Αρχείο κατηγορίας Διαγωνίσματα Κατεύθυνσης

Διαγώνισμα βιολογίας θετικού προσανατολισμού. Κεφάλαια: 1-2-4-7

Ζήτημα 1.                                                                                                   Μονάδες 25

  1. Δίνεται το παρακάτω σχήμα που αναπαριστά ένα χρωμόσωμα.

 

Επαναληπτικό 1-2-4-7-01

Το τμήμα Α θέλουμε να κλωνοποιηθεί in vitro.  Η αντιγραφή τελειώνει κάθε φορά στο τέλος του μητρικού κλώνου που λειτουργεί ως καλούπι.

Μετά από πόσους κύκλους αντιγραφής θα υπάρχει στον δοκιμαστικό σωλήνα για πρώτη φορά το επιθυμητό τμήμα Α.

α. Νo x 2κ

β. 2κ

γ. κ

δ.2

ε. 3

  1. Το τμήμα Α αποτελεί γονίδιο. Το προϊόν της μεταγραφής διαθέτει 70% πουρίνες, από αυτές το 30% δημιουργεί δυο δεσμούς υδρογόνου σε δίκλωνο μόριο. Γνωρίζετε ακόμη ότι η πουρίνη που σχηματίζει δυο δεσμούς υδρογόνου και συμμετέχει στο μεταγράψιμο τμήμα, του γονιδίου Α στην μη κωδική αλυσίδα, αποτελεί το 20% του κλώνου αυτού, στο γονίδιο Α.

Ο λόγος A+T/G+C του γονιδίου Α είναι (στον μη κωδικό κλώνο) στο τμήμα που αντιπροσωπεύεται στο προϊόν της μεταγραφής, μετά την ολοκλήρωση της διαδικασίας.

α. περίπου 7/3

β.1

γ. περίπου ½

δ. περίπου 2/3

ε. Δεν υπολογίζεται

  1. Για την μεταγραφή αυτού του γονιδίου απαιτήθηκε να ξετυλιχθούν 14 νουκλεοσώματα, στα οποία συμπεριλαμβάνονται και εκείνα στα σημεία Μ και Ν, που φαίνονται στην εικόνα 1. Το μήκος του RNA που παράχθηκε αποτελείται από 2746 νουκλεοτίδια. Το χρωμόσωμα έχει μήκος 2 χ 106 ζ.β. και ξεκινάει και τελειώνει με νουκλεόσωμα.  Ποιο είναι το πλήθος των ιστόνων που απαιτούνται για το πακετάρισμα του;

α.  περίπου 2 χ 104

β. περίπου 16 χ 104

γ. περίπου 8 χ 104

δ. 32 χ 104

ε. περίπου 106

  1. Το μεταφράσιμο τμήμα του γονιδίου Α αποτελείται από 600 κωδικόνια. Η 5’ αμετάφραστη περιοχή του, προκαλεί τη δημιουργία συμπλόκου έναρξης με τέτοιο ρυθμό ώστε το αμέσως προηγούμενο ριβόσωμα να έχει ήδη μεταφράσει 10 κωδικόνια μέχρι να συνδεθεί το επόμενο μόριο tRNA σε αυτό . Πόσα   πλήρη ριβοσώματα θα αποτελούν το πολύσωμα του mRNA του γονιδίου Α όταν το πρώτο ριβόσωμα έχει ολοκληρώσει την πολυπεπτιδική αλυσίδα;

α. 60

β.65

γ. 66

δ. 59

ε. 66,6

  1. Η θέση Ε που φαίνεται στο σχήμα έχει την αλληλουχία:

5’ ——————–GGAATTCC——————-3’

3’———————CCTTAAGG——————5’

Α. Υπάρχει η περιοριστική ενδονουλεάση MdI, η οποία αναγνωρίζει την παραπάνω αλληλουχία οκτώ νουκλεοτιδίων και πέμπτει τους φωσφοδιεστερικούς δεσμούς 5’-G-G-3’ καθώς και τους 14 δεσμούς υδρογόνου μεταξύ των παρεμβαλλόμενων ζευγών βάσεων. Πάσα διαφορετικά τμήματα που περιέχουν το γονίδιο Α προκύπτουν μετά την πέψη του χρωμοσώματος με τα ένζυμα EcoRI και MdI, ταυτόχρονα;

α. 1

β.2

γ. 3

δ. 4

ε. Κανένα.

Β. Το διπλανό πλασμίδιο χρησιμοποιήθηκε ως φορέας κλωνοποίησης του τμήματος Α. Πόσα διαφορετικά ανασυνδυασμένα πλασμίδια μπορούν να προκύψουν;

Δίνεται ο φορέας κλωνοποίησης  που θα χρησιμοποιηθεί.

Επαναληπτικό 1-2-4-7-02

 

α. 1

β. 2

γ. 3

δ.4

ε. Κανένα.

Ζήτημα 2.                                                                                           Μονάδες 25

  1. Να αναφέρετε τους λόγους για τους οποίους το βακτήριο Ε. coli χρησιμοποιείται ως οργανισμός μοντέλο της Μοριακής Βιολογίας. (μόρια 4)
  2. Εξηγήστε για ποιο λόγο προσθέτουμε αζωτούχες και φωσφορικές ενώσεις στις πετρελαιοκηλίδες που πρόκειται να «καθαριστούν» με την δράση μικροοργανισμών οι οποίοι μεταβολίζουν το πετρέλαιο.  (μόρια 5)
  3. Κατατάξτε τα γονίδια των οργανισμών ως προς τη θέση τους στο κύτταρο και ως προς τη θέση του γενετικού τους τόπου. (μόρια 5)
  4. Στην εικόνα 1 φαίνεται ένα μέρος μιας βιολογικής διαδικασίας που βρίσκεται σε εξέλιξη.

CUCUUTCT

GAGAAACATGCATACGAC                    Εικόνα 1

α. Να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας.               (μόρια 2)

β. Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1. (μόρια 3)

γ. Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού.              (μόρια 1)

  1. Τα παρακάτω βήματα περιγράφουν μια εργαστηριακή καλλιέργεια μικροοργανισμών. Να τοποθετήσετε τα βήματα στη σωστή σειρά, γράφοντας μόνο τον αντίστοιχο αριθμό. α.προετοιμασία κατάλληλων θρεπτικών υλικών β. εμβολιασμός μικρής ποσότητας του μικροοργανισμού γ. απομόνωση οργανισμού στο εργαστήριο δ. ανάπτυξη καλλιέργειας σε κατάλληλες συνθήκες ε. αποστείρωση θρεπτικών υλικών και μέσων.           (μόρια 5)

Ζήτημα 3.                                                                                                    Μονάδες 25

  1. Δίνονται τα παρακάτω τρία σχήματα, δυο από αυτά αφορούν ακριβώς το ίδιο τμήμα ενός κλώνου ενός μορίου DNA σε διαφορετικές χρονικές στιγμές του κυτταρικού κύκλου ενός ευκαρυωτικού κυττάρου, στο οποίο ανήκει αυτός ο κλώνος DNA. Το τρίτο σχήμα αφορά την ίδια ακριβώς διαδικασία με μια από τις δυο διαδικασίες in vivo που δίνονται. Η διαδικασία που παριστάνεται στο τρίτο σχήμα πραγματοποιείται in vitro.

 

Επαναληπτικό 1-2-4-7-03

Α. Ποιες διαδικασίες αφορούν τα σχήματα 1, 2 και 3;

Β. Να ονομάσετε τις πρωτεΐνες α,β,γ,δ και ε.

Γ. Ποια είναι η λειτουργία του σημείου 1 στο μόριο του DNA;

Ποιες διαφορές γνωρίζετε μεταξύ των σημείων 1 στο μόριο του DNA ανάμεσα στους προκαρυωτικούς και τους ευκαρυωτικούς οργανισμούς;

Υπάρχουν διαφορές μεταξύ των δυο κατηγοριών οργανισμών που αναφέρθηκαν και για τις πρωτεΐνες α, που αναγνωρίζουν τα σημεία όπως το 1;

Δ. Τι είδους βιολογικά μακρομόρια είναι οι κλώνοι ι και ιι καθώς και ιιι;

Ποια δομική διαφορά εντοπίζεται μεταξύ των κλώνων ι και ιιι;

Ε. Ποιες πρωτεΐνες έδρασαν και ποιες πρόκειται να δράσουν ακόμη εκατέρωθεν του σημείου 2;

ΣΤ. πόσες πρωτεΐνες έδρασαν στο σημείο 3; Ονομάστε τις πρωτεΐνες αυτές.

