Αρχείο κατηγορίας Διαγωνίσματα Κατεύθυνσης

ΔΙΑΓΩΝΙΣΜΑ

ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό  

ΖΗΤΗΜΑ 1Ο

Α. Επιλέξτε την μία Σωστή ή μία Λανθασμένη πρόταση που συμπληρώνει κάθε ερώτημα από τα παρακάτω: (25 μονάδες)

  1. Τα νουκλεοτίδια αποτελούνται:

α. αποκλειστικά από μέταλλα.

β. αποκλειστικά από αμέταλλα.

γ. τόσο από μέταλλα όσο και από αμέταλλα.

δ. από οργανικά χημικά στοιχεία.

  1. Η χρήση του υπότονου διαλύματος κατά τη δημιουργία του καρυότυπου:

α. επιτρέπει τη λύση του κυττάρου λόγω ώσμωσης.

β. επιτρέπει την καταστροφή του πυρήνα του κυττάρου.

γ. σταματάει την κυτταρική διαίρεση.

δ. προκαλεί τη μίτωση στο κύτταρο.

  1. Στο κύτταρο της 1ης μειωτικής διαίρεσης του ανθρώπου, ενός φυσιολογικού ατόμου:

α. υπάρχει ένα διπλασιασμένο φυλετικό χρωμόσωμα.

β. υπάρχουν 46 μόρια DNA δίκλωνου, ανά δύο πανομοιότυπα.

γ. υπάρχει διαφορετικό πλήθος Ρ από 9 βραχιόνων των χρωμοσωμάτων.

δ. σε κάθε χρωμόσωμα υπάρχουν δύο κλώνοι πανομοιότυποι και δύο κλώνοι συμπληρωματικοί.

  1. Οι ιοί που χρησιμοποιήθηκαν στο πείραμα του 1952:

α. αποτελούνται από δύο μόνο διαφορετικά είδη βιολογικών μακρομορίων.

β. ανήκουν στους ιούς που προσβάλλουν βακτήρια και μόνο.

γ. έχουν ως γενετικό υλικό ένα όξινο πολυμερές μόριο με υδρογόνο στον 2ο άνθρακα της πεντόζης.

δ. μπορούν να ιχνηθετηθούν με 32Ρ ή με 35S όταν καλλιεργηθούν σε θρεπτικό υλικό κατάλληλο για την ανάπτυξή τους στο οποίο υπάρχει ως Ρ μόνο 32Ρ ή υπάρχει ως S μονάχα 35S.

  1. Στο γονιδίωμα ενός ατόμου:

α. υπολογίζεται το DNA που περιέχεται στο σύνολο των κυττάρων του.

β. υπολογίζεται μόνο το γενετικό υλικό που αντιπροσωπεύει τα γονίδιά του.

γ. υπολογίζεται το χρωμοσωμικό DNA του και το μη-χρωμοσωμικό DNA του.

δ. τίποτα από τα παραπάνω δεν είναι σωστό.

ΖΗΤΗΜΑ 2Ο

  1. Ποιο είναι το συμπέρασμα του πειράματος που πραγματοποιήθηκε το 1928;

(μονάδες 5)

  1. Περιγράψτε τη δομή του χρωμοσωμικού γενετικού υλικού των προκαρυωτικών κυττάρων. (μονάδες 5)

  1. Ποια χρωμοσώματα ονομάζονται αυτοσωμικά και ποια φυλετικά; Ένα άτομο με καρυότυπο ΧΧΥ + 44 αυτοσωμικά, τι φύλο αναμένεται να είναι; (μονάδες 5)

 

  1. α) Δώστε τον ορισμό του όρου μετασχηματισμός. (μονάδες 3)

β) Ποιοι οργανισμοί μετασχηματίζονται; (μονάδες 3)

γ) Αναφέρετε δύο παραδείγματα μετασχηματισμού που γνωρίζετε. (μονάδες 4)

ΖΗΤΗΜΑ 3Ο

Δίνεται ένα βακτήριο E. coli με γονιδίωμα 4,6 x 106 ζβ για το κυρίως μόριο που διαθέτει. Το βακτήριο αυτό, τοποθετείται σε στερεό θρεπτικό υλικό με μοναδική πηγή Ρ το 32Ρ και μοναδική πηγή S το 35S. Πραγματοποιεί, δύο διαδοχικές απλές διχοτομήσεις και τα κύτταρα που προκύπτουν, μεταφέρονται σε νέο στερεό θρεπτικό υλικό, που περιέχει αποκλειστικά 31Ρ και αποκλειστικά 35S. Τα κύτταρα διαιρούνται για 5 ώρες ακόμα. Γνωρίζετε ότι το E. coli διαιρείται κάθε 30 λεπτά.

