βιοτόπου του παραμένει σταθερό.
  26. Ο παραπάνω τύπος δηλώνει ότι οι γονοτυπικές συχνότητες ενός παμμικτικού πληθυσμού αόριστα μεγάλου μεγέθους παραμένουν σταθερές από μια γενεά στην επόμενη.
  27.  Ο παραπάνω πληθυσμός βρίσκεται σε ισορροπία Hardy-Weinberg (HWE), δηλαδή η σχετική αφθονία των αλληλομορφων Α και α δεν αλλάζει από γενεά σε γενεά. Η μονή αλλαγή στη γενετική κατανομή του πληθυσμού είναι μια ανακατανομή των γονότυπων σε συχνότητες που θα παραμένουν σταθερές σε όλες τις επόμενες γενεές.
  28. Ο τύπος HW  ισχύει και για πολλαπλά αλληλόμορφα ενός γενετικού τόπου αλλά και για πολυγονιδιακούς χαρακτήρες.
  29. Ο νόμος HW μας παρέχει ένα βασικό επίπεδο ώστε να μπορούμε να συγκρίνουμε τις πραγματικές αλλαγές συχνοτήτων αλληλομορφων που συμβαίνουν από γενεά σε γενεά σε μια αναπαραγωγική κοινότητα (πληθυσμός).
  30. Αποκλίσεις από τον τύπο HW υποδεικνύει διατάραξη του ισοζυγίου γονοτυπικών συχνοτήτων από γενεά σε γενεά.
  31. Αποκλίσεις από τον τύπο HW προκύπτουν λόγω μεταλλάξεων, μετανάστευση νέων γονιδίων στο εσωτερικό του πληθυσμού, τυχαίες αλλαγές συχνοτήτων εξαιτίας δειγματοληπτικού σφάλματος (γενετική παρέκλιση) και φυσική επιλογή που ευνοεί έναν γονότυπο σε βάρος κάποιου άλλου.
  32. Σε μια κυψέλη η βασίλισσα είναι διπλοειδής και γονιμοποιείται από έναν κηφήνα που είναι απλοειδής, όπως όλοι οι κηφήνες, όλες οι εργάτριες έχουν ομοιότητα σε επίπεδο γενετικού υλικού του πυρήνα κατά 75%.
  33. Ο Punnett ρωτήθηκε κάποτε αν θα θυσιαζόταν στο όνομα της Βασίλισσας της Αγγλίας. Εκείνος απάντησε: «για την Βασίλισσα όχι, άλλα για δυο αδέλφια μου ή για 4 πρώτα ξαδέλφια μου ναι.» Δώστε μια εξήγηση για αυτήν την απάντηση του μεγάλου γενετιστή.
  34. Δυο κατσίκες που είναι μονοζυγωτικά δίδυμα διασταυρώθηκαν με τον ίδιο τράγο διαδοχικά η μια μετά την άλλη. Τα κατσικάκια που γεννήθηκαν είχαν πανομοιότυπο γενετικό υλικό και πυρηνικό και μιτοχονδριακό.
  35. Δυο κριοί μονοζυγωτικα δίδυμα διασταυρώθηκαν με δυο προβατίνες επίσης μεταξύ τους μονοζυγωτικά διδυμα την ιδια χρονικη περιοδο. Τα προβατακια ειχαν το ιδιο μιτοχονδριακο DNA και διαφορετικο πυρηνικο.
  36. Αν τα παραπάνω ζευγάρια ήταν καθαρές σειρές, οι μεν κριοί για την γαλακτοπαραγωγή και οι δε προβατίνες για την ποιότητα του μαλλιού, τότε τα προβατάκια θα ήταν όλα κλώνοι μεταξύ τους.
  37. Από την διασταυρωση ενός ατόμου ΑΑ με ένα άτομο αα, σύμφωνα με το πρότυπο διασταυρωσεων κατά Μεντελ, στην δεύτερη θυγατρική γενεά το 75% των απόγονων θα έχουν τον επικρατή φαινότυπο. Άρα, μπορούμε να υποθέσουμε ότι εξαιτίας της αριθμητικής υπεροχής του, το επικρατές αλληλομορφο θα γίνεται όλο και πιο κοινό στον πληθυσμό και το υπολειπόμενο όλο και πιο σπάνιο.
  38. ολα τα άτομα της πρώτης θυγατρικής γενεάς στα πειράματα του Μεντελ είναι μεταξύ τους κλώνοι.
  39. το ανάπτυγμα κύβου της παράστασης (3+1) μας δίνει την μενδελικη αναλογία τριυβρυδισμου.
  40. Καθαρη σειρά σημαίνει άτομα ομοζυγα αποκλειστικά για το γονίδιο που ελέγχει τον υπό μελέτη χαρακτήρα.
  41. Τα υβρίδια είναι μεταξύ τους κλώνοι.
  42. Ο χαρακτήρας ύψος ελέγχεται μονογονιδιακά σε όλους τους πολυκύτταρους οργανισμούς.
  43. Η αναλογία 3 προς 1 κατά την μελέτη δυο χαρακτήρων που ελέγχονται μονογονιδιακα με δυο αλληλομορφα  με σχέση πλήρους επικράτειας -υποτέλειας, προκύπτει οταν το ενα  ειναι εμβρυακο θνησιγονο σε ομοζυγη κατασταση (το υπολοιπομενο) ή οταν τα γονιδια ειναι συνδεδεμενα.
  44. Αν ο Μεντελ στις διασταυρωσεις μονουβριδισμου που πραγματοποίησε, εβρισκε τις εξης αναλογιες στην F2 γενεα: 8 [Α]:[α], θα διατυπωνε τον πρωτο νομο του ως εξης: Κατα την μείωση Ι, διαχωριζονται τα ομολογα χρωμοσώματα τυχαία μεν,  ισοπιθανα δε και κατανέμονται στους γαμετες. Η γονιμοποιηση ειναι τυχαιο γεγονος.
  45. Το υψος σε όλα τα είδη των οργανισμών είναι μονογονιδιακο χαρακτηριστικό.
  46.  Οι αιμομιξίες οδηγούν σε αύξηση της ομοζυγωτίας για τα ευνοϊκά χαρακτηριστικά ενός πληθυσμού σε βάθος γενεών.
  47. Οι αιμομιξίες έχουν οδηγήσει στο παρελθόν στην κατάρρευση βασιλικών δυναστειών.
  48. Από γονείς με ομάδα αίματος Α και Β αντίστοιχα, μπορούμε να έχουμε απογόνους με όλες τις διαφορετικές ομάδες αίματος ως προς το σύστημα ΑΒΟ.
  49.  Για έναν πολυγονιδιακό χαρακτήρα που ελέγχεται μόνο από αυτοσωμικά γονίδια ισχύει ο πρώτος νόμος του Μέντελ, για κάθε επιμέρους γονίδιο που τον ελέγχει καθώς και ο δεύτερος νόμος για όσα από τα γονίδια που τον ελέγχουν, δεν είναι συνδεδεμένα.
  50. Ένα χαρακτηριστικό χαρακτηρίζεται ως υπολειπόμενο όταν δεν εμφανίζεται φαινοτυπικά στο ετερόζυγο άτομο για αυτό το χαρακτηριστικό.
  51.  Ένα χαρακτηριστικό είναι φυλοσύνδετο υπολειπόμενο όταν από την διασταύρωση ετερόζυγων ατόμων προκύπτει αναλογία θηλυκών / αρσενικά 1:1 και φαινοτυπική αναλογία 3:1, οπού όλα τα άτομα με το χαρακτηριστικό είναι αρσενικά.
  52.  Το γονίδιο της αχρωματοψίας στο κόκκινο είναι διαφορετικό αλλά συνδεδεμένο με το γονίδιο της αχρωματοψίας στο πράσινο.
  53. Ο Μέντελ μελέτησε επτά χαρακτήρες του φυτού μοσχομπίζελο.
  54. Η πιθανότητα ένα παιδί να είναι αγόρι είναι 1/2 , διότι ο αρσενικός γονέας δημιουργεί δυο πιθανούς γαμέτες , αυτούς με Χ φυλετικό χρωμόσωμα και αυτούς με Υ φυλετικό χρωμόσωμα ενώ ο θηλυκός γονέας δημιουργεί μόνο γαμέτες με Χ φυλετικό χρωμόσωμα.
  55. Δεν δημιουργούνται επικρατή θνησιγόνα αλληλόμορφα γονιδίων.
  56. Ο πρώτος νόμος του Μεντελ στηρίζεται στην πρώτη μειωτική διαίρεση και ο δεύτερος νόμος στην δεύτερη μειωτική διαίρεση.
  57.  Και οι δυο νόμοι του Μεντελ στηρίζονται στο ίδιο στάδιο της μείωσης, στον διαχωρισμό των αδελφών χρωματίδων.
  58.  Ο δεύτερος νόμος του Μεντελ δεν ισχύει για μονογονιδιακούς χαρακτήρες.
  59. Είναι αδύνατον να προκύψει υγιές παιδί από γονείς που νοσούν από οικογενή υπερχολιστεριναιμία.
  60.  Στην πρώτη μειωτική διαίρεση συμβαίνει διαχωρισμός αδελφών χρωματίδων και επιχιασμός και στην δεύτερη μειωτική διαίρεση συμβαίνει αποχωρισμός ομολόγων χρωμοσωμάτων και σύναψη τους στο ισημερινό πεδίο του κυττάρου.
  61. Στα αγόρια υπάρχει περισσότερο γενετικό υλικό μητρικής προέλευσης ενώ στα κορίτσια το γενετικό υλικό τους είναι 50% μητρικής και 50% πατρικής προέλευσης.
  62.  Η αυτογονιμοποιήση των φυτών δεν συμβάλει στην γενετική ποικιλότητα τους.
  63. Η φαινοτυπική σχέση επικρατείας μεταξύ των αλληλομόρφων ενός γονιδίου προκύπτει με βάση το φαινότυπο του ετερόζυγου ατόμου.
  64.  Η σχέση επικρατείας των αλληλομόρφων ενός γονιδίου σε μοριακό επίπεδο ταυτίζεται πάντα με την φαινοτυπική σχέση επικρατείας τους.
  65.  Το 1940 οι επιστήμονες ήξεραν ότι το γενετικό υλικό δεν είναι οι υδατάνθρακες και τα λιπίδια επειδή είχε διατυπωθεί ήδη η χρωμοσωμική θεωρία της κληρονομικότητας.
  66. Οι νομοί του Μεντελ και ο επιχιασμος, είναι ικανές και αναγκαίες συνθήκες για την αλλαγή των συχνοτήτων των αλληλομορφων σε ένα πληθυσμό.
  67. Οι επιλεκτικές διασταυρώσεις είναι βιοτεχνολογική μέθοδος.