Ζ. Ποιες από τις πρωτεΐνες που εμφανίζονται στα σχήματα εκτελούν εργασίες που έχουν το ίδιο τελικό αποτέλεσμα;

Η. Σε ποιο από τα τρία σχήματα γνωρίζετε ότι ένα προκαρυωτικό ένζυμο  «διαβάζει» ευκαρυωτικό γενετικό υλικό;

Θ. Ποια από τις διαδικασίες που φαίνονται στα σχήματα εκτελείται μια φορά στο δεδομένο τμήμα DNA, στην ζωή του κυττάρου;

Ι. Εξηγήστε τις πρακτικές εφαρμογές που βρίσκει η διαδικασία η οποία εκτελείται in vitro.                                                                                         (μόρια 1.5, 1.5, 1, 2, 2, 1, 2, 1, 1, 1)

  1. Σε ένα εργαστήριο Μοριακής Βιολογίας, επαναλήφθηκαν τα πειράματα που απέδειξαν τον μετασχηματισμό των προκαρυωτικών κυττάρων.

Οι οργανισμοί μελετήθηκαν με σύγχρονα μέσα και τεχνικές που μας παρέχει η τεχνολογία του ανασυνδυασμένου DNA.

Οι επιστήμονες δημιούργησαν την γονιδιωματική βιβλιοθήκη των δυο στελεχών του βακτηρίου D. pneumoniae και απομόνωσαν το γονίδιο που κωδικοποιεί για την πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος στα λεία στελέχη.

Στην συνέχεια με τεχνικές Γενετικής Μηχανικής μετασχημάτισαν ένα πληθυσμό από αδρά στελέχη του βακτηρίου. Από τον πληθυσμό που μετασχηματίστηκε και τον αρχικό πληθυσμό των λείων βακτηρίων, λήφθηκε δείγμα κυττάρων, στο οποίο πραγματοποιήθηκε PCR για την ενίσχυση του γονιδίου που ελέγχει για το κάλυμμα, από το γονιδίωμα των βακτηρίων. Τα αποτελέσματα αναλύθηκαν και πήραμε τα εξής:

Επαναληπτικό 1-2-4-7-04

 

Α. Ποιο από τα βακτηρία που αναλύθηκαν είναι το αδρό , ποιο το λείο και ποιο το μετασχηματισμένο αδρό σε λείο;                                                                         (μόρια 1,5)

Β. Δίνεται ο ένας από τους δύο κλώνους του γονιδίου που ενισχύθηκε και δυο μόρια tRNA που μετείχαν στην μετάφραση του.

5′ …TCAATTAGTGTACCCTTTATGATCACCTGGGTACATTGATTAGAT…3′

3′ UUA5′ και 5′ GUA 3′  τα αντικωδικόνια των δυο μορίων tRNA .

Ο κλώνος που δίνεται είναι ο κωδικός ή ο μη κωδικός του γονιδίου;

Αιτιολογήστε την απάντηση σας.                                                                           (μόρια 1 και 1,5)

Γ. Γνωρίζετε ότι μεταξύ της αλληλουχίας αναγνώρισης του mRNA από την μικρή ριβοσωμική υπομονάδα και του κωδικονίου έναρξης υπάρχουν τέσσερα νουκλεοτίδια της 5′ αμετάφραστης περιοχής. Ποια θα είναι η αλληλουχία της κωδικής αλυσίδας του γονιδίου rRNA που θα συνδέεται με το μόριο mRNA το οποίο θα προκύπτει κατά την μεταγραφή του δοθέντος γονιδίου;                                                                                                                  (μόρια 1)

Δ. Τα αδρά στελέχη του D. pneumoniae,  που χρησιμοποιήθηκαν για να μετασχηματιστούν δεν διαθέτουν πλασμίδια και είναι ανθεκτικά στο αντιβιοτικό τετρακυκλίνη (tet). Οι ερευνητές είχαν στην διάθεσή τους, τους παρακάτω φορείς κλωνοποίησης.

Ποιον  μπορούν επιλέξουν για να επιτύχουν τον μετασχηματισμό;

Αιτιολογείστε την απάντηση σας.                                                                            (μόρια 1 και 2,5)

 

Επαναληπτικό 1-2-4-7-05

Όπου: Polilynker: Πολλές, διαδοχικές, αλληλεπικαλυπτόμενες, μοναδικές θέσεις αναγνώρισης περιοριστικών ενδονουκλεασών. Τουλάχιστον μια από αυτές είναι κατάλληλη για την ένθεση του επιθυμητού γονιδίου.

Ε. Τα ανασυνδυασμένα βακτήρια καλλιεργήθηκαν στο εργαστήριο και πήραμε τις παρακάτω καμπύλες: Βιομάζα = f(t) και Πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος = f(t).

Επαναληπτικό 1-2-4-7-06

 

Γνωρίζουμε ότι το γονίδιο του λείου πνευμονιόκοκκου που ανασυνδυάστηκε, διαθέτει μια θέση περιορισμού NdeI, εντός του μεταφράσιμου τμήματος του. Μια καλλιέργεια,  όπως η παραπάνω (διάγραμμα 2), παρουσίασε την εξής εικόνα ως προς την παραγωγή της ετερόλογης πρωτεΐνης από τα μετασχηματισμένα αδρά στελέχη.

Μέτα από την απομόνωση των κυττάρων της καλλιέργειας και στη συνέχεια την απομόνωση των γονιδίων από τους πλασμιδιακούς φορείς κλωνοποίησης και στην  περαιτέρω πορεία πέψης του γονιδίου που ευθύνεται για το κάλυμμα των λείων στελεχών του πνευμονιόκοκκου από την NdeI, έδειξε ότι τα μισά γονίδια μπορούσαν να κοπούν και τα άλλα μισά όχι. Εξηγήστε σύντομα το φαινόμενο. Είναι γνωστό ότι  η καλλιέργεια δεν εκτέθηκε σε κανέναν  εξωγενή μεταλλαξιγόνο παράγοντα και  θεωρούμε ότι σε κάθε κύτταρο ξενιστή εισέρχεται μόνο ένα πλασμίδιο φορέας κλωνοποίησης, το οποίο αντιγράφεται μόνο μια φορά εντός του ξενιστή του.                                                    (μόρια 2,5)

Ζήτημα 4ο                                                                                                   Μονάδες 25

  1. Ένα στέλεχος E. coli, μετασχηματίζεται με το γονίδιο που ευθύνεται για το κάλυμμα (κάψα) του λείου στελέχους του πνευμονόκοκκου. Για τον μετασχηματισμό χρησιμοποιήθηκαν τρεις διαφορετικοί φορείς κλωνοποίησης, όπως φαίνονται παρακάτω και δημιουργηθηκαν τρεις διαφορετικες υγρες καλλιεργειες των μετασχηματισμενων κυτταρων που η καθεμιά έχει μετασχηματιστεί με διαφορετικό  φορέα κλωνοποίησης. Οι καλλιέργειες αναπτύσσονται αρχικά σε γλυκόζη και μετά την εξάντληση της, η αύξηση της κάθε καλλιέργειας συνεχίζεται με λακτόζη. Σε ποια χρονική στιγμή αναμένεται να εκφράζεται η ετερόλογη πρωτεΐνη σε καθεμιά από τις τρεις καλλιέργειες;

Επαναληπτικό 1-2-4-7-08

2.

Επαναληπτικό 1-2-4-7-07

2. Δίνονται οι παραπάνω καμπύλες α, β, γ που αφορούν τρεις διαφορετικές υγρές καλλιέργειες. Ποια από αυτές αντιστοιχεί στην αύξηση της καλλιέργειας E. coli, σε υγρό θρεπτικό υλικό με πηγή άνθρακα  λακτόζη, ποια με γλυκόζη και ποια με γαλακτόζη. Γνωρίζεται ότι σε κάθε μια από τις καλλιέργειες η πηγή άνθρακα βρίσκεται σε ίσες συγκεντρώσεις  με τις υπόλοιπες καλλιέργειες που εξετάζονται;

Δίνεται ακόμη ότι το βακτήριο E. coli, μπορεί να προσλάβει και να μεταβολίσει την γαλακτόζη. Η γαλακτόζη εντός του κυττάρου μετατρέπεται μετά από τρία μεταβολικά βήματα σε 6-φωσφόρο-γλυκόζη που αποτελεί το προϊόν και του πρώτου μεταβολικού βήματος της καταβολικής οδού διάσπασης της γλυκόζης στο κύτταρο.

 

 

 

Διαγώνισμα Κεφάλαιο 5 – Μενδελική Κληρονομικότητα

Ζήτημα 1ο                                                                                                μονάδες 25

Α.

  1. Στην περίπτωση του φυτού Anthirrium sp.