α. Στο πρώτο τρυβλίο, πόσοι κλώνοι DNA φέρουν 32Ρ και πόσοι κλώνοι φέρουν 35S;

(μονάδες 5)

β. Στο δεύτερο τρυβλίο, πόσα κύτταρα αποτελούν την αποικία; (μονάδες 5)

γ. Πόσα από αυτά τα κύτταρα φέρουν ραδιενεργό DNA; (μονάδες 5)

δ. Πόσοι κλώνοι DNA είναι στην αποικία του 2ου τρυβλίου ραδιενεργοί και πόσοι είναι μη ραδιενεργοί; Να υπολογιστεί το πλήθος των ραδιενεργών νουκλεοτιδίων.

(μονάδες 5)

ε. Η αποικία μολύνεται από Τ2 φάγους. Πόσοι από τους φάγους αυτούς που θα παραχθούν από τα μολυσμένα κύτταρα (όλα τα κύτταρα μολύνονται) θα είναι ραδιενεργοί; (μονάδες 5)

ΖΗΤΗΜΑ 4Ο

  1. Το βακτήριο Clostridium tetani προκαλεί τον τέτανο. Το γονιδίωμα του βακτηρίου αποτελείται πέρα από το χρωμοσωμικό γενετικό υλικό και από ένα πλασμίδιο, στο οποίο φέρεται ένα γονίδιο ανθεκτικότητα στο αντιβιοτικό Τετρακυκλίνη (tetR gene). Το πλασμίδιο αντιγράφεται πάντα μόνο 2 φορές εντός του βακτηρίου.

Στο κυρίως μόριο DNA του βακτηρίου φέρεται ο γενετικός τόπος του γονιδίου lexA. Το βακτήριο κλωνοποιείται και δημιουργεί μία αποικία αποτελούμενη από 26 κύτταρα σε χρονικό διάστημα 6 ωρών.

α. Ποιος είναι ο χρόνος διαίρεσης του Clostridium tetani; (μονάδες 5)

β. Στην αποικία πόσα αντίγραφα του γενετικού τόπου του γονιδίου lexA υπάρχουν; Πόσα αντίγραφα του γονιδίου tetR; (μονάδες 5)

γ. Λαμβάνεται ένα κύτταρο από την εν λόγω αποικία και μεταφέρεται σε νέο θρεπτικό υλικό κατάλληλο για την ανάπτυξή του. Στο κύτταρο αυτό πραγματοποιείται ανασυνδυασμός μεταξύ ενός από τα πλασμίδια και του κυρίως μορίου DNA. Κατά τον ανασυνδυασμό γίνεται ανταλλαγή μεταξύ του γονιδίου tetR του πλασμιδίου και του γονιδίου lexA του χρωμοσωμικού γενετικού υλικού. Μετά από 2 ώρες πόσα αντίγραφα του γονιδίου lexA και πόσα αντίγραφα του γονιδίου tetR υπάρχουν στα κύτταρα που προέκυψαν;

(μονάδες 10)

  1. Μία μιτοχονδρική νόσος του ανθρώπου ελέγχεται από ένα γονίδιο που εδράζεται στο Χ φυλετικό χρωμόσωμα του ανθρώπου, ένα αυτοσωμικό γονίδιο του ανθρώπου που εδράζεται στο 21ο χρωμοσωμικό ζεύγος και δύο μιτοχονδρικά γονίδια, τα ND1 και ND6.

Έστω το φυλοσύνδετο γονίδιο Α με αλληλόμορφους Α και α με το Α επικρατές του α, δηλαδή Α (Α,α) Α>α. Το παθολογικό αλληλόμορφο είναι το Α. Δηλαδή άτομα με γονότυπο ΧΑΥ ή ΧΑΧΑ ή ΧΑΧα νοσούν.

Έστω το αυτοσωμικό γονίδιο Β (Β,β) με Β>β και παθολογικό αλληλόμορφο το β. Δηλαδή άτομα με γονότυπο ββ νοσούν, ενώ άτομα με γονότυπο ΒΒ ή Ββ δε νοσούν.