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

     

 

Ερωτήσεις κατανόησης – Kεφαλαίου 4. H τεχνολογια του ανασυνδυασμενου DNA

  1. Μπορούμε να δημιουργήσουμε γονιδιωματική βιβλιοθήκη RNA ιών με δίκλωνο
  2. Μπορούμε να δημιουργήσουμε γονιδιωματική βιβλιοθήκη RNA ιών με μονόκλωνο
  3. Μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη για το οπερόνιο της λακτόζης από το coli.
  4. Μπορούμε να δημιουργήσουμε cDNA βιβλιοθηκή για τα γονίδια του λυσιγόνου κύκλου ζωής του λ-φάγου.
  5. Μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη για ένα ορισμένο γονίδιο του πρωτοζώου που προκαλεί την ελονοσία.
  6. Μπορεί να υπάρξει ως φορέας κλωνοποίησης πλασμίδιο χωρίς να διαθέτει κανένα γονίδιο ανθεκτικότητας σε κάποιο αντιβιοτικό.
  7. Μπορεί να υπάρξει φορέας κλωνοποίησης χωρίς να διαθέτει γονίδιο ανθεκτικότητας σε κάποιο αντιβιοτικό.
  8. Είναι δυνατή η δημιουργία cDNA βιβλιοθήκης με φορέα κλωνοποίησης DNA λ φάγου.
  9. Με PCR είναι αδύνατη η κλωνοποίηση ιικού δίκλωνου
  10. Μπορούμε να δημιουργήσουμε βιβλιοθήκες από ώριμα ερυθρά αιμοσφαίρια μας.
  11. Η γονιδιωματική βιβλιοθήκη του ανθρώπου που δημιουργείται από κύτταρα στη φάση G2 του κυτταρικού κύκλου αναμένεται να έχει 6*10^5 φαγικές πλάκες, όταν δημιουργείται με φορέα κλωνοποίησης DNA λ-φάγου.
  12. Δεν μπορούμε να δημιουργήσουμε γονιδιωματική βιβλιοθήκη από γαμετικό μας κύτταρο διότι διαθέτει ένα αντίγραφο από κάθε μας γονίδιο.
  13. Είναι προτιμότερο τα κύτταρα που χρησιμοποιούμε για την δημιουργία γονιδιωματικής βιβλιοθήκης να μην βρίσκονται στο στάδιο της μετάφασης της μίτωσης.
  14. Τα ομόλογα χρωμοσώματα εμφανίζουν ακριβώς τα ίδια σημεία αναγνώρισης από την ίδια περιοριστική ενδονουκλεάση (Π.Ε.).
  15. Τα τμήματα DNA που προκύπτουν από την πέψη ενός χρωμοσώματος με την EcoRI έχουν όλα το ίδιο περίπου μήκος σε ζεύγη βάσεων, διαφέρουν όμως ως προς την αλληλουχία.
  16. Η γονιδιωματική βιβλιοθήκη ενός ρετροϊού είναι αδύνατον να δημιουργηθεί.
  17. Σε έναν RNA ιό με γενετικό υλικό δίκλωνο κυκλικό RNA υπάρχει η αλληλουχία:

5′ ———–CCCGGG———3′

3′————GGGCCC———5′

πέντε φορές ,όποτε μετά από επώαση του γονιδιώματος αυτού του ιού με την περιοριστική ενδονουκλεάση SmaI που αναγνωρίζει την παραπάνω αλληλουχία, αναμένεται να προκύψουν 5 τμήματα.