Α. Δεν ισχύει ο νόμος του διαχωρισμού των αλληλομόρφων για τον χαρακτήρα χρώμα άνθους.

Β. Τα ετερόζυγα άτομα εμφανίζουν φαινότυπο στον οποίο εκφράζονται ταυτόχρονα και τα δύο αλληλόμορφα του γονίδιου που ελέγχει το χρώμα του άνθους.

Γ. Άτομα με διαφορετικό φαινότυπο ως προς τον χαρακτήρα χρώμα άνθους έχουν και διαφορετικό γονότυπο πάντα.

Δ. Φυσιολογικά άτομα με διαφορετικό φαινότυπο για το χρώμα του άνθους δεν αποκλείεται να έχουν ίδιο γονότυπο.

 

  1. Από την διασταύρωση δυο φυτών του ιδίου είδους και αγνώστου φαινοτύπου προέκυψαν στην πρώτη θυγατρική γενεά:

9[ιώδη] : 4 [μπλε] : 3 [κόκκινα]

Το χρώμα αυτών των φυτών ελέγχεται:

Α. Μονογονιδιακά από δυο αλληλόμορφα

Β. Μονογονιδιακά από τρία αλληλόμορφα

Γ. Απο τρία ανεξάρτητα γονίδια με δυο αλληλόμορφα το καθένα

Δ. Απο δυο ανεξάρτητα γονίδια με δυο αλληλόμορφα το καθένα.

  1. Σε μια αυτοσωμική επικρατή νόσο που ελέγχεται μονογονιδιακά:

Α. Το υπολειπόμενο αλληλόμορφο αποκλείεται να εκφράζεται

Β. Το ετερόζυγο άτομο δεν εμφανίζει τη νόσο

Γ. Το αλληλόμορφο που επικρατεί ως προς την έκφραση , επικρατεί πάντα και φαινοτυπικώς

Δ. Το αλληλομόρφο που δεν εκφράζεται δεν αποκλείεται να επικρατεί και φαινοτυπικώς.

  1. Ένα γονίδιο με πέντε διαφορετικά αλληλόμορφα με σχέση πλήρους επικράτειας υποτέλειας διαδοχικά μεταξύ τους δημιουργεί

Α. 15 διαφορετικούς γονοτύπους

Β. 10 διαφορετικούς ετερόζυγους γονοτύπους

Γ. 20 διαφορετικούς φαινοτύπους

Δ. Τα δυο πρώτα είναι σωστά

  1. Στο γενεαλογικό δένδρο που φαίνεται παρακάτω εξετάζονται οι ασθένειες της αιμορροφιλίας και της β-θαλασσαιμίας.

Δεδομένου ότι όλα τα άτομα της γενεάς Ι είναι ετερόζυγα, να υπολογιστεί η πιθανότητα το άτομο ΙΙΙ1 να είναι υγιές.

Α. ½

Β. 2/3

Γ. ¼

Δ. 1/16

Διαγ 5 blog-05

 

Σημείωση: Το άτομο ΙΙ1 νοσεί από β θαλασσαιμία και το άτομο ΙΙ2 από αιμορροφιλία.                                                                                              (15)

 

Β.   Τις παρακάτω ερωτήσεις χαρακτηρίστε τις ως σωστές ή λανθασμένες:                                                                                                                 (10)

  1. Η αιμοσφαιρίνη είναι πολυγονιδιακός χαρακτήρας.
  2. Στην μελέτη του διυβριδισμού οι χαρακτήρες που μελέτησε ο Mendel δεν εμφάνιζαν επιχιασμό.
  3. Σε ένα αρσενικό άτομο οι νόμοι του Mendel ισχύουν για όλα τα γονίδια που βρίσκονται στον πυρήνα των σωματικών τους κυττάρων.
  4. Τα φυτά προϊόντα της αυτογονιμοποίησης εμφανίζουν ποικιλότητα στις πρώτες γενεές και βαθμιαία σε βάθος γενεών τείνουν σε ομοιομορφία.
  5. Ο τρόπος κληρονόμισης των μονογονιδιακών χαρακτήρων προσδιορίζεται από τον φαινότυπο των ετερόζυγων ατόμων πάντα.

Ζήτημα 2ο                                                                       μονάδες 25

 

  1. Εξηγήστε για ποιο λόγο η πιθανότητα να προκύψει είτε αγόρι είτε κορίτσι είναι ίση με ½. Και κάθε κύηση είναι ανεξάρτητο γεγονός που δεν επηρεάζεται από τα αποτελέσματα των προηγουμένων κυήσεων.; (8)

 

  1. Ένας τράγος διασταυρώθηκε με 64 κατσίκες. 24 από τις κατσίκες αυτές γέννησαν και νεκρούς απογόνους ενώ κάθε κατσίκα απέκτησε συνολικά 3 κατσικάκια. Υπολογίστε πόσες ακόμη κατσίκες από τις 64 που διασταυρωθήκαν με αυτόν τον τράγο είναι ετερόζυγες ως προς το θνησιγόνο αλληλόμορφο, αλλά δεν εντοπιστήκαν καθώς γέννησαν τρία υγιή κατσικάκια η καθεμιά.                                                                                                              (7)

 

  1. Γνωρίζοντας ότι υπάρχουν τέσσερα πολλαπλά αλληλόμορφα για το χρώμα του τριχώματος στα ποντίκια. Με σχέση πλήρους επικράτειας – υποτέλειας μεταξύ τους, πόσες διαφορετικές πιθανές διασταυρώσεις γονοτύπων  μπορούν να γίνουν,  αν το άτομο με τον πλέον επικρατή φαινότυπο  διασταυρώνεται με το άτομο με τον αμέσως  επόμενο κατά σειρά κυριαρχίας φαινότυπο και αποκτούν απογόνους, με φαινοτύπους όμοιους με τους γονείς τους  σε ίσες αναλογίες.                                                                       (10)

 

 

 

Ζήτημα 3ο                                                                        μονάδες 25                                                                                                                                                     

 

  1. Δίνεται το παρακάτω γενεαλογικό δένδρο που αφορά ένα αυτοσωμικό υπολειπόμενο γνώρισμα. Δεχόμενοι ότι όλα τα εισερχόμενα στην γενεαλογία άτομα είναι ετερόζυγα καθώς και τα άτομα της γενεάς Ι, βρείτε την πιθανότητα το άτομο V1 να εμφανίζει το γνώρισμα. (8)

Διαγ 5 blog-02

2. Το φυσιολογικό αλληλόμορφο του γονίδιου για την αιμορροφιλία πέμπεται σε δυο ισομεγέθη τμήματα, υπό την επίδραση της EcoRI

Ένα ζευγάρι έχει αποκτήσει δυο αγόρια και δυο κορίτσια. Το πήκτωμα της αγαρόζης των τεσσάρων παιδιών έδωσε την ακόλουθη εικόνα:

Διαγ 5 blog-03

 

Σημείωση: Όπου jβ, είναι Ζεύγη Βάσεων. Κατά την ηλεκτροφόρηση του DNA σε πήκτωμα αγαρόζης, γνωρίζετε ότι σε δεδομένο χρόνο εφαρμογής του ηλεκτρικού πεδίου στο πήκτωμα, τα μικρότερου μήκους τμήματα DNA διανύουν μεγαλύτερη απόσταση εντός του πηκτώματος.

Να προσδιορίσετε τους γονοτύπους των παιδιών 1,2,3,4 του ζευγαριού καθώς και τους γονοτύπους των γονέων τους.                                         (4)

Αιτιολογήστε την απάντηση σας.                                                                     (5)

3. Στους γορίλες (Gorilla gorilla), υπάρχει το γονίδιο WRS υπεύθυνο για το χρώμα του τριχώματος και το γονίδιο QPR που ελέγχει το μέγεθος του ύβου πίσω από το κεφάλι. Οι γορίλες μπορεί να είναι μαύροι ή ασημόραχοι και μπορεί να έχουν μεγάλο , μεσαίο ή μικρό ύβο.