Τα γονίδια ND1 (ND1, ND1*) ND1>ND1* και ND6 (ND6, ND6*) με ND6>ND6*. Τα νοσούντα άτομα έχουν αποκλειστικά ND1* και ND6*. Για να νοσεί ένα άτομο πρέπει να έχει γονότυπο ββΧ^Α-ND1*ND6*.

α) Πόσοι είναι οι διαφορετικοί συνδυασμοί αλληλόμορφων (γονότυποι) που υπάρχουν σε ένα ανθρώπινο πληθυσμό και οδηγούν σε φυσιολογικό φαινότυπο (άτομο υγιές για την συγκεκριμένη νόσο) και ποιο συνδυασμό γονιδίων (αλληλόμορφων) πρέπει να έχει ένα άτομο για να νοσεί; (μονάδες 5)

extra ΕΡΩΤΗΜΑΤΑ

β) Ένα άτομο με σύνδρομο Down (Τρισωμία 21ο χρωμόσωμα), δηλαδή άτομο με καρυότυπο 47 χρωμοσωμάτων, 46 φυσιολογικά και ένα ακόμη 21ο χρωμόσωμα.

  1. Πόσους γενετικούς τόπους της ασθένειας αυτής διαθέτει;

  2. Πόσα αλληλόμορφα γι’ αυτή την ασθένεια διαθέτει;

  3. Πόσα αντίγραφα για κάθε γονίδιο που ελέγχει την ασθένεια διαθέτει;

Η αναφορά να γίνει ανά σωματικό του κύτταρο, με δεδομένο για την άσκηση ότι σε κάθε σωματικό κύτταρο υπάρχουν 50 μιτοχόνδρια.

Απαντήστε στα ίδια ερωτήματα για ένα άτομο με σύνδρομο Klinefelter 44 Αυτοσωμικά + ΧΧΥ.

Γνωρίζετε ότι κάθε γονέας μέσω της μείωσης και της γονιμοποίησης κληροδοτεί ένα πλήρες απλοειδές γονιδίωμα του πυρήνα σε κάθε απόγονο.

γ) Ένα ζευγάρι έχει τους εξής γονοτύπους: ♀ ββ ΧαΧα (ND1*, ND6*)

♂ Ββ ΧΑΥ (ND1*, ND6)

Το ζευγάρι απέκτησε ένα γιο που δε νοσεί και μία κόρη που νοσεί καθώς και μία δεύτερη κόρη που δε νοσεί. Γράψτε τους γονοτύπους των παιδιών του ζευγαριού.

Διαγώνισμα βιολογίας θετικού προσανατολισμού στα κεφαλαία 2-4

ΖΗΤΗΜΑ 1Ο                                                                                             ΜΟΝΑΔΕΣ 25

 

Α)                                                                                                             ΜΟΝΑΔΕΣ 15

  1. Ποιο από τα παρακάτω πλασμίδια είναι κατάλληλο να χρησιμοποιηθεί ως φορέας κλωνοποίησης σε ζυμομύκητα cDNA βιβλιοθήκης του αλόγου;

2017 Διαγώνι??? 2-4-01

Υπόμνημα: όπου Υ = Υποκινητής, ΑΛΜ= Αλληλουχίες Λήξης της Μεταγραφής,

ΘΕΑ= Θέση Έναρξης της Αντιγραφής, TetR = γονίδιο ανθεκτικότητας στο αντιβιοτικό τετρακυκλινη, Killer= γονίδιο που κωδικοποιεί για μια τοξική πρωτεΐνη για τον ξενιστή, lacZ  = γονίδιο που κωδικοποιεί για την β-γαλακτοζιδαση, Polylinker= πολλές διαφορετικές μοναδικές διαδοχικές αλληλεπικαλυπτόμενες θέσεις περιορισμού. Κάθε polylinker εδώ είναι διαφορετικός από τους άλλους.

1ο πλασμιδιο: οι υποκινητές είναι οι φυσικοί υποκινητές των αναφερομένων γονίδιων.

2ο πλασμιδιο: ο πρώτος υποκινητής είναι γονίδιου της ζύμης, ο δεύτερος υποκινητής είναι ο φυσικός υποκινητής του γονίδιου lacZ.

3o  πλασμιδιο: όλοι οι υποκινητές και οι ΑΛΜ ανήκουν στη ζύμη.