  1. Θα μπορούσαμε να χρησιμοποιήσουμε μια ολιγονουκλεοτιδική μονόκλωνη αλληλουχία που να αποτελείται από δεοξυνουκλεοτίδια και από ριβονουκλεοτίδια ως ανιχνευτή, για τον εντοπισμό του επιθυμητού τμήματος DNA μέσα από μια βιβλιοθήκη .
  2. Σε ένα φορέα κλωνοποίησης είναι αδύνατον να ενθέσουμε τμήμα δίκλωνου DNA με διαφορετικά κολλώδη άκρα στις δυο πλευρές του.
  3. Από την cDNA βιβλιοθήκη του μαμούθ μπορούμε να απομονώσουμε μια αρχέγονη ευκαρυωτικη πρωτεΐνη και να την μελετήσουμε.
  4. Το χλωροπλαστικό DNA μπορεί να χρησιμοποιηθεί ως φορέας κλωνοποίησης αφού μπορεί να αντιγράφεται ανεξάρτητα.
  5. H cDNA βιβλιοθήκη με φορέα κλωνοποίησης DNA λ φάγου είναι βιβλιοθήκη έκφρασης των γονιδίων.
  6. Οι cDNA βιβλιοθήκες από δυο διαφορετικούς γαμέτες του ίδιου ατόμου είναι διαφορετικές.
  7. Η γονιδιωματική βιβλιοθήκη του γαμέτη ενός είδους περιεχέι και τον γονότυπο του ατόμου από το οποίο πήραμε τον γαμέτη.
  8. Δημιουργούμε cDNA βιβλιοθήκη προκαρυωτικών κυττάρων και βακτηριοφαγων.
  9. Δημιουργούμε cDNA βιβλιοθήκη ιών ευκαρυωτικων οργανισμών.
  10. Το φίλτρο νιτροκυτταρινης χρησιμοποιειται όπως και το σκούρου χρώματος βελούδο για να εντοπίσουμε πάνω τους τον κλώνο της βιβλιοθήκης που φέρει το ετερολογο τμήμα DNA που μας ενδιαφέρει.
  11. Κατά την δημιουργία γονιδιωματικης βιβλιοθήκης του  Τ4 η ανάμειξη των θραυσμάτων του γονιδιώματος και των πλασμιδιων πρέπει να γίνεται παρουσία DNA δεσμασης σε ένα ρυθμιστικό αλκαλικό διάλυμα.
  12. Μετά την πέψη του ανθρωπινού πυρηνικού DNA με την EcoRI πόσα είναι τα τμήματα που προέκυψαν και δεν μπορούν να ανασυνδυαστούν άμεσα;
  13. Δεν είναι δυνατή η δημιουργία γονιδιωματικης βιβλιοθήκης του βακτηρίου E.coli  σε ξενιστή E.coli.
  14. Με Αλυσιδωτή Αντίδραση Πολυμερασης μπορούμε να ενισχύουμε και ολόκληρα πλασμίδια.
Εξώφυλλο Βιβλίου Βιολογίας Θετικής Κατεύθυνσης Β' Τόμος

Ερωτήσεις κατανόησης 2ου Κεφαλαίου Βιολογία Θετικού Προσανατολισμού.

 