Σε ένα παμμεικτικο πληθυσμό γοριλων πραγματοποιήθηκαν διασταυρώσεις μεταξύμαύρων αρσενικών με μεσαίο ύβο  με θηλυκα με τα ιδιά αυτά χαρακτηριστικά και έδωσαν :

 

F1:

3200 θηλυκά [μαύρα, μεγάλο ύβο]

3100 θηλυκά [μαύρα, μεσαίο ύβο]

1200 θηλυκά [ ασημόραχα, μεγάλο ύβο]

1000 θηλυκά [ασημόραχα, μεσαίο ύβο]

3300 αρσενικά [μαύρα, μεσαίο ύβο]

3100 αρσενικά [μαύρα, μικρό ύβο]

900 αρσενικά [ασημόραχα, μεσαίο ύβο]

1000 αρσενικά [ασημόραχα, μικρό ύβο]

 

Να ερμηνευθούν τα αποτελέσματα όταν γνωρίζετε πως μεταξύ των χαρακτηριστικών δεν παρατηρούνται φαινοτυπικες διακυμάνσεις.                                                   (8)

 

 

 

 

Ζήτημα 4ο                                                                 μονάδες 25

 

  1. Στο παρακάτω γενεαλογικό δένδρο μελετάται μια ασθένεια αυτοσωμική υπολειπόμενη. Όλα εισερχόμενα στη γενεαλογία άτομα είναι υγιή και ομόζυγα.

Διαγ 5 blog-04

 

Α. Να βρεθούν όλοι οι γονότυποι των ατόμων της γενεαλογίας.             (3)

Β. Αν τα άτομα Α και Β αποκτήσουν παιδί με ποια πιθανότητα θα νοσεί;                                                                                                                     (3)

Γ. Αν το πρώτο παιδί είναι φυσιολογικό με ποια πιθανότητα το δεύτερο θα είναι αγόρι με την ασθένεια;                                                                (3)

Δ. Αν το πρώτο παιδί νοσεί με ποια πιθανότητα το δεύτερο θα είναι υγιές;                                                                                                                   (3)

  1. Δίνεται το παρακάτω γενεαλογικό δένδρο που αφορά έναν χαρακτήρα του ανθρώπου. Τα άτομα με μαύρο χρώμα εμφανίζουν μια ασθένεια των οφθαλμών.

Να βρεθούν οι γονότυποι των ατόμων του δένδρου.                                            (13)

Διαγ 5 blog-01

 

Διαγώνισμα κεφάλαιο 2 : Αντιγραφή, έκφραση , ρύθμιση της γενετικής πληροφορίας

Ζήτημα 1                                                                                                                   Μονάδες 25

Στις παρακάτω ερωτήσεις επιλέξτε την σωστή απάντηση.

  1. Το ένζυμο DNA δεσμάση

α. απαιτεί για να δράσει κλώνο DNA ως εκμαγείο

β. συνδέει το πρώτο νουκλεοτίδιο του πρωταρχικού τμήματος που αντικαταστάθηκε με δεοξυνουκλεοτίδιο με το πρώτο νουκλεοτίδιο του ασυνεχούς τμήματος που επιμήκυνε αυτό το πρωταρχικό τμήμα.

γ. συνδέει το τελευταίο νουκλεοτίδιο του πρωταρχικού τμήματος που αντικαταστάθηκε με δεοξυνουκλεοτίδιο με το πρώτο νουκλεοτίδιο του ασυνεχούς τμήματος που επιμήκυνε αυτό το πρωταρχικό τμήμα.

δ. έχει επιδιορθωτικό ρόλο.

ε. συνδέει το πρώτο και το τελευταίο νουκλεοτίδιο του πρωταρχικού τμήματος που αντικαταστάθηκε με δεοξυνουκλεοτίδιο με το τελευταίο νουκλεοτίδιο του επόμενου ασυνεχούς τμήματος DNA   και το πρώτο νουκλεοτίδιο του ασυνεχούς τμήματος που επιμήκυνε αυτό το πρωταρχικό τμήμα.

  1. Τα επιδιορθωτικά ένζυμα

α. δρουν μόνο κατά την διάρκεια της αντιγραφής του DNA των ευκαρυωτικών κυττάρων

β. δρουν μόνο κατά την διάρκεια της αντιγραφής του DNA τόσο των ευκαρυωτικών όσο και των προκαρυωτικών οργανισμών

γ. δρουν καθ’ολη την διάρκεια του κυτταρικού κύκλου. Οι προκαρυωτικοί οργανισμοί δεν διαθέτουν επιδιορθωτικά ένζυμα.

δ. Μπορούν να διακρίνουν τον μητρικό από τον νεοσυντιθέμενο κλώνο του DNA και να επιδιορθώνουν τον νεοσυντιθέμενο κατά την διάρκεια της αντιγραφής.

  1. Η καθολικότητα του γενετικού κώδικα

α. καθορίζεται από την καθολικότητα των μορίων tRNA των κυττάρων.

β. δεν ισχύει για τα μιτοχόνδρια των ζωικών οργανισμών καθώς και σε πολλά πρωτόζωα που αποτελούν τους προπάτορες των πολυκύτταρων ευκαρυωτικών οργανισμών

γ. υποδηλώνει την κοινή καταγωγή των οργανισμών σύμφωνα με την θεωρία της εξέλιξης των ειδών

δ. όλα τα παραπάνω είναι σωστά.

  1. Τα χαρακτηριστικά του γενετικού κώδικα ως τριπλέτας, συνεχής και μη επικαλυπτόμενος

α. προσδιορίζονται από το ριβόσωμα

β. προσδιορίζουν το πλαίσιο ανάγνωσης του μεταφράσιμου τμήματος του mRNA μαζί με το κωδικόνιο έναρξης.

γ. τα δύο παραπάνω είναι σωστά

δ. το β είναι λάνθασμενο  αλλά και το α είναι λανθασμένο

  1. Στο δοθέν σχήμα το το γονίδιο είναι το τμήμα του χρωμοσώματος

————————–Υ———————————-

————————–Υ———————————-

(ο Υποκινητής είναι στο δίκλωνο μόριο του DNA και καταλαμβάνει την θέση που προσδιορίζεται στο σχήμα)

α. αριστερά του Υποκινητή

β. δεξιά του Υποκινητή

γ. υπάρχουν δυο γονίδια εκατέρωθεν του Υποκινητή και ελέγχονται και τα δυο από τον ίδιο Υποκινητή

δ. δεν διαθέτουμε αρκετά δεδομένα για να επιλέξουμε

ε. όλα τα παραπάνω είναι σωστά.

Ζήτημα 2                                                                                                                   Μονάδες 25

  1. Έχετε στη διάθεση σας 1000 πρόδρομες πολυπεπτιδικες αλυσίδες που η καθεμιά αποτελείται από 100 αμινοξέα. Γνωρίζοντας ότι ο ρυθμός που συμβαίνουν τα λάθη κατά την διάρκεια της μετάφρασης είναι 1 στα 10.000 αμινοξέα. Πόσες πολυπεπτιδικες αλυσίδες θα περιμένατε να έχουν λάθος πρωτοταγή δομή; (5)
  1. Σε ένα τεχνητό μόριο mRNA  ολόκληρη η μεταφράσιμη περιοχή του μετά το κωδικόνιο έναρξης, αποτελείται από την επαναλαμβανόμενη αλληλουχία 5′ UUAC3′. Το μόριο αυτό μεταφράζεται από βακτηριακό και μυκητιακό κυτταρικό εκχύλισμα. Ποια θα είναι η αλληλουχία των αμινοξέων του πεπτιδίου που παράγεται σε κάθε διαφορετικό κυτταρικό εκχύλισμα; (6)

Αιτιολογήστε την απάντηση σας.

  1. Τι είναι η μεταγραφή, ποιος είναι συνοπτικά ο ρόλος της; Ποια είναι τα προϊόντα της μεταγραφής; (8)
  2. Αναφέρετε τρεις λόγους για τους οποίους ο εκφυλισμός του γενετικού κώδικα εξυπηρετεί την επιβίωση και την εξέλιξη της ζωής στη Γη. (6)

Ζήτημα 3                                                                                                                   Μονάδες 25

Οι Monod & Jacob στα κλασσικά τους πειράματα για το οπερόνιο της λακτόζης παρατήρησαν ότι όταν ένα φυσιολογικό στέλεχος του βακτηρίου E.coli αναπτύσσεται σε περιβάλλον με μοναδικές πήγες άνθρακα γλυκόζη και λακτόζη σε ίσες αναλογίες στην αρχή, τότε το διάγραμμα που περιγράφει την μεταβολή του πληθυσμού των κυττάρων σε συναρτήσει με τον χρόνο είναι η παρακάτω. Η καμπύλη αυτή ονομάζεται καμπύλη διαύξησης.