4ο πλασμιδιο: οι ΑΛΜ στα δεξιά ανήκουν στο γονίδιο της ανθεκτικότητας στην τετρακυκλινη και όλοι οι υποκινητες ανήκουν στη ζυμη.

  1. Πόσα γονίδια υπάρχουν στο παρακάτω τμήμα γονιδιωματικής βιβλιοθήκης του βακτηρίου Treponema Pallidum. Ορίστε τα τμήματα που τα αποτελούν.

2017 Διαγώνι??? 2-4-02

Ο Υποκινητής δεξιά είναι ο Υ1 και βρίσκεται στην περιοχή Β του χρωμοσώματος

Τ και Ρ Συντηρημένες αλληλουχίες

 

α) Δύο γονίδια: γονίδια: (Υ1 : Γ + Δ, Υ2 : Ε + Δ + Γ + Β + Α + Ω)

β) Δύο γονίδια: γονίδια: (Υ1 : Γ + Δ, Υ2 : Η + Θ)

γ) Δύο γονίδια: γονίδια: (Υ1 : Β + Α + Ω, Υ2 : Ζ + Ε + Δ)

δ) Δύο γονίδια: γονίδια: (Υ2 : Η + Θ, Υ1 : Α + Ω)

  1. Ο ρυθμός της κυτταρικής διαφοροποίησης στο σύνολο του οργανισμού από την εμβρυική ηλικία μέχρι τα βαθιά γεράματα θα μπορούσε να αποδοθεί με το γράφημα:

2017 Διαγώνι??? 2-4-03

Σημείωση: Τα διαγράμματα δεν δίνονται υπό κλίμακα.

  1. Η αντιγραφή ενός κυκλικού μορίου DNA μπορεί να γίνεται σύμφωνα με ότι γνωρίζετε από το σχολικό βιβλίο.

2017 Διαγώνι??? 2-4-04

ε) Με όλους τους παραπάνω τρόπους.

στ) Με τους δύο πρώτους αναλόγως το είδος του κυκλικού μορίου.

  1. Δίνονται τα παρακάτω δύο γραμμικά μόρια DNA:

2017 Διαγώνι??? 2-4-05

Σημείωση: από τα αριστερά προς τα δεξιά είναι τα θραύσματα Α1, Α2, Α3 και Β1, Β2, Β3.

Τα μόρια DNA πέπτονται από δύο διαφορετικές Π.Ε την EcoRI και ένα περιοριστικό ένζυμο που αναγνωρίζει την αλληλουχία     5΄ C TTAAG

                                                                                                GAATT C

και κόβει μεταξύ του C και Τ σε κάθε κλώνο.

Εν συνεχεία τα δύο αυτά κομμένα μόρια αναμειγνύονται παρουσία του ενζύμου DNA δεσμάση. Μπορούν να δημιουργηθούν οι συνδυασμοί:

α) Α1 + Α3, Β1 + Β3, Α2 + Β2

β) Α1 + Β3, Β1 + Α3, Α2 + Β2

γ) Α1 + Β1, Α3 + Β3, Α2 + Β2

δ) Α1 + Α3, Β1 + Β3

Β) Χαρακτηρίστε ως Σ ή Λ καθεμία από τις παρακάτω προτάσεις:

ΜΟΝΑΔΕΣ 10

  1. Σε ένα βακτήριο έχει συμβεί λάθος κατά την αντιγραφή του DNA του (κυρίως μόριο), το οποίο δεν επιδιορθώθηκε στη ΘΕΑ και δεν αναγνωρίζεται από τις DNA ελικάσες, η μετάλλαξη αυτή είναι θνησιγόνος.
  2. Σε ένα ευκαρυωτικό χρωμόσωμα έγινε το ίδιο λάθος, όπως παραπάνω, σε ένα σημείο του χρωμοσώματος, είναι η μετάλλαξη αυτή θανατηφόρα;
  3. Τα ευκαρυωτικά χρωμοσώματα σε κάθε μίτωση είναι πιο κοντά από τα αντίστοιχα της προηγούμενης μίτωσης στην ίδια κυτταρική σειρά, αυτό συμβαίνει και με το βακτηριακό DNA.
  4. Στο διπλανό σχήμα για την ενίσχυση του τμήματος Α με PCR τα κατάλληλα τεχνητά ολιγονουκλεοτίδια είναι το ζευγάρι 1-3.