  1. Τα διαφορετικά μονομερή που δομούν τα νουκλεϊκά οξέα είναι συνολικά πέντε.
  2. In vivo είναι αδύνατο να δημιουργηθεί φωσφοδιεστερικός δεσμός ανάμεσα σε δεσοξυριβονουκλεοτίδιο και ριβονουκλεοτίδιο.
  3. Όλες οι RNA πολυμεράσες δημιουργούν μόρια RNA διαβάζοντας DNA.
  4. In vivo συντίθεταιDNA με μήτρα ριβονουκλεϊκό οξύ.
  5. Οι Watson και Crick απέδειξαν τον ημισυντηρητικό τρόπο αντιγραφής του DNA.
  6. Οι διαδικασίες στα κύτταρα λαμβάνουν χώρα με την παρακάτω σειρά: Αντιγραφή->Μεταγραφή->Μετάφραση.
  7. Για τη μεταγραφή ενός γονιδίου απαιτείται η προσωρινή αποδόμηση των νουκλεοσωμάτων του .
  8. Η μεγάλη ποικιλία μεταγραφικών παραγόντων στα ευκαρυωτικά κύτταρα εξυπηρετεί την μεγάλη ποικιλία υποκινητών των γονιδίων τους.
  9. Η μεγάλη ποικιλία υποκινητών στα ευκαρυωτικά γονίδια εξυπηρετεί τον πολύ υψηλό βαθμό εξειδίκευσης των κυττάρων αυτών.
  10. Το μόριο tRNA με αντικωδικόνιο CATείναι φορτισμένομε το εναρκτήριο αμινοξύ της πρωτεϊνοσύνθεσης.
  11. Όλες οι πρωτεΐνες συντίθενται έχοντας ως πρώτο αμινοξύ την μεθειονίνη και δεν μπορούν να φέρουν αλλού αυτό το αμινοξύ.
  12. Ένα βακτηριακό στέλεχος E.coli είναι δυνατό να αδυνατεί να αναπτυχθεί παρουσία λακτόζης παρόλο που διαθέτει lac οπερόνιο.
  13. Η γονιδιακή ρύθμιση στα βακτήρια δεν μπορεί να στηρίζεται στην ποικιλία των βακτηριακών υποκινητών.
  14. Η κυτταρική διαφοροποίηση συμβαίνει μονάχα κατά την εμβρυακή ηλικία.
  15. Η υπερέκφραση ενός γονιδίου μπορεί να συμβεί με τη δημιουργία πολυσώματος και την πολλαπλή μεταγραφή του.
  16. Όταν δύο ζυγωτά φυτών βρεθούν στις ίδιες συνθήκες περιβάλλοντος θα δώσουν φυτά του ίδιου είδους.
  17. Η ικανότητα πρόσδεσης του mRNA με τα ριβοσώματα διαφέρει μεταξύ διαφορετικών μορίων mRNA.
  18. Το πολύσωμα είναι ένα σύμπλοκο ριβοσωμάτων με ένα μόριο mRNA.
  19. Το σύμπλεγμα έναρξης περιλαμβάνει ένα μόριο mRNA, ένα μόριο tRNA, ένα ορισμένο αμινοξύ και την μικρή υπομονάδα του ριβοσώματος.
  20. Το πριμόσωμα είναι ένα ειδικό σύμπλοκο ενζύμων.
  21. Την γενετική οδηγία για το χρώμα της ίριδας του προ-πάππου σας δεν αποκλείεται να την φέρετε και εσείς.
  22. Οι Monod και Jacob έθεσαν τα θεμέλια για την κατανόηση της ρύθμισης της έκφρασης της γενετικής πληροφορίας.
  23. Έστω ότι μέχρι σήμερα υπάρχουν γνήσιοι απόγονοι του Σωκράτη, τότε δεν αποκλείεται κάποιος από αυτούς να φέρει μόνο τον ένα από τους δύο κλώνους τουλάχιστον ενός από τα χρωμοσώματα του αρχαίου φιλόσοφου.
  24. Τα γονίδια των ευκαρυωτικών κυττάρων που κωδικοποιούν για μεταγραφικούς παράγοντες δεν απαιτούν για τη μεταγραφή τους κατάλληλο συνδυασμό από μεταγραφικούς παράγοντες.
  25. Τα θυγατρικά κύτταρα του ζυγωτού ενός είδους, όταν αναπτυχθούν στις ίδιες ακριβώς συνθήκες, θα δώσουν το καθένα το τμήμα του οργανισμού που θα έδινε αν παρέμεναν μαζί.
  26. Σε έναν πολυκύτταρο ευκαρυωτικό οργανισμό τα κύτταρα κάθε κυτταρικού τύπου περιέχουν καθορισμένη ποιότητα και ποσότητα πρωτεϊνών που διαφέρει από τα κύτταρα των άλλων κυτταρικών τύπων του ίδιου οργανισμού.
  27. Η DNA δεσμάση δεν δρα στο νεοσυντιθέμενο κλώνο που συντίθεται συνεχώς.
  28. Σε ένα προκαρυωτικό κύτταρο κατά την αντιγραφή του DNA δρουν ταυτόχρονα τέσσερις DNA πολυμεράσες που δημιουργούν τους νέους κλώνους.
  29. Σε όλα τα κύτταρα ενός οργανισμού εκφράζονται κάποια κοινά γονίδια π.χ. αυτά των ιστόνων.
  30. Η διαδικασία σύνθεσης νέου μορίου mRNA είναι δυνατό να ξεκινήσει πριν την ολοκλήρωση της μεταγραφής του γονιδίου.
  31. Η μεταγραφή των προκαρυωτικών γονιδίων λαμβάνει χώρα κυρίως  στο πυρηνοειδές.
  32. Πολλά μόρια RNAs μπορούν να μεταγράφονται ταυτόχρονα από μία μη-κωδική αλυσίδα.
  33. Η προσθήκη ενός ζεύγους νουκλεοτιδίων στο μεταφράσιμο τμήμα ενός γονιδίου έχει ως συνέπεια μια πρωτεΐνη που διαφέρει από την φυσιολογική κατά τρία αμινοξέα.
  34. Κατά την αντιγραφή του DNA ενός ανθρώπινου κυττάρου τοποθετούνται 12*109 νέα δεσοξυνουκλεοτίδια, έτσι το γονιδίωμα μας, μετά την αντιγραφή έχει μέγεθος 12*109  ζεύγη βάσεων.
  35. Η DNA πολυμεράση αναμένεται να τοποθετήσει λάθος 120.000 νουκλεοτίδια κατά την αντιγραφή των σωματικών κυττάρων μας και 60.000 νουκλεοτίδια κατά την αντιγραφή του γενετικού υλικού του γαμέτη μας.
  36. Στην φάση της μεσόφασης μετά την αντιγραφή του γενετικού υλικού μας, αναμένεται να υπάρχει ένα μόνο λάθος σε ζεύγη νουκλεοτιδίων σε ολόκληρο το γονιδίωμα μας.
  37. Όλα τα γονίδια ενός οργανισμού έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  38. Όλα τα γονίδια όλων των οργανισμών έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  39. Όλα τα γονίδια έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  40. Όλες οι πρωτεΐνες ενός οργανισμού έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  41. Όλες οι πρωτεΐνες όλων των οργανισμών έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  42. Οι πρωτεΐνες είναι τα βιολογικά μακρομόρια που καταλύουν τις βιοχημικές αντιδράσεις και συντελούν στην δόμηση των οργανισμών.
  43. Οι πρωτεΐνες στα κύτταρα αποτελούν κατά το πλείστων ανεξάρτητες και αυτόνομες μονάδες. Τα γονίδια στα κύτταρα δεν είναι ανεξάρτητες διακριτές μονάδες.
  44. Οι προκαρυωτικοί οργανισμοί δεν διαθέτουν επιδιορθωτικά ένζυμα και δεν επιτελούν μετά-μετάφραση στις πρωτεΐνες τους.
  45. Το RNA που προκύπτει από την μεταγραφή είναι ίδιο σε αλληλουχία νουκλεοτιδίων, μόνο που αντί για θυμίνη έχει ουρακίλη, με την κωδική αλυσίδα του γονιδίου που το κωδικοποιεί.
  46. Το RNA που προκύπτει από την μεταγραφή είναι ίδιο σε αλληλουχία αζωτούχων βάσεων, μόνο που αντί για θυμίνη έχει ουρακίλη, με την κωδική αλυσίδα του γονιδίου που το κωδικοποιεί.
  47. Ο γενετικός κώδικας είναι σχεδόν καθολικός. Όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα. Το σχεδόν αναφέρεται π.χ. στις διαφορές στην αντιστοίχηση των κωδικονίων με τα αμινοξέα που εμφανίζονται στα μιτοχόνδρια των ζωικών κυττάρων.
  48. Κωδικόνια υπάρχουν και στην μη κωδική αλυσίδα ενός γονιδίου.
  49. Το E.coli έχει περίπου 3000 γονίδια και μέγεθος γονιδιώματος περίπου τέσσερα εκατομμύρια ζεύγη βάσεων.
  50. Στο οπερόνιο της λακτόζης τα τρία δομικά γονίδια (Z-Y-A) κωδικοποιούν για τις πρωτεΐνες β-γαλακτοζιδάση, περμεάση, τρανσακετυλάση.
  51. Ένα ορισμένο μόριο mRNA  κωδικοποιεί για μια μοναδική πρόδρομη πολυπεπτιδική αλυσίδα. Μια συγκεκριμένη πρόδρομη πολυπεπτιδική αλυσίδα είναι δυνατόν να κωδικοποιείται από περισσότερες τις μιας διαφορικές αλληλουχίες νουκλεοτιδίων mRNA.
  52. Είναι δυνατόν να υπάρχουν δυο διαφορετικές πρωτεΐνες με την ίδια ποσοστιαία σύσταση σε αμινοξέα.
  53. Δεν υπάρχουν υποκινητές γονιδίων που να αποτελούνται από ριβονουκλεοτίδια.
  54. Συνήθως οι ιικοί υποκινητές είναι ισχυρότεροι από τους υποκινητές των γονιδίων των κυττάρων των ξενιστών των ιών.