Διαγώνισμα κεφάλαιο 2 blog-01

 

α. Σύμφωνα με όσα γνωρίζεται από το σχολικό βιβλίο ερμηνεύστε την καμπύλη διαυξησης σε μοριακό επίπεδο έκφρασης του οπερονίου της λακτόζης. (10)

β. Στο παραπάνω φυσιολογικό στέλεχος του βακτηρίου πραγματοποιείται in vitro μετασχηματισμός με την εισαγωγή ενός μεταλλαγμένου τμήματος του χρωμοσωμικού γενετικού υλικού του βακτηρίου, που περιεχέι το ρυθμιστικό γονίδιο του οπερονίου της λακτόζης καθώς και τα δομικά γονίδια μαζί με τον υποκινητή και τον χειριστή του. Το μεταλλαγμένο αυτό τμήμα, φέρει τέτοια αλλαγή στην αλληλουχία του ρυθμιστικού γονιδίου, ώστε δεν παράγεται η πρωτεΐνη καταστολέας. Στο μετασχηματισμένο στέλεχος θα εκφράζονται την χρονική περίοδο 0 έως t1 τα δομικά γονίδια του οπερονίου της λακτόζης; (7)

γ. Ένα διαφορετικό στέλεχος E. coli από το φυσιολογικό μετασχηματίζεται όπως παραπάνω. Από το μετασχηματισμένο αυτό στέλεχος απομονώνεται το ένζυμο β-γαλακτοσιδάση καθ’ολη την διάρκεια της καλλιέργειας. Μπορείτε να εξηγήσετε σε ποιο σημείο φέρει τη μετάλλαξη το στέλεχος αυτό σε σχέση με το φυσιολογικό; (8)

Ζήτημα 4                                                                                                                   Μονάδες 25

1.Οι ερευνητές Menselson & Stahl με τα κλασσικά τους πειράματα απέδειξαν τον ημισυντηριτικό μηχανισμό της αντιγραφής έναντι του συντηρητικού και του διασπαρτικού μηχανισμού . Σύμφωνα με την υπόθεση του συντηρητικού μηχανισμού της αντιγραφής στο τέλος κάθε αντιγραφής ενός μορίου DNA του γενετικού υλικού ενός κυττάρου προκύπτουν δύο μόρια πανομοιότυπα μεταξύ τους και με το αρχικό. Το ένα από τα δυο μόρια είναι το αρχικό μητρικό μόριο και το άλλο μόριο είναι εξ ολοκλήρου νεοσυντηθέμενο.

Σύμφωνα με την υπόθεση του διασπαρτικού μηχανισμού της αντιγραφής κάθε νέο μόριο DNA που προκύπτει από την αντιγραφή ενός μητρικού μορίου είναι πανομοιότυπο με το μητρικό και αποτελείται σε κάθε κλώνο του από τμήματα του μητρικού μορίου και από νεοσυντήθεμενα τμήματα σε ίσες αναλογίες.

Στα πειράματα τους οι ερευνητές αρχικά ανέπτυξαν μια καλλιέργεια E.coli σε κατάλληλο θρεπτικό υλικό που περιείχε αποκλειστικά το άζωτο με την μορφή του ισοτόπου Ν (15) (βαρύ άζωτο). Στη συνεχεία μετέφεραν κύτταρα από αυτή την καλλιέργεια σε νέο κατάλληλο θρεπτικό υλικό με μορφή αζώτου (14). Στο περιβάλλον αυτό τα κύτταρα πραγματοποίησαν δυο διπλασιασμούς.

Διαγώνισμα κεφάλαιο 2 blog-02Διαγώνισμα κεφάλαιο 2 blog-03

Μετά από κάθε διπλασιασμό, απομόνωναν το DNA 1000 βακτηριακών κυττάρων και μετά από φυγοκέντριση, όπου επιτυγχάνεται διαχωρισμός συστατικών ενός διαλύματος σύμφωνα με το βάρος (τα βαρύτερα συστατικά διανύουν μεγαλύτερη απόσταση από τον άξονα περιστροφής της φυγόκεντρου), ο δοκιμαστικός σωλήνας που φυγοκεντρήθηκε δέχθηκε μονοχρωματική ακτινοβολία (ορισμένου μήκους κύματος) σε όλο του το μήκος και μετρήθηκε η απορρόφηση αυτής της ακτινοβολίας στα διάφορα σημεία του σωλήνα. Εκεί όπου η πυκνότητα του διαλύματος είναι μεγάλη και η απορρόφηση είναι μεγάλη.

Τα αποτελέσματα που πήραν φαίνονται παρακάτω:

Διαγώνισμα κεφάλαιο 2 blog-04

 

α. Το πείραμα αυτό χαρακτηρίζεται ως in vivo ή in vitro; (1)

β. Πώς οι επιστήμονες χάρη σε αυτά τα αποτελέσματα απέδειξαν τον ημισυντηριτικό μηχανισμό της αντιγραφής αποκλείοντας τους άλλους; (6)

γ. Εάν ο μηχανισμός ήταν διασπαρτικός, το διάγραμμα που θα έπαιρναν οι επιστήμονες μετά τον δεύτερο κυτταρικό διπλασιασμό, από πόσες κορυφές θα αποτελούνταν και σε ποιο/α ύψη του δοκιμαστικού σωλήνα θα εντοπίζονταν σε σύγκριση με αυτά που τελικά παρατηρήθηκαν; (3)

2. Δίνεται το παρακάτω τμήμα γονιδίου το οποίο δεν διαθέτει εσώνια :

Υ 5′ ATG CCA GGT CCC AAA TGA3′

Y 3′ TAC GGT CCA GGG TTT ACT5′

Κατά την διάρκεια της φάσης G1 του κυτταρικού κύκλου συμβαίνει αυθόρμητη απαμίνωση της κυτοσίνης, που βρίσκεται στο δεύτερο κωδικόνιο ως πρώτο νουκλεοτίδιο, με συνέπεια την μετατροπή της σε ουρακίλη. Το γονίδιο μεταγράφεται αμέσως πριν από την επιδιόρθωση του.

Σε ένα άλλο κύτταρο στο ίδιο γονίδιο συμβαίνει το ίδιο φαινόμενο στην πρώτη κυτοσίνη της μη κωδικής αλυσίδας  και το γονίδιο και πάλι μεταγράφεται αμέσως μετά την μετάλλαξη πριν την επιδιόρθωση.

Ποιο/α κύτταρο/α αναμένεται να δημιουργήσει μεταλλαγμένο mRNA (3); Το μεταλλαγμένο mRNA μεταφράζεται και κωδικοποιεί την ίδια πρωτεΐνη (6); Αιτιολογήστε την απάντησή σας. (6)

Καλή Επιτυχία

Διαγώνισμα Κεφ 1-2-4-5-7

Ζήτημα 1ο
(Μονάδες 25)
1. Η διπλή έλικα DNA:
Α. έχει μεταβαλλόμενο σκελετό
Β. έχει υδρόφιλες βάσεις που διατάσσονται προς το εσωτερικό του μορίου
Γ. έχει δεοξυριβόζες που βρίσκονται πάντα προσκείμενες στο νερό
Δ. έχει συμπληρωματικές παράλληλες αλυσίδες δεοξυριβονουκλεοτιδίων

2. Στο οπερόνιο της λακτόζης, όταν υπάρχει επαγωγέας μέσα στο κύτταρο E-coli, η πρωτεΐνη καταστολέας:
Α. συνδέεται με τον υποκινητή του ρυθμιστικού γονιδίου
Β. απομακρύνεται από τον υποκινητή οπερονίου
Γ. αλλάζει τρισδιάστατη δομή και απομακρύνεται από τον χειριστή
Δ. αλλάζει στερεοδιάταξη και συνδέεται με το χειριστή

3. Δεν μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη, για
Α. τα γονίδια του ιού HIV (ρετροϊός)
Β. τα γονίδια του λ-φάγου
Γ. το Pisum sativum
Δ. Τη ζύμη αρτοποιίας

4. Εάν η παρουσία των αλληλομόρφων του γονιδιού που ελέγχει την νόσο είναι ισοπιθανη σε έναν πληθυσμό, τότε ένα ζευγάρι που και οι δύο νοσούν από οικογενή υπερχοληστεριναιμία έχουν:
Α. ¾ πιθανότητα να αποκτήσουν παιδί που νοσεί από την ασθένεια
Β. 15/64 πιθανότητα να αποκτήσουν παιδί που νοσεί από την ασθένεια
Γ. 15/16 πιθανότητα να αποκτήσουν παιδί που νοσεί από την ασθένεια
Δ. ¼ πιθανότητα να αποκτήσουν παιδί που νοσεί από την ασθένεια

5. Τα μικροβιακά κύτταρα:
Α. αποκλείεται ορισμένα από τα είδη τους να χρειάζονται διοξείδιο του ανθρακα
Β. Όλα απαιτούν τα ίδια μεταλλικά ιόντα αλλά σε διαφορετικές συγκεντρώσεις τα διάφορα είδη μεταξύ τους
Γ. Για να διαιρεθούν πρέπει να διαθέτουν το κατάλληλο μέγεθος
Δ. Είναι ακατάλληλα για ξενιστές ανασυνδιασμένου DNA αν δεν είναι βακτήρια

6. Για να δημιουργήσουμε cDNA Βιβλιοθήκη πρέπει:
Α. Να χρησιμοποιήσουμε και S1 νουκλεάση, τρανσφεράση και DNA δεσμάση
Β. Να χρησιμοποιήσουμε μόνο περιοριστική ενδονουκλεάση και DNA δεσμάση
Γ. Να χρησιμοποιήσουμε απαραιτήτως πλασμίδιο ως φορέα κλωνοποίησης
Δ. Να χρησιμοποιήσουμε το γονιδιωματικό DNA του οργανισμού δότη

Ζήτημα 2ο
(Μονάδες 25)

1. Τι είναι η κλωνοποίηση; Δώστε τους ορισμούς της γονιδιωματικής και της cDNA βιβλιοθήκης.