2017 Διαγώνι??? 2-4-06

5. Εάν ένα ευκαρυωτικό γονίδιο έχει 4 εσώνια, από το γονίδιο αυτό προκύπτουν έως 8 διαφορετικά ώριμα mRNA.

 

 

ΖΗΤΗΜΑ 2ο                                                                                             ΜΟΝΑΔΕΣ 25

1) Σε μία άσκηση ενός πανεπιστημιακού εργαστηρίου Μοριακής Βιολογίας μία ομάδα φοιτητών προσπαθεί να δημιουργήσει τη γονιδιωματική βιβλιοθήκη του βακτηρίου Lactobacillus sp.

Οι φοιτητές διαθέτουν ένα φορέα κλωνοποίησης πλασμίδιο που φέρει γονίδια ανθεκτικότητας στα αντιβιοτικά Στρεπτομυκίνη (StrR) και Αμπικιλλίνη (AmpR). Το τελευταίο φέρει και τη μοναδική θέση ανασυνδυασμού. Τα βακτήρια-ξενιστές είναι ένα κατάλληλο στέλεχος E.coli.

Στην εργασία τους οι φοιτητές έγραψαν:

«Μετά τον ανασυνδυασμό των φορέων κλωνοποίησης από τα θραύσματα του DNA του Lactobacillus sp. επακολούθησε ο μετασχηματισμός των βακτηρίων-ξενιστών. Μετά τον μετασχηματισμό, υπήρχαν 3 κατηγορίες βακτηρίων E.coli.

α) Τα μη μετασχηματισμένα που δεν φέρουν ανθεκτικότητα ούτε σε Str, ούτε σε Amp.

β) Τα μετασχηματισμένα

  1. Με το μη ανασυνδυασμένο φορέα κλωνοποίησης που έχουν ανθεκτικότητα και στα δύο αντιβιοτικά.
  2. Με τον ανασυνδυασμένο φορέα κλωνοποίησης που φέρουν ανθεκτικότητα μόνο στο αντιβιοτικό Str.

Ο διαχωρισμός των βακτηρίων που αποτελούν τη βιβλιοθήκη από τα υπόλοιπα κύτταρα E.coli θα γίνει ως εξής:

Τα ζητούμενα βακτήρια  E.coli είναι τα μετασχηματισμένα με το ανασυνδυασμένο πλασμίδιο.

Στην την υγρή βακτηριακή καλλιέργεια των ξενιστών που χρησιμοποιήθηκαν για το μετασχηματισμό τους, υπήρχε το αντιβιοτικό Str, οπότε τα μόνα βακτήρια που επέζησαν ήταν τα μετασχηματισμένα. Από αυτή την υγρή καλλιέργεια επιλέγουμε κάποια βακτήρια και τα καλλιεργούμε μεμονωμένα σε υγρό θρεπτικό υλικό. Στη συνέχεια χωρίζουμε τους απογόνους σε δύο ίσα μέρη και σε κάποια βακτήρια από τα δύο αυτά μέρη χορηγούμε αμπικιλλίνη. Αν πεθάνουν κάποια, συμπεραίνουμε ότι προέρχονται από την ομάδα που μας ενδιαφέρει, δηλαδή τα μετασχηματισμένα με το ανασυνδυασμένο πλασμίδιο.»

Εξηγήστε γιατί οι φοιτητές μηδενίστηκαν από τον υπεύθυνο του εργαστηρίου.

μονάδες 5

2) Εργάζεστε σε μία φαρμακευτική βιομηχανία και ενδιαφέρεστε να δημιουργήσετε  το εμβόλιο κατά ενός νέου ιού. Ξεκινάτε ψάχνοντας στο γονιδίωμα του ιού, ώστε να βρείτε τα/το γονίδιο που κωδικοποιεί για μία κατάλληλη πρωτεΐνη αντιγονικό καθοριστή του ιού.

Εξηγήστε το είδος της βιβλιοθήκης του ιικού DNA που θα δημιουργήσετε, γονιδιωματική ή cDNA;

3) Δίνεται το παρακάτω μόριο RNA προϊόν της μεταγραφής ενός βακτηρίου. Το μόριο αυτό είναι λειτουργικό.