  55. Το οπερόνιο που κωδικοποιεί τα ένζυμα για την βιοσύνθεση ενός αμινοξέος θα περιμέναμε να έχει ως επαγωγέας της έκφρασης του το ίδιο το αμινοξύ όταν αυτό βρίσκεται μέσα στο βακτηριακό κύτταρο.
  56. Κατά την μετα-μεταγραφή πραγματοποιείται και διάσπαση και δημιουργία ομοιοπολικών δεσμών.
  57. Κατά την μετα-μετάφραση πραγματοποιείται και διάσπαση και πιθανόν και δημιουργία ομοιοπολικών δεσμών.
  58. Κατά την ωρίμανση συμβαίνει πρώτα αποδιάταξη των δύο πολυνουκλεοτιδικών κλώνων.
  59. Μια πρόδρομη πρωτεΐνη 100 αμινοξέων υφίσταται μετα-μεταφραστική πρωτεϊνόλυση σε τρία σημεία της. Μεταξύ του πεμτου και έκτου αμινοξεος, μεταξύ του τεσσαρακοστού και του τεσσαρακοστού πρώτου και μεταξύ του εξηκοστού έκτου και εξηκοστού εβδόμου αμινοξέος. Το τμήμα με το αρχικό αμινικο άκρο απομακρύνεται η λειτουργική πρωτεΐνη θα αποτελείται από τρία πεπτίδια ενωμένα με δισουλφιδικούς δεσμούς.
  60. Οπερόνια υπάρχουν μόνο στο κυρίως γενετικό υλικό των βακτηρίων.
  61. Κάθε εξώνιο ενός διακεκομμένου γονιδίου πρέπει να αποτελείται από πλήθος ζευγών βάσεων που είναι ακέραιο πολλαπλάσιο του τρία.
  62. Τα εσώνια στα διακεκομμένα γονίδια είναι ζεύγη δεοξυνουκλεοτιδίων.
  63. Ο Τ2 έχει DNA δίκλωνα γονίδια, και μερικά έχουν και εσώνια.
  64. Πριν από την απόδειξη του ημισυντηριτικού μηχανισμού της αντιγραφής, ένα από τα προτεινόμενα μοντέλα του μηχανισμού της αντιγραφής του DNA, ήταν ο δισπαρτικος. Σύμφωνα με αυτό τον μηχανισμό στο τέλος κάθε αντιγραφής προκύπτουν δυο νέα μόρια DNA αποτελούμενα το καθένα από δυο κλώνους, που ο καθένας αποτελείται από τυχαία τμήματα μητρικού και θυγατρικού κλώνου. Αν ένα βακτήριο αρχικά αναπτύσσεται σε περιβάλλον με 100% βαρύ Ν και μετά μεταφερθεί σε περιβάλλον με 100% ελαφρύ Ν και πραγματοποιηθούν  δυο διαδοχικές κυτταρικές διαιρέσεις, κάθε κύτταρο που προέκυψε από την δεύτερη διαίρεση θα φέρει ίση ποσότητα βαρύ Ν με κάθε κύτταρο που προέκυψε από την πρώτη διαίρεση, θεωρώντας ότι τα τμήματα του κάθε μορίου DNA που σχηματίζεται δημιουργούνται με τυχαία μεν άλλα ισοπίθανη κατανομή τμημάτων DNA μητρικών και θυγατρικών.
  65. Όλοι οι επιδιορθωτικοί μηχανισμοί που λειτουργούν κατά την αντιγραφή λειτουργούν και σε όλη την διάρκεια της μεσόφασης.
  66. οι 5΄και 3΄ αμετάφραστες  περιοχές ενός γονιδίου έχουν το ίδιο μέγεθος και διαφορετικό ρυθμιστικό ρόλο στην έκφραση των γονιδίων.
  67. Σύμφωνα με την θεωρία για την εξελικτική προέλευση των μιτοχονδρίων και των χλωροπλαστών, θα αναμένετο τα γονίδια του DNA των οργανιδίων αυτών να μην έχουν εσώνια.
  68. Αποκοπή των εσωνίων και συρραφή των εξωνίων υφίστανται μόνο τα πρόδρομα mRNA των διακεκομμένων γονιδίων που κωδικοποιούν για πολυπεπτίδιο.
  69. Το σύνολο των διαδικασιών που περιλαμβάνει η ωρίμανση αφορά όλα τα πρόδρομα RNA.
  70. Τα tRNA γονίδια φέρουν τα αντικωδικόνια στην μη κωδική αλυσίδα τους.
  71. Υπάρχουν και μονόκλωνοι υποκινητές γονιδίων.
  72. ο κλώνος που αντιγράφεται ασυνεχώς έχει το 5′ άκρο του προς την ΘΕΑ.
  73. ο κλώνος που συντίθεται ασυνεχώς έχει το 3′ άκρο του προς τη ΘΕΑ.
  74. Στην φάση G2 του κυτταρικού κύκλου έχουμε 4 αντίγραφα ενός αυτοσωμικού γονιδίου και αν το γονίδιο εκφράζεται, τότε εκφράζονται και τα 4 αντίγραφα.
  75. Ο κανόνας της συμπληρωματικότητας και της αντιπαραλληλίας είναι τα κριτήρια της επιλογής από το ένζυμο της μεταγραφής, για το ποιος κλώνος του γονιδίου είναι ο μεταγραφόμενος.
  76. Η διατύπωση » έτσι τα δυο θυγατρικά μόρια DNA που προκύπτουν από την αντιγραφή είναι πανομοιότυπα μεταξύ τους και με το μητρικό μόριο DNA» ,είναι λανθασμένη καθώς τα θυγατρικά μόρια είναι μεταξύ τους πανομοιότυπα άλλα όχι και πανομοιότυπα με το μητρικό μόριο DNA από το οποίο προήλθαν.
  77. Τα θυγατρικά μόρια DNA που προκύπτουν από την αντιγραφή είναι μικρότερου μήκους (σε πλήθος ζευγών βάσεων) από το μητρικό μόριο DNA.
  78. Η DNA δεσμάση δρα στην αρχή κάθε πρωταρχικού τμήματος κατά την αντικατάσταση του από την κατάλληλη DNA πολυμεράση.
  79. Τα αυτοσωμικά ομόλογα χρωμοσώματα έχουν ακριβώς τις ίδιες Θέσεις Έναρξης της Αντιγραφής.
  80. Οι αδελφές χρωματίδες έχουν ακριβώς τις ίδιες ΘΕΑ.
  81. Εντός ενός φυσιολογικού βακτηρίου E.coli, υπάρχουν ένας χείριστης του οπερονίου της λακτόζης και ένα πλήθος από πρωτεΐνες καταστολής.
  82. Το οπερόνιο της λακτόζης εκφράζεται πάντα σε φυσιολογικό κύτταρο E.coli  αρκεί να υπάρχουν μόρια λακτόζης εντός του, σε οποιοδήποτε πλήθος.
  83. Ένας ευκαρυωτικός γενετικός τόπος μπορεί να κωδικοποιεί για περισσότερες από ενός είδους διαφορετικές πολυπεπτιδικές αλυσίδες.
  84. Δίνεται η παρακάτω υποθετική κωδική αλυσίδα του γονιδίου Ζ του οπερονίου της λακτόζης: 5΄ΥΠΟΚΙΝΗΤΗΣ-ΧΕΙΡΙΣΤΗΣ-ATGACTGGATCATGCCATGGGGATG……………ΠΛΗΘΟΣ ΝΟΥΚΛΕΟΤΙΔΙΩΝ ΑΚΕΡΑΙΟ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΤΡΙΑ………………………………………………….ATGATGΤΑΑTGAGGTAGCCTAAGTCTGTA3′ το κωδικόνιο έναρξης βρίσκεται σίγουρα 11 νουκλεοτίδια μετά τον χειριστή.
  85. Ένα διακεκομμένο γονίδιο με 3 εσώνια δίνει 1 πρόδρομο και 8 διαφορετικά ώριμα μόρια mRNA.
  86. Εντός της μεγάλης υπομοναδας του ριβοσωματος κατά την επιμήκυνση του πολυπεπτιδίου κάθε φορα δημιουργείται ένας ομοιοπολικός δεσμός και διασπάται ένας ομοιοπολικός δεσμός.
  87.  H DNA πολυμεράση μπαίνει στον πυρήνα όπως και τα μόρια snRNA.
  88. Τα μορια tRNA των προκαρυωτων και των ευκαρυωτων έχουν το ίδιο μέγεθος , δευτεροταγή δομή, και αλληλουχία και μορια με το ίδιο αντικωδικόνιο είναι φορτισμένα με το ίδιο αμινοξύ.
  89. Τα γονίδια που κωδικοποιούν για tRNA τόσο στους ευκαρυωτες όσο και στους  προκαρυωτες έχουν την ιδια αλληλουχία και το ίδιο μέγεθος.
  90. Το βακτηριακό γενετικό υλικο «κονταίνει» σε κάθε κύκλο αντιγραφής.
  91. Είναι δυνατόν να εισάγουμε βακτηριακο mRNA σε φυτικό εκχύλισμα και να πάρουμε πολυπεπτιδιο μικρότερο από το φυσιολογικό βακτηριακο πολυπεπτιδιο.
  92. Σε ένα πολυπεπτιδικό μόριο είναι δυνατόν το πλήθος των ομοιοπολικών δεσμών του που ενώνουν τα μονομερή  να είναι όσο και το πλήθος των μονομερών του.
  93. Μεταξύ των διαδικασιών του κεντρικού δόγματος της Βιολογιας που λαμβάνουν χώρα  σε ένα φυσιολογικό κύτταρο, η αντιγραφή, συμβαίνει μόνο μια φορά και η μεταγραφή και η μετάφραση πολλές φορές σε ίσο όμως πλήθος.
  94.  Οι χλωροπλαστες ειναι ημιαυτονομα σωματιδια οπως και τα ριβοσωματα που εχουν τα δικα τους νουκλεικα οξεα.
  95. Κάθε εσώνιο βρίσκεται πάντα ανάμεσα στο τελευταίο κωδικόνιο του προηγουμενου εξωνιου και στο πρώτο κωδικόνιο του εξωνιου που έπεται αυτού του εσωνιου.
  96. Ένα κωδικόνιο μπορεί να ανήκει σε διαφορετικά, αλλα διαδοχικά εξώνια ενός διακεκκομενου γονιδιου.
  97. Η θεση έναρξης της αντιγραφής μπορεί να βρίσκεται μεσα σε ένα γενετικό τόπο αλλα μπορεί και όχι.