2. Να αναφέρετε ποια θρεπτικά συστατικά είναι απαραίτητα για να αναπτυχθεί ένας μικροοργανισμός σε μια καλλιέργεια.

3. Μια πρωτεΐνη ενός ευκαρυωτικού κυττάρου αποτελείται από μια πολυπεπτιδική αλυσίδα 100 αμινοξέων. Το γονίδιο αυτό από το οποίο κωδικοποιήθηκε αυτή η πρωτεΐνη αποτελείται από πολύ περισσότερα νουκλεοτίδια από αυτά που κωδικοποιούν τα 100 αμινοξέα. Να αναφέρετε τους λόγους αυτής της διαφοράς.

4. Να ταξινομήσετε τις παρακάτω μορφολογικές δομές του γενετικού υλικού ενός ευκαρυωτικού κυττάρου αρχίζοντας από το μικρότερο προς το μεγαλύτερο βαθμό συσπείρωσης.
ινίδια χρωματίνης. μεταφασικά χρωμοσώματα. «χάντρες» νουκλεοσωμάτων.
διπλή έλικα DNA. αδελφές χρωματίδες.

5. Τι είναι:
Α. Αλληλόμορφα γονίδια
Β. Πολλαπλά αλληλόμορφα
Γ. Θνησιγόνα γονίδια
Δ. Ζύμωση
Ε. Τι ορίζετε ως γονιδιακή έκφραση; Που αποσκοπεί η γονιδιακή ρύθμιση στους προκαρυωτικούς οργανισμούς;

Ζήτημα 3ο

Α. Δίνονται τα παρακάτω τμήματα DNA που περιέχουν τα κωδικόνια που κωδικοποιούν τα επτά πρώτα αμινοξέα της φυσιολογικής και της μεταλλαγμένης β-πολυπεπτιδικής αλυσίδας της HbA.
Φυσιολογική
5’… GTG CAC CTG ACT CCT GAG GAG … 3’
3’ … CAC GTG GAC TGA GGA CTC CTC … 5’
Μεταλλαγμένη
5’ … GTG CAC CTG ACT CCT GTG GAG … 3’
3’ … CAC GTG GAC TGA GGA CAC CTC … 5’
Η περιοριστική ενδονουκλεάση DdeI αναγνωρίζει την αλληλουχία:
5’ CTGAG 3’
3’ GACTC 5’
και κόβει κάθε αλυσίδα μεταξύ του C και του T (με κατεύθυνση 5’ -> 3’). Η αλληλουχία που αναγνωρίζει η DdeI βρίσκεται στο παραπάνω τμήμα DNA της φυσιολογικής αλυσίδας. Από ένα άτομο φορέα της β-θαλασσαιμίας (φορέα του μεταλλαγμένου αλληλόμορφου γονιδίου β και του φυσιολογικού γονιδίου β), απομονώθηκαν τμήματα του DNA, που περιέχουν τα κωδικόνια τα οποία κωδικοποιούν τα επτά πρώτα αμινοξέα της β-πολυπεπτιδικής αλυσίδας. Στα τμήματα αυτά επιδράσαμε με την περιοριστική ενδονουκλεάση DdeI. Πόσα τμήματα DNA διαφορετικού μήκους θα προκύψουν μετά τη δράση της DdeI; Να αιτιολογήσετε την απάντησή σας.
(Μόρια 1+6)

Β. Στους παρακάτω δοκιμαστικούς σωλήνες (1, 2, 3) φαίνεται η διαβάθμιση της συγκέντρωσης οξυγόνου και η περιοχή ανάπτυξης τριών ειδών μικροοργανισμών σε υγρό θρεπτικό υλικό. Οι μικροοργανισμοί απεικονίζονται ως μαύρες κουκίδες. Σε ποιόν από τους τρεις δοκιμαστικούς σωλήνες έχουμε καλλιέργεια μυκήτων αρτοποιίας, βακτηρίων του γένους clostridium και βακτηρίων του γένους Mycobacterium; Να αιτιολογήσετε την απάντησή σας.
(Μόρια 3+6)
test1

Γ. Δίνεται το παρακάτω τμήμα βακτηριδιακού DNA που κωδικοποιεί για ένα ολιγοπεπτίδιο
Αλυσίδα 1: GTTGAATTCTTAGCTTAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG

Γ1. Να προσδιορίσετε τα 5’ και 3’ άκρα των αλυσίδων. Να αιτιολογήσετε την απάντησή σας.
(Μόρια 1+3)

Γ2. Το παραπάνω γονίδιο θέλουμε να το κλωνοποιήσουμε in vitro. Ποιο από τα παρακάτω πρωταρχικά τμήματα είναι τα κατάλληλα για αυτή την κλωνοποίηση; Να αιτιολογήσετε την απάντησή σας.
i) 5’ TTAAGCTA 3’
ii) 5’ GAGAATTC 3’
iii) 5’ GTTGAATT 3’
iv) 3’ CAACTTAA5’
v) 3’ GTTGAATT 5’
vi) 3’ CTCTTAAG 5’
(Μόρια 2+3)

Ζήτημα 4ο

Μια γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που έγινε σε εμβρυακά κύτταρα διαπιστώθηκε ότι το έμβρυο διαθέτει φυσιολογικό αριθμό χρωμοσωμάτων, αλλά διαθέτει μόνο ένα φυλετικό χρωμόσωμα, αυτό του Χ φυλετικού χρωμοσώματος και τρία χρωμοσώματα για το 18ο χρωμόσωμα.

Α1. Να περιγράψετε τη διαδικασία κατασκευής του καρυότυπου.
(Μόρια 5)

Α2.
i) Πόσα μόρια DNA υπάρχουν στα χρωμοσώματα που παρατηρούνται;
ii) Πόσα κεντρομερίδια υπάρχουν στα χρωμοσώματα του εμβρύου;
iii) Πόσες αδελφές χρωματίδες παρατηρούνται;
iv) Πόσοι βραχίονες παρατηρούνται;
v) Πόσα ινίδια χρωματίνης παρατηρούνται;
vi) Πόσες ελεύθερες φωσφορικές ομάδες υπάρχουν στα χρωμοσώματα που παρατηρούνται;
vii) Πόσα αντίγραφα ενός γονιδίου που εδράζεται σε γενετικό τόπο του χρωμοσώματος 18 υπάρχουν;
viii) Ποιο είναι το φύλο του εμβρύου και γιατί;
ix) Πόσα αντίγραφα ενός γονιδίου που εδράζεται στα φυλετικά X χρωμοσώματα υπάρχουν στο έμβρυο;
x) Πόσα ζεύγη ομολόγων χρωμοσωμάτων παρατηρούνται;
(Μόρια 5)

Α3. Δίνεται το παρακάτω τμήμα DNA το οποίο αντιγράφεται. Τα σημεία Α και Γ υποδεικνύουν τη θέση έναρξης της αντιγραφής.
test2
Να σχεδιάσετε στο τετράδιό σας το παραπάνω σχήμα και να σημειώσετε πάνω σε αυτό τους προσανατολισμούς των μητρικών αλυσίδων (1). Τα ασυνεχή και τα συνεχή τμήματα των δύο νέων αλυσίδων με βέλη και να σημειώσετε πάνω σ’ αυτά τους προσανατολισμούς τους (2).
Η μητρική αλυσίδα του DNA που αντιγράφεται με συνεχή τρόπο, αμέσως μετά μεταγράφεται. Να γράψετε το τμήμα του RNA που σχηματίζεται κατά τη μεταγραφή και να σημειώσετε τον προσανατολισμό του (2).
(Μόρια 1+2+2)

Β. Το παρακάτω γενεαλογικό δένδρο απεικονίζει τον τρόπο με τον οποίο κληρονομείται μια ασθένεια του μεταβολισμού στον άνθρωπο
test3

Β1. Η ασθένεια αυτή οφείλεται σε επικρατές ή σε υπολειπόμενο γονίδιο; Να αιτιολογήσετε την απάντησή σας. Κληρονομείται ως αυτοσωμικός ή φυλοσύνδετος χαρακτήρας; Να αιτιολογήσετε την απάντησή σας. (4)

Β2. Να προσδιορίσετε τους γονότυπους όλων των μελών της οικογένειας που απεικονίζονται στο παραπάνω γενεαλογικό δένδρο. (3)

Β3. Ο άνδρας ΙΙΙ1 αποκτά με ετερόζυγη γυναίκα για την ασθένεια αυτή ένα αγόρι. Με ποια πιθανότητα αυτό το αγόρι νοσεί από την νόσο αυτή, αιτιολογώντας την απάντησή σας. (3)
(Μόρια 4+3+3)

διαγώνισμα Βιολογίας Ομάδας Θετικού Προσανατολισμού κεφαλαίου 1: Το Γενετικό Υλικό.