2017 Διαγώνι??? 2-4-07

α) Τι είδους γονίδιο το κωδικοποιεί αυτό το μόριο RNA; (3)

β) Γράψτε το τμήμα του γονιδίου που το κωδικοποιεί και αφορά την περιοχή 3. Προσδιορίστε την κωδική αλυσίδα του γονιδίου και τον προσανατολισμό των κλώνων του. (4)

γ) Τι είδους δεσμοί σταθεροποιούν αυτή τη δομή του μορίου RNA εντός της περιοχής 2; Ποιο ένζυμο καταλύει τη δημιουργία αυτών των δεσμών; (2)

δ) Στην περιοχή 1 δίνεται ένα τμήμα της αλληλουχίας της. Μπορούμε να υπολογίσουμε τα % των βάσεων %Α, %U, %C και %G στην απέναντι πλευρά της περιοχής 1 από αυτήν που δίνεται η ακολουθία; (3)

ε) Απαντήστε στο ίδιο ερώτημα αν η ακολουθία αυτή της περιοχής 1 ήταν εντός της περιοχής 2. (3)

ΖΗΤΗΜΑ 3Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α) Παρακάτω δίνονται τα τμήματα δύο διαφορετικών γονιδίων. Το γονίδιο 1 κωδικοποιεί για μία πρωτεΐνη που εκφράζεται πάντα σε υψηλό ρυθμό. Το γονίδιο 2 εκφράζεται μόνο σε ένα κατάλληλο αναπτυξιακό στάδιο του οργανισμού.

Συνέβη αναδιάταξη γονιδίων και το τμήμα του γονιδίου 2 που δίνεται τοποθετήθηκε κοντά στον υποκινητή του γονιδίου 1. Δημιουργήθηκαν 4 διαφορετικές αναδιατάξεις. Εξηγήστε σε ποια από όλες εκφράστηκε το τμήμα του γονιδίου ② και για ποιο λόγο δεν εκφράστηκε σωστά ή καθόλου στις άλλες πιθανές αναδιατάξεις.

Σημείωση: Η αλληλουχία που δίνεται Italics και υπογραμμισμένη αποτελεί τον υποκινητή. Τα νούμερα δηλώνουν το πλήθος των νουκλεοτιδίων.  Στο γονίδιο ② η υπογράμμιση δηλώνει το πλαίσιο ανάγνωσης του γονιδίου. Στο γονίδιο ① τα bold ζεύγη βάσεων δηλώνουν τις 4 πιθανές θέσεις αναδιάταξης του γονιδίου ②. Το τμήμα του γονιδίου ② τοποθετείται κάθε φορά αμέσως μετά τη θέση 83, 136, 155, 183 του γονιδίου ①.

gene

Β) Το φυσιολογικό γονίδιο ① αντιγράφεται. Από τη θέση 80 έως τη θέση 140 υπάρχει θέση έναρξης της αντιγραφής.

Δίνονται τα παρακάτω πρωταρχικά τμήματα:

  1. 5΄ AGAGAGAGAA 3΄
  2. 5΄ CUCCCCCGCG 3΄
  3. 5΄ AUAUAAUCUA 3΄
  4. 5΄ CCAUACAUAG 3΄

τα οποία είναι τα πρώτα πρωταρχικά τμήματα που τοποθετούνται από τα πριμοσώματα. Γνωρίζετε ότι το πριμόσωμα τοποθετεί πρωταρχικό τμήμα 10 νουκλεοτιδίων κάθε 30 νουκλεοτίδια από το 5΄ άκρο του ακριβώς προηγούμενου πρωταρχικού τμήματος.

  • Να βρεθούν τα δύο επόμενα πρωταρχικά τμήματα που θα τοποθετήσουν τα πριμοσώματα. (10)
  • Σε ποιο κλώνο, στον πάνω ή στον κάτω, κινείται η DNA πολυμεράση χρησιμοποιώντας τον ως καλούπι που τοποθέτησε το 29ο νουκλεοτίδιο στον κλώνο που συντίθεται ασυνεχώς και το νουκλεοτίδιο αυτό ήταν η Τ. (3)

ΖΗΤΗΜΑ 4Ο

 Σε δύο διαφορετικά βακτηριακά στελέχη E.coli μελετήθηκε η κινητική της παραγωγής της β-γαλακτοσιδάσης, παρουσία και απουσία λακτόζης. Όταν δεν υπήρχε λακτόζη, τα βακτήρια αναπτύσσονταν σε γαλακτόζη.