Βιολογία Θετικής Κατεύθυνσης Γ’ Λυκείου-Ερωτήσεις κατανόησης 1ου κεφαλαίου-Το γενετικό υλικό.

Κεφάλαιο 1: Το γενετικό υλικό. Από τις Παρακάτω επιλέξτε ποιες προτάσεις είναι σωστές και ποιες προτάσεις είναι λανθασμένες:

1. Τα κύτταρα μιας βακτηριακής αποικίας είναι όλα πανομοιότυπα μεταξύ τους καθώς είναι όλα απόγονοι του ίδιου μητρικού κυττάρου και έχουν πάντοτε την ίδια ποσότητα DNA

Σωστό□ Λάθος□

2. Οι Hershey και Chase πραγματοποίησαν τα κλασικά πειράματά τους για να μελετήσουν πως πολλαπλασιάζεται ένας φάγος (Τ2) και όχι για να αποδείξουν ότι το DNA είναι το γενετικό υλικό των οργανισμών

Σωστό□ Λάθος□

3. Ο άνθρωπος είναι εξελικτικά ανώτερος από το καλαμπόκι, οπότε ο άνθρωπος έχει και περισσότερο DNA από το φυτό αυτό στο γονιδίωμά του.

Σωστό□ Λάθος□

4. Ο πεντανθρακικός δακτύλιος του DNA έχει H στον 2’C.

Σωστό□ Λάθος□

5. Όλες οι πολυνουκλεοτιδικές αλυσίδες έχουν προσανατολισμό 5 -> 3.

Σωστό□ Λάθος□

6. Το γενετικό υλικό των βακτηρίων συνδέεται με το εσωτερικό της κυτταρικής μεμβράνης του κυττάρου.

Σωστό□ Λάθος□

7. Μειοκύτταρα διαθέτουν όλοι οι οργανισμοί.

Σωστό□ Λάθος□

8. Τα νευρικά κύτταρα δεν υφίστανται μίτωση.

Σωστό□ Λάθος□

9. Ο καρυότυπος δύο ανθρώπων είναι πάντοτε ολόιδιος μεταξύ δύο ατόμων.

Σωστό□ Λάθος□

10. Ο HIV διαθέτει δύο πανομοιότυπα μόρια μονόκλωνου γραμμικού RNA συνεπώς είναι διπλοειδής ιός.

Σωστό□ Λάθος□

11. Η μεσόφαση καταλαμβάνει το πλείστο της διάρκειας του κυτταρικού κύκλου ενός ευκαρυωτικού κυττάρου.

Σωστό□ Λάθος□

12. Η σειρά των γεγονότων στην μίτωση είναι G1 -> S-> G2 -> … μετάφαση … -> G1.

Σωστό□ Λάθος□

13. Στη μείωση συμβαίνουν δύο διαδοχικές κυτταρικές διαιρέσεις.

Σωστό□ Λάθος□

14. Όταν ένα είδος έχει γονιδίωμα 32 χρωμοσωμάτων θα έχει σε κάθε κύτταρο της πρώτης μειωτικής διαίρεσης απο 64 μόρια DNA.

Σωστό□ Λάθος□

15. Ένα είδος που φυσιολογικά στον καρυότυπο του μετρήθηκαν 34 μόρια DNA σημαίνει ότι μπορεί να είναι  απλοειδές.

Σωστό□ Λάθος□

16. Όσα είναι τα μόρια DNA στον καρυότυπο τόσα είναι και τα κεντρομερίδια που υπάρχουν, αλλά παρατηρούνται στο οπτικό μικροσκόπιο τα μισά ακριβώς.

Σωστό□ Λάθος□

17. Ισχύει: 1 ινίδιο χρωματίνης (φάση G1) = 1 χρωμόσωμα και επίσης   2 αδελφές χρωματίδες (φάση G2) = 1 χρωμόσωμα άρα 1 ινίδιο χρωματίνης =2 αδελφές χρωματίδες.

Σωστό□ Λάθος□

18. Τα μεταφασικά χρωμοσώματα δεν διαθέτουν νουκλεοσώματα.

Σωστό□ Λάθος□

19. Το μόριο DNA των βακτηρίων πακετάρεται με την βοήθεια ιστονών και μη – ιστονών.

Σωστό□ Λάθος□

20. Τα ινίδια χρωματίνης περιέχουν ιστόνες και αναδιπλώνονται για να σχηματίσουν θηλιές.

Σωστό□ Λάθος□

21. Το μιτοχονδριακό DNA όλων των ευκαρυωτικών οργανισμών είναι κυκλικό δίκλωνο μόριο.

Σωστό□ Λάθος□

22. Το μιτοχονδριακό DNA ορισμένων κατωτέρων πρωτοζώων μπορεί να είναι και πατρικής προέλευσης και όχι μητρικής.

Σωστό□ Λάθος□

23. Συμπληρώστε τον παρακάτω πίνακα τοποθετώντας ενα Χ στο σωστό μέγεθος DNA για κάθε μόριο κυκλικού DNA που δίνεται. Γνωρίζεται οτι οι ιοί διαθέτουν πολύ μικρό γονιδίωμα και ότι ένα μέσο πλασμίδιο έχει μήκος 1μm.

Μόριο κυκλικού δίκλωνου DNA 17*103  ζ.β 28*104 ζ.β 19*102 ζ.β 4*103 ζ.β
Χλωροπλάστης
Μιτοχόνδριο
Πλασμίδιο
Ιός

24. Σε δύο μόρια DNA ίσου μήκους απαντάται Μόριο Α: 51% G-C, 49%  A-T Μόριο Β: 49% G-C, 51% A-T

Ποιό από τα δύο είναι πιο Θερμοανθεκτικό στην αποδιάταξη (αποχωρισμός δυο κλώνων) Α□ Β□

25. Στο πείραμα του Griffith οι ζωντανοί αδροί πνευμονιόκοκκοι μετασχηματιστήκαν από τους λείους ζωντανούς πνευμονιόκοκκους.