Ζήτημα 1.

Α. Σημειώστε τη σωστή απάντηση σε κάθε μια από τις παρακάτω ερωτήσεις:                                                                                                    15 μόρια

1. Κατά πόσο συσπειρώνεται το DNA του ανθρώπου που ως ενιαίο μόριο έχει            μήκος περίπου 2m  για χωρέσει στον πυρήνα του κυττάρου:

α) κατά το ελάχιστο 105 φορές

β) τουλάχιστον κατά 2×105 φορές

γ) κατά το μέγιστο 4×102 φορές

δ) κατά 3×103 φορές ακριβως

2. Το κεντρομερίδιο υπάρχει:

α) στο κέντρο του κυττάρου

β) στην κυτταρική μεμβράνη

γ) στο γενετικό υλικό των μιτοχονδρίων

δ) σε κάθε αδελφή χρωματίδα

3. Τα μιτοχόνδρια στα κύτταρα κάποιων κατώτερων πρωτοζώων:

α) είναι γραμμικά

β) είναι μόνο μητρικής προέλευσης

γ) έχουν γραμμικό DNA

δ) δημιουργούνται de novo

4. Οι ιστόνες είναι απαραίτητες για το σχηματισμό:

α) του κυτταροσκελετού

β) του πυρήνα

γ) των νουκλεοσωμάτων

δ) του συμπλόκου έναρξης της μετάφρασης

5. Μια από τις βασικές φυσιολογικές διαδικασίες, που διαφοροποιεί τη μίτωση από τη μείωση, είναι:

α) Ο αποχωρισμός των αδελφών χρωματίδων.

β) Η σύναψη ομόλογων χρωμοσωμάτων.

γ) Ο διπλασιασμός του DNA.

δ) Η ύπαρξη νουκλεοσωμάτων.

Β. Απαντήστε αν η καθεμιά από τις παρακάτω προτάσεις είναι σωστή ή λανθασμένη γράφοντας μια σύντομη αιτιολόγηση:                                                                      10 μόρια

α. Οι ιοί μπορούν να φέρουν ως γενετικό υλικό DNA, RNA, DNA-RNA μονόκλωνο ή δίκλωνο γραμμικό ή κυκλικό.

β. Τα μισά γονίδια του μιτοχονδριακού DNA ενός οργανισμού προέρχονται από τη μητέρα και τα άλλα μισά από τον πατέρα.
γ. Η απεικόνιση των χρωμοσωμάτων κατά τη μεσόφαση όπου τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος ονομάζεται καρυότυπος.

δ. Η έλικα του DNA έχει πλάτος 2 nm ενώ ενός νουκλεοσώματος είναι 11nm.

ε. Το ραδιοσημασμένο θειο δεν ενσωματώνεται στο DNA και συνέπεια θα ήταν αδύνατον εντοπιστεί στα χρωμοσώματα.

 

Ζήτημα 2.

Απαντήστε στις παρακάτω ερωτήσεις:                                                                 25 μόρια

 

 1. Το 1944 τα πειράματα του Griffith επαναλήφθηκαν in vitro.

Σε ποια συμπεράσματα οδήγησαν αυτά τα πειράματα; Ποια άλλα επιστημονικά δεδομένα της ίδιας εποχής ενισχύουν τα παραπάνω αποτελέσματα; (μόρια 8)

2. Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι κυκλικό δίκλωνο DNA. Από ποια μόρια αποτελείται το γενετικό υλικό των προκαρυωτικών οργανισμών; Τι γνωρίζετε γι’ αυτά; (μόρια 8)

3. Τι ονομάζουμε αποικία, δώστε από ένα παράδειγμα in vitro και in vivo διαδικασίας. Για την περιγραφή του μήκους ή της αλληλουχίας ενός νουκλεϊκού οξέος ποιος όρος χρησιμοποιείται και τι σημαίνει; ( μόρια 5)

4. Στο κριθάρι τα σωματικά κύτταρα έχουν χρωμοσώματα 2n=14. Ποιος είναι ο αριθμός των χρωμοσωμάτων: α. στα κύτταρα των ριζών, β. στα έμβρυα, γ. στους γυρεόκκκοκους και δ. στα φύλλα. (μόρια 4)

Ζήτημα 3.

Απαντήστε στις παρακάτω ερωτήσεις:

 

  1. Είναι δυνατόν ένας οργανισμός να έχει γενετικό υλικό με περιττό αριθμό νουκλεοτιδίων; Αιτιολογήστε την απάντηση σας.                                                                              7 μόρια
  2. Είναι δυνατόν ένας οργανισμός φυσιολογικά, να έχει γενετικό υλικό με περιττό αριθμό χρωμοσωμάτων; Αιτιολογήστε την απάντηση σας.                                                 6 μόρια
  3.  Δίνεται ένα υβριδικό δίκλωνο μόριο DNA-RNA που αποτελείται από 40 νουκλεοτίδια. α. Γνωρίζεται ότι η Τ (θυμίνη) αποτελεί το 15% των αζωτούχων βάσεων του υβριδικού αυτού μορίου. Να υπολογίσετε το ποσοστό και το πλήθος των υπολοίπων βάσεων  του μορίου, εάν είναι γνωστό ότι περιέχει 30% C (κυτοσίνη). β. Είναι γνωστό ότι  η Τ (θυμίνη) αποτελεί το 15% των βάσεων του κλώνου του DNA του υβριδικού αυτού μορίου.  Να υπολογιστεί το ποσοστό και το πλήθος των υπολοίπων βάσεων του μορίου, εάν είναι γνωστό ότι περιέχει 30% C (κυτοσίνη). γ. Να συγκριθούν τα δυο παραπάνω αποτελέσματα.                                                                                    12 μόρια     

Ζήτημα 4.

Να επιλυθούν οι παρακάτω ασκήσεις:

1. Εάν το βάρος 1.000 ζευγών βάσεων στο DNA είναι 10-18g και κάθε ζεύγος βάσεων απέχει από το επόμενο 3,4 x 10-10  m. Να βρείτε το βάρος του γενετικού υλικού του φυτού Λίλιουμ, που έχει μήκος 100m, θεωρώντας το ενιαίο μορίου δίκλωνου DNA. Πόσα μόρια φωσφόρου περιέχονται σε αυτό το μόριο; Θεωρούμε ότι το νουκλεοτίδιο έχει μηδενικό μηκος.                                                                                                                                                                                                             10 μόρια

2. Σε δύο διαφορετικά δείγματα DNA ιδίου μήκους που το καθένα απομονώθηκε από ένα άγνωστο είδος βακτηρίων, βρέθηκε ότι στο δείγμα Α η Θυμίνη ζευγαρώνει σε ποσοστό 32%, ενώ στο δείγμα Β το αντίστοιχο ποσοστό είναι 17% του συνολικού αριθμού των νουκλεοτιδίων του DNA του κάθε είδους βακτηρίων. Γνωρίζουμε ότι το ένα είδος απομονώθηκε από θερμοπηγές (64ο C). Μπορούμε να αποφανθούμε ποιο από τα δύο είδη προκαρυωτικών κυττάρων είναι το θερμόφιλο;                                                                                                                                                                              15 μόρια

Διαγώνισμα Βιολογίας θετικού προσανατολισμού στα κεφάλαια 1-2

Διαγώνισμα θετικής κατεύθυνσης 

Θέμα 1ο

25 Μονάδες

Επιλέξτε τη σωστή απάντηση.