2017 Διαγώνι??? 2-4-08

Για την ερμηνεία της καμπύλης ① δημιουργήθηκαν οι γονιδιωματικές βιβλιοθήκες των δύο στελεχών. Σε κάθε περίπτωση χρησιμοποιήθηκαν οι ίδιες περιοριστικές ενδονουκλεάσες και για τα δύο στελέχη. Η χρήση αυτών των Π.Ε. επιτρέπει την κοπή του γονιδιώματος του E.coli με τέτοιο τρόπο ώστε να δημιουργείται θραύσμα με ακέραιο το τμήμα που περιλαμβάνει από τον υποκινητή του ρυθμιστικού γονιδίου μέχρι και τις αλληλουχίες λήξης της μεταγραφής των δομικών γονιδίων.

Από τη σύγκριση των αλληλουχιών των οπερονίων των δύο στελεχών δεν παρατηρήθηκε καμία διαφορά μεταξύ τους.

Η σύγκριση έγινε με πέψη με ορισμένο πλήθος και είδος περιοριστικών ενδονουκλεάσεων που πέπτουν εντός του απομονωμένου τμήματος.

Σημειωση:το παρακάτω σχήμα δεν αφορά το PCR.

2017 Διαγώνι??? 2-4-10

Τα παραπάνω αποτελέσματα ηλεκτροφορισης αφορουν τη γονιδιωματική βιβλιοθήκη  για τους κλώνους που περιέχουν το οπερόνιο στις  βιβλιοθήκες Α και Β.

Κάθε  μια από τις πέψεις i, ii, iii  έγινε με διαφορετικό σύνολο περιοριστικών ενζύμων.

Ακολούθησε PCR μέθοδος στα γονιδιώματα των στελεχών:

  1. PCR για την ενίσχυση του γονιδίου της β-γαλακτοσιδάσης.
  2. PCR για την ενίσχυση του χειριστή.
  3. PCR για την ενίσχυση του ρυθμιστικού γονιδίου.

Κατόπιν επακολούθησε πέψη των προϊόντων της PCR για τη σύγκριση των αλληλουχιών αυτών των δύο στελεχών.

Ακόμη είχε γίνει υβριδοποίηση των γονιδιωματικών βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των αποικιών των παραπάνω περιοχών του οπερονίου.

Τα αποτελέσματα του PCR είναι: Για την ενίσχυση των περιοχών DNA:

2017 Διαγώνι??? 2-4-11

iii

2017 Διαγώνι??? 2-4-09

Ακόμη είχε γίνει υβριδοποίηση των γονιδιωματικών βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των αποικιών των παραπάνω περιοχών του οπερονίου.

Τα αποτελέσματα της υβριδοποίησης είναι:

table

 

Σύμφωνα με την παραπάνω πειραματική διαδικασία, απαντήστε:

α) Για ποιο λόγο οι επιστήμονες δημιούργησαν γονιδιωματικές και όχι cDNA βιβλιοθήκες των δύο στελεχών;

β) Για ποιο λόγο δημιούργησαν τις δύο διαφορετικές βιβλιοθήκες χρησιμοποιώντας τα ίδια ένζυμα;

γ) Για ποιο λόγο συνέκριναν τις αλληλουχίες των δύο οπερονίων των δύο στελεχών; Πώς γίνεται η σύγκριση με την πέψη;

δ) Για ποιο λόγο έγινε PCR των συγκεκριμένων περιοχών του γονιδιώματος που ανήκουν στο οπερόνιο των δύο στελεχών από ολόκληρο το γονιδίωμα;

ε) Για ποιο λόγο συνέκριναν ως προς την αλληλουχία τα προϊόντα του PCR, που έγινε για στοχευμένα τμήματα του οπερονίου, αφού είχαν συγκρίνει ήδη αυτές τις περιοχές εντός των βιβλιοθηκών;

στ) Για ποιο λόγο μετά το πρώτο PCR έγινε υβριδοποίηση των βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των συγκεκριμένων αλληλουχιών;

ζ) Ερμηνεύστε για ποιο λόγο το στέλεχος     εμφανίζει αυτή τη συμπεριφορά παρουσία γαλακτόζης.

Διαγώνισμα κεφαλαίων 8 και 9 Βιολογίας Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

 

Επιλέξτε την ορθή επιλογή που συμπληρώνει σωστά την πρόταση:

  1. Στόχοι του προγράμματος του ανθρωπίνου γονιδιώματος είναι:

Α. Αλληλούχιση του γενετικού υλικού και χαρτογράφηση των γονιδίων μας.