Σωστό□ Λάθος□

26. Το πείραμα των Avery et. al απέδειξε τη φύση του γενετικού υλικού των οργανισμών.

Σωστό□ Λάθος□

27. Στα κύτταρα του ίδιου οργανισμού ισχύει Α1=Α2 και Α1=Τ2 αλλά και Τ1=Τ2, όπου Α1= αδενίνες και Τ1= θυμίνες του ενός κυττάρου και Α2= αδενίνες και Τ2 = θυμίνες του δεύτερου κυττάρου.

Σωστό□ Λάθος□

28. Η συμπληρωματικότητα των αζωτούχων βάσεων στο DNA αποτελεί ικανή συνθήκη για τον αυτοδιπλασιασμό του.

Σωστό□ Λάθος□

29. Η ικανότητα αντιγραφής του μόριου είναι αναγκαία συνθήκη για να είναι το γενετικό υλικό.

Σωστό□ Λάθος□

30. Ο προσανατολισμός των πολυνουκλεοτιδικών αλυσίδων είναι πάντα 5’ προς 3’, επειδή κατασκευάζονται με την σύνδεση των μονομερών τους με 5’ προς 3’ φωσφοδιεστερικό δεσμό.

Σωστό□ Λάθος□

31. Η μείωση και η μίτωση αφορούν όλα τα κύτταρα των αμφιγονικά αναπαραγόμενων οργανισμών.

Σωστό□ Λάθος□

32. Το κυρίως γενετικό υλικό των βακτηρίων πακετάρεται με την βοήθεια ιστονών, όμως τα πλασμίδια είναι μη χρωμοσωμικά μόρια γενετικού υλικού τους.

Σωστό□ Λάθος□

33. Το πλήθος των χρωμοσωμάτων δεν μεταβάλλεται κατά την διάρκεια του κυτταρικού κύκλου  των ευκαρυωτικών κυττάρων, όμως δεν ισχύει το ίδιο και για τα μόρια του DNA.

Σωστό□ Λάθος□

34. Το σύνολο των γονιδίων ενός κυττάρου περιέχεται στο γονιδίωμα του.

Σωστό□ Λάθος□

35. Το γονιδίωμα ενός πολυκύτταρου οργανισμού είναι το γενετικό υλικό ενός οποιουδήποτε κυττάρου του.

Σωστό□ Λάθος□

36. Ένα ανθρωπινό μειοκύτταρο διαθέτει 46 χρωμοσώματα και από αυτό προκύπτουν 4 γαμέτες με 23 χρωμοσώματα ο καθένας.

Σωστό□ Λάθος□

37. Τα κύτταρα της 1ης μειωτικής διαίρεσης είναι απλοειδή.

Σωστό□ Λάθος□

38. Η μίτωση εξασφαλίζει γενετική ποικιλότητα, η μείωση όχι.

Σωστό□ Λάθος□

39. Οι προκαρυωτικοί οργανισμοί διαιρούνται με μίτωση.

Σωστό□ Λάθος□

40. Και στις δυο κυτταρικές διαιρέσεις συμβαίνει σύναψη ομολόγων χρωμοσωμάτων.

Σωστό□ Λάθος□

41. Στους γαμέτες μας υπάρχουν 23 ζεύγη ομολόγων χρωμοσωμάτων.

Σωστό□ Λάθος□

42. Οι μιτογόνες ουσίες χρησιμοποιούνται στην δημιουργία καρυότυπου για να σταματήσουν τη μίτωση.

Σωστό□ Λάθος□

43. Τα ινίδια χρωματίνης είναι ίδια στο πλήθος, άλλα με λιγότερα νουκλεοσώματα από τα αντίστοιχα μεταφασικά χρωμοσώματα.

Σωστό□ Λάθος□

44. Η ανθεκτικότητα των βακτηριών στα αντιβιοτικά εξασφαλίζεται από το γονιδιακό προϊόν του κατάλληλου γονιδιού ανθεκτικότητας, και όχι από την ύπαρξη του γονιδιού ανθεκτικότητας σε ορισμένο αντιβιοτικό  στο γονιδίωμα τους.

Σωστό□ Λάθος□

45. Το γενετικό υλικό των ίων μπορεί να είναι RNA, όμως δεν υπάρχουν κύτταρα με γενετικό υλικό RNA.

Σωστό□ Λάθος□

46. Σε ένα βακτήριο, ένα ζεύγος ομολόγων χρωμοσωμάτων του είναι κατά το ήμισυ μητρικής προέλευσης.

Σωστό□ Λάθος□

47. Το φύλο στον άνθρωπο καθορίζεται από την ύπαρξη του Υ φυλετικού χρωμοσώματος, τα προκαρυωτικά κύτταρα δεν έχουν φύλο.

Σωστό□ Λάθος□

48. Ένα άτομο με γονιδίωμα 23 χρωμοσώματα είναι βεβαίως άνθρωπος.

Σωστό□ Λάθος□

49. Τα βακτήρια έχουν λιγότερα μιτοχόνδρια από τα ζωικά κύτταρα, γιατί τα βακτήρια είναι μικρότερου μεγέθους κύτταρα.

Σωστό□ Λάθος□

50. Το γενετικό υλικό των μιτοχονδρίων και των χλωροπλαστών αποτελείται από πλασμίδια.                                                                                                              Σωστό□ Λάθος□

51. Μπορούμε να δημιουργήσουμε καρυότυπο σε πρωτόζωα και μύκητες, δεν μπορούμε όμως να δημιουργήσουμε καρυότυπο απο βακτήρια. Σωστό□ Λάθος□

52. Είναι αδύνατο ο λόγος Α+Τ/G+C δυο διαφορετικών ειδών οργανισμών να είναι ίδιος. Είναι όμως δυνατόν ο λόγος αυτός να είναι ίδιος μεταξύ δυο διαφορετικών ειδών ίων. Σωστό□ Λάθος□

53. Tα χρωμοσώματα αμέσως μετά την ολοκλήρωση της αντιγραφής του DNA ενος κυττάρου ευκαρυωτικού οργανισμού, έχουν τον ίδιο βαθμό συσπείρωσης με τα ινίδια χρωματίνης του κυττάρου αυτού, στην φάση της μεσόφασης πριν απο την αντιγραφή του DNA.                                                                                                                        Σωστό□ Λάθος□

54. Τα γονίδια των ινιδίων χρωματίνης μπορούν να εκφράζονται, τα γονίδια των αδελφών χρωματίδων αποκλείεται να εκφράζονται.                                                        Σωστό□ Λάθος□

55. Ένα ανθρώπινο σωματικό κύτταρο μετά την αντιγραφή του DNA του είναι τετραπλοειδές.                                                                                                                                        Σωστό□ Λάθος□

56.Τα βακτήρια είναι απλοειδή κύτταρα με ένα χρωμόσωμα. Άρα ο καρυότυπος ενός βακτηρίου αποτελείται μόνο από ένα κυκλικό χρωμόσωμα.                                                                                                                                                                                    Σωστό□ Λάθος□

57. Σε κάθε ανώτερο πολυκύτταρο ευκαρυωτικό οργανισμό υπάρχουν κύτταρα που δεν διαιρούνται ούτε με μίτωση, ούτε με μείωση.                                    Σωστό□ Λάθος□

58. Τα κύτταρα μας με ένα αντίγραφο του γονιδιώματος, υφίστανται μείωση αλλά όχι μίτωση.                                                                                                                     Σωστό□ Λάθος□

59. Είναι δυνατόν κάποια μιτοχονδριακή ασθένεια να οφείλεται στον πάτερα ή και στους δύο γονείς.                                                                                                     Σωστό□ Λάθος□

60. Οι φυσιολογικοί καρυοτυποι του ανθρώπου μπορεί να είναι : 44+ΧΥ, 44+ΧΧ, 44+ΥΥ.