1. Ποιο από τα παρακάτω ισχύει για το DNA των οργανισμών;

α. Δίκλωνο, παράλληλο, Α+G/C+T=1

β. Δίκλωνο, αντιπαράλληλο, Α+G/C+T=1

γ. Μονόκλωνο, παράλληλο, Α+G/C+T=1

δ. Δίκλωνο, παράλληλο, Α+G/C+U=1

ε. Δίκλωνο, αντιπαράλληλο, Α+G/C+T=διάφορες τιμές

2. Από εκχύλισμα πρωτόζωων απομονώνονται μιτοχόνδρια τα οποία μολύνονται από κατάλληλους DNA ιούς (πλήθος ιών = n) μετά από κατάλληλο χρονικό διάστημα παρατηρούνται 300n ιοί. Αυτό σημαίνει ότι:

α. το γενετικό υλικό των μιτοχόνδριων είναι κυκλικό.

β. το γενετικό υλικό των μιτοχόνδριων είναι γραμμικό.

γ. τα μιτοχόνδρια διαθέτουν DNA πολυμεράση, RNA πολυμεράση, ριβοσώματα.

δ. όλα τα παραπάνω.

ε. τίποτα από τα παραπάνω.

 

3. Ο τερματισμός της μεταγραφής στα κύτταρα επιτυγχάνεται:

α. από ειδικό δίκλωνο τμήμα στο γονίδιο, που έπεται του 5′ άκρου της μη κωδικής αλυσίδας του γονιδίου .

β. από ειδικές πρωτεΐνες (μεταγραφικούς παράγοντες) που απομακρύνουν την RNA πολυμεράση.

γ. από τις αλληλουχίες λήξης της μετά-μεταγραφής.

δ. από την πρωτεΐνη που καλείται παράγοντας απελευθέρωσης.

ε. από το κωδικόνιο λήξης.

 

4. Στο οπερόνιο βιοσύνθεσης π.χ. του αμινοξέως τρυπτοφάνη, που υπάρχει στο γονιδίωμα του βακτηρίου E.coli, θα περιμένετε η πρωτεΐνη καταστολέας:

α. να είναι συνδεδεμένη στο χειριστή απουσία τρυπτοφάνης.

β. να αλλάζει στερεοδιάταξη και να απομακρύνεται από τον χειριστή παρουσία τρυπτοφάνης.

γ. να αλλάζει στερεοδιάταξη και να απομακρύνεται από τον χειριστή απουσία τρυπτοφάνης.

δ. να είναι μόνιμα συνδεδεμένη με τον χειριστή.

ε. τίποτα από τα παραπάνω.

 

5. Ένα πλασμίδιο μπορεί να ξεκινήσει την αντιγραφή του πριν ολοκληρώθεί η πρώτη αντιγραφή του. Σε αυτή την περίπτωση:

α. υπάρχουν στο πλασμίδιο δύο (2) αντιγραφικές διχάλες.

β. υπάρχουν στο πλασμίδιο τέσσερις (4) νεοσυντιθέμενοι κλώνοι DNA που κινούνται αμφίδρομα.

γ. υπάρχουν στο πλασμίδιο δώδεκα (12) νεοσυντιθέμενοι κλώνοι DNA που κινούνται αμφίδρομα.

δ. υπάρχουν στο πλασμίδιο οκτώ (8) DNA πολυμεράσες που δρουν για να ολοκληρωθεί η αντιγραφή.

ε. υπάρχουν στο πλασμίδιο οκτώ (8) νεοσυντιθέμενοι κλώνοι DNA που δημιουργούνται μονόδρομα.

Θέμα 2ο                                                                                                                                    Μονάδες 25

1. Να περιγράψετε τη δομή ενός φυσιολογικού μεταφασικού χρωμοσώματος  και τον τρόπο με τον οποίο από τα ινίδια χρωματίνης προκύπτουν τα μεταφασικά χρωμοσώματα.                                                                      Μονάδες 8

2. Η έκφραση των γονιδίων υπόκειται σε ρύθμιση. Να εξηγήσετε πως επιτυγχάνεται η γονιδιακή ρύθμιση στους ευκαρυωτικούς οργανισμούς σε επίπεδο μετάφρασης.                                                                                    Μονάδες 5

3. Να περιγράψετε τον τρόπο δημιουργίας του καρυότυπου ενός κατώτερου πρωτόζωου με απλοειδές γονιδίωμα n=7 και να τον συγκρίνετε με τον καρυότυπο του ανθρώπου.                                                                      Μονάδες 6

4. Με ποιους τρόπους τα κύτταρα εξασφαλίζουν την πιστότητα της αντιγραφής του γενετικού υλικού τους;                                                                       Μονάδες  6

Θέμα 3ο                                                                                                                                        Μονάδες 25

Α. Σε ένα εργαστήριο μοριακή μικροβιολογίας αναπτύσσονται υγρές καλλιέργειες τριών διαφορετικών στελεχών E.coli.

Στέλεχος Α →            Δεν διαθέτει πλασμίδια και δεν είναι ανθεκτικό σε κανένα αντιβιοτικό.

Στέλεχος Β →            Διαθέτει το πλασμίδιο pKam+F+ και έτσι είναι ανθεκτικό στο αντιβιοτικό Kam και ακόμη στο πλασμίδιο φέρεται το γονίδιο F+ που επιτρέπει τη μεταφορά  του πλασμιδίου σε άλλο βακτήριο μετά την αντιγραφή του.

Στέλεχος Γ →            Διαθέτει το πλασμίδιο pPen+ και έτσι είναι ανθεκτικό στην πενικιλλίνη.

Οι φοιτητές εμβολίασαν μία αποστειρωμένη φιάλη που περιέχει 1L κατάλληλο θρεπτικό υλικό για την ανάπτυξη της Ε.coli με 10ml από την καλλιέργεια Α, 1ml από την καλλιέργεια Γ και 0,1ml από την καλλιέργεια Β και μετά από ανάπτυξη 24 ωρών σε ιδανικές συνθήκες (pΗ=7, θoC=37o, αερισμό) παίρνοντας δείγμα από την καλλιέργεια που δημιούργησαν κατόρθωσαν να αναπτύξουν καθαρές καλλιέργειες (αποτελούμενες από κύτταρα ενός μόνο στελέχους) για ποια στελέχη κατέστει δυνατό αυτό και με ποιο τρόπο;

 

Σημείωση: Τα στελέχη Ε.coli δεν είχαν καμία μορφολογική διαφορά. Θεωρούμε ότι δεν συμβαίνει ανταλλαγή γενετικού υλικού μεταξύ πλασμιδίων ούτε μεταξύ πλασμιδίου και κυρίως μορίου γενετικού υλικού των βακτηρίων.

 

           

Θέμα 4ο                                                                                                                             Μονάδες 25

Α. Στο 11ο χρωμόσωμά μας εδράζεται το γονίδιο Α και στο 21ο χρωμόσωμά μας εδράζεται το γονίδιο Β. Ένας άνθρωπος για τα δύο αυτά γονίδια έχει την εξής σύσταση  (ΑαΒβ).

1. Ποια μπορεί να είναι η σύσταση των γαμετών ως προς τα συγκεκριμένα γονίδια;                              Μονάδες 6

2. Κατά τη 2η μειωτική διαίρεση του στο ένα 21ο χρωμόσωμά του δεν μπορούν να συνδεθούν τα ινίδια της ατράκτου με τα κατάλληλο σημείο στο χρωμόσωμα με αποτέλεσμα να μην μπορεί να πραγματοποιηθεί ο αποχωρισμός των αδελφών χρωματίδων του χρωμοσώματος. Ποια θα είναι τώρα η πιθανή σύσταση των γαμετών του ατόμου;

Μονάδες 6

 Β. Δίνεται η παρακάτω αλληλουχία DNA του βακτηρίου D.pneumoniae, που περιέχει γονίδιο υπεύθυνα για τη σύνθεση ενός ολιγοπεπτιδίου.

Αλυσίδα 1  CAGTGAATTACTTCAATGTCGAAGTGGACACATCGATTAAGTGCACTTAATAATTCCGG
Αλυσίδα 2  GTCACTTAATGAAGTTACAGCTTCACCTGTGTAGCTAATTCACGTGAATTATTAAGGCC

Η αλληλουχία             3’GTGAATTA5′   αποτελεί τον έναν από τους δυο κλώνους του υποκινητή του γονιδίου.

1. Να γράψετε ποια από τις δύο αλυσίδες είναι η μη-κωδική και να σημειώσετε τον προσανατολισμό των κλώνων του δοθέντος μορίου DNA. Να αιτιολογήσετε τις απαντήσεις σας.

Μονάδες 8

2. Ποίο είναι το mRNA που προκύπτει από τη μεταγραφή του γονιδίου;   Μονάδες 5