61. Το γραμμικό μιτοχονδριακο γενετικό υλικό των κατώτερων πρωτοζώων απαντάται και με την μορφή αδελφών χρωματιδων ενωμένων στο κεντρομεριδιο κατά την φάση G2.

62. Η ουρακιλη είναι πυριμιδίνη.

63. Αν ισχύει ότι ο λόγος A+T/G+C=0,6 στα σωματικά κύτταρα ενός διπλοειδους είδους τότε ο ίδιος λόγος σε ένα γαμέτη του είναι ίσος με 0,3.

64. Αν ο Griffith είχε σκοτώσει τους λείους πλευμονιόκοκκους με αντιβιοτικό, θα είχε τα ίδια αποτελέσματα το πείραμα;

65. Μπορεί να ερμηνευθεί  το πείραμα του Griffith   με την ύπαρξη πλασμιδιου που φέρει το γονίδιο για το κάλυμμα και γονίδιο μεταφοράς;

66. Η δυνατότητα των πλασμίδιων να ανταλλάσουν γενετικό υλικό μεταξύ τους και με το κύριο μόριο DNA του βακτηρίου απαιτεί τα βακτήρια να είναι ζωντανά.

67. Από το πείραμα του Griffith μπορούμε σήμερα να συνάγουμε (ακόμη και αν δεν μας είναι γνωστό το πείραμα των Avery at. al.) ότι οι πρωτεΐνες του βακτηρίου D. pneumoniae αποκλείεται να είναι το γενετικό υλικό του.

68. Ο μετασχηματισμός των βακτηρίων συνέβει για πρώτη φορά στο πείραμα του Griffith.

69.O μετασχηματισμός ορίζεται μόνο όταν το εισερχόμενο στο βακτήριο τμήμα DNA  προσδίδει  στον δέκτη νέες ιδιότητες.

70. Στο πείραμα   των Hershey & Chase δεν αποδεικνύεται ότι δεν απαιτείται η πρόσδεση του καψίδιου στην κυτταρική μεμβράνη για την εισαγωγή και την δράση του DNA του ιού εντός του βακτηριακού κυττάρου.

71. Επειδή τα νευρικά κύτταρα δεν διαιρούνται τα χρωμοσώματα τους δεν αναδιπλώνονται με μη ιστόνες.

72. Ένας άνθρωπος 100 ετών δεν πραγματοποιεί ούτε μίτωση ούτε μείωση στα κατάλληλα κύτταρά του.

73. Οι γαμέτες μπορούν να διαιρούνται σε κυτταροκαλλιέργειες in vitro. Επομένως είναι δυνατόν να δημιουργήσουμε τον καρυότυπο τους.

74. Το γενετικό υλικό των μιτοχονδρίων αναδιπλώνεται με την βοήθεια ιστόνων.

75. Υπάρχουν φωτοσυνθέτοντα κατώτερα πρωτόζωα που δεν διαθέτουν κανένα κυκλικό δίκλωνο μόριο DNA.

76. Μέσα σε ένα χλωροπλάστη ή/και σε ένα μιτοχόνδριο είναι απαραίτητη η ύπαρξη νουκλεοσωμάτων.

77. Στο χλωροπλαστικο γενετικό υλικό αναμένουμε εξαιτίας της θεωρίας της ενδοσυμβίωσης να υπάρχουν γονίδια οργανωμένα σε οπερόνια.

78. Στο πείραμα των Hersey και Chase, στο υπερκείμενο της φυγοκεντρισης δεν εντοπίστηκε ραδιενεργός φωσφόρος άλλα μόνο ραδιενεργό θείο.

79. Οργανισμοί με το ίδιο πλήθος χρωμοσωμάτων έχουν και το ίδιο μέγεθος γονιδιώματος.

80. Όλες οι  πρωτεΐνες που δρουν στα μιτοχόνδρια πρέπει μετά την σύνθεση τους να εισαχθούν σε αυτά.

81. Σε 4 δοκιμαστικούς σωλήνες υπάρχουν: Στον πρώτο, ένα βακτήριο χωρίς πλασμιδια, στο δεύτερο, ένα πλασμιδιο με γονίδιο ανθεκτικότητας στο αντιβιοτικό πενικιλλίνη, στον τρίτο, ένα βακτήριο με το πλασμιδιο αυτό, στον τέταρτο, ένα πλασμιδιο χωρίς γονίδια ανθεκτικότητας. Σε κάθε δοκιμαστικό σωλήνα προστίθεται το αντιβιοτικό πενικιλλίνη, σε πόσους δοκιμαστικούς σωλήνες θα παραμείνει ζωντανό το περιεχόμενο τους;

82. Το φυτικό είδος Zea mays έχει στον πυρήνα του 10 χρωμοσώματα άρα θα έχει και γονιδίωμα μικρότερο από 3*10^9 ζεύγη βάσεων.

83. Υπάρχουν ιοί με χρωμοσωμικό γενετικό υλικό.

84. Τα θερμόφιλα βακτήρια θα πρέπει έχουν γενετικό υλικό με ποσοστό γούνινης μεγαλύτερο από 60 %.

85. Είναι δυνατόν να υπάρχουν ιοί με γενετικό υλικό που περιεχέι ποσοστό αδενίνης μεγαλύτερο από 53%.

86. Στο γονιδίωμα των ιών που προσβάλουν ευκαρυωτικά κύτταρα υπάρχουν γονίδια που κωδικοποιούν για mRNA, tRNA, rRNA, snRNA κ.α.

87. Εικάζεται πως στην αρχέγονη Γη το πρώτο γενετικό υλικό ήταν το RNA. Όμως τελικά η φύση επέλεξε το DNA. Δώστε μια εξήγηση.

88. Οι δεσμοί υδρογόνου μπορούν να δημιουργηθούν και ενδομοριακά σε ένα μονόκλωνο μόριο νουκλεικου οξέος.

89. Το βακτηριακό γενετικό υλικό έχει τριτοτάγη δομή.

90. Το γονιδίωμα της Ελένης Κ. είναι ίδιο με το γονιδίωμα της Έλλης Σ. αφού και οι δυο είναι ανθρωποι και μάλιστα θηλυκά άτομα.

91. Το ανθρωπινο γονιδίωμα έχει μέγεθος 3 δισεκατομυρια ζεύγη βάσεων είτε το άτομο είναι αρσενικό είτε θηλυκό.

92. Το χημικό στοιχειο είναι ισχυρό δηλητήριο για τον άνθρωπο διότι ανήκει στην ιδια περίοδο του περιοδικού πινακα με ένα μακροστοιχείο μας.