Β. Ο προσδιορισμός των γονιδίων που σχετίζονται με τις ασθένειες

Γ. Η μελέτη της εξελικτικής μας πορείας

Δ. Η κατανόηση του ρόλου των περιοχών του γονιδιώματος μας, που δεν μεταγράφονται.

Ε. Όλα τα παραπάνω

  1. Οι απαραίτητες γνώσεις για την βιοτεχνολογική παραγωγή φαρμακευτικών πρωτεϊνών από βακτήρια, είναι:

Α. Γνώση του ιστού όπου εκφράζεται το υπεύθυνο γονίδιο, απομόνωση και κλωνοποίηση του γονιδίου, γνώση και δυνατότητα in vitro  των μετά μεταφραστικών τροποποιήσεων, οικονομικό όφελος.

Β. Χαρτογράφηση του υπεύθυνου γονιδίου, γνώση του ιστού που δρα η φαρμακευτική πρωτεΐνη, δημιουργία γονιδιωματικής βιβλιοθήκης, γνώση μετα-μεταγραφικών τροποποιήσεων in vitro.

Γ. Γνώση της αλληλουχίας του ανθρωπίνου γονιδιώματος, κατασκευή cDNA βιβλιοθήκης, οικονομικό όφελος.

Δ. Η καθολικότητα του κώδικα, η καθολικότητα των ριβοσωμάτων.

Ε. Τίποτα από τα παραπάνω.

  1. Πότε ξεκίνησε και πότε ολοκληρώθηκε το πρόγραμμα του ανθρωπίνου γονιδιώματος;

Α. Το 1986 και το 2005 αντιστοίχως

Β. Το 1990 >>>>>2001 >>>>>>>>

Γ. Το 1993 >>>>>2001 >>>>>>>>

Δ. Το 1990 >>>>>2005 >>>>>>>>

Ε. Τίποτα από τα παραπάνω.

  1. Με την δημιουργία του κλωνοποιημένου προβάτου Ντόλυ, αποδείχθηκε:

Α. Η δυνατότητα της αναπαραγωγής κλώνων ανθρώπων

Β. Ο επαναπρογραμματισμός μερικώς διαφοροποιημένων κυττάρων

Γ. Η κυτταρική διαφοροποιήση

Δ. Ότι και τα ζώα όπως και τα φυτά αναγεννιούνται από σωματικά κύτταρα.

Ε. Όλα τα παραπάνω

  1. Κατά την διαδικασία δημιουργίας διαγονιδιακών σολομών (ψάρια), πιο βήμα δεν θα πραγματοποιήθει:

Α. Η μικροέκχυση στο γονιμοποιημένο ωάριο

Β. Η in vitro γονιμοποίηση

Γ. Η τοποθέτηση του γονιμοποιημένου ωάριου στη μήτρα θετής μητέρας

Δ. Η απομόνωση σπερματοζωαρίων .

Ε. Όλα τα παραπάνω πρέπει να πραγματοποιηθούν.

Ζήτημα 2ο                                                              

Α. Ο Bob είναι ένας βελτιωμένος ταύρος γαλακτοπαραγωγής  προϊόν επιλεκτικών ομομεικτικών διασταυρώσεων και αποτελεί καθαρή σειρά. Η Bobena είναι αδελφή του Bob, με τα ίδια χαρακτηριστικά.

Επίσης, ο Sam  είναι ένας βελτιωμένος ταύρος κρεατοπαραγωγής και αυτός καθαρή σειρά. Τέλος η Samena είναι αδελφή του Sam, επίσης με τα ίδια χαρακτηριστικά όπως και ο Sam.

Οι γεωπόνοι ζωοτέχνες γενετιστές πραγματοποίησαν τις εξής διασταυρώσεις:

P1: Bob x Bobena

F1: θηλυκό Β1, αρσενικό Β2, αρσενικό Β3, θηλυκό Β4

P2: Sam x Samena

F1: αρσενικό S1, αρσενικό S2, θηλυκό S3, θηλυκό S4

P3: Bob x Samena

F1: θηλυκό BS1, θηλυκό BS2, αρσενικό BS3, αρσενικό BS4

P4: Sam x Bobena

F1: θηλυκό SB1, αρσενικό SB2, αρσενικό SB3, θηλυκό SB4

α. Ποια από τα παραπάνω άτομα έχουν μεταξύ τους τον ίδιο ακριβώς γονότυπο; (να λάβουμε υπόψη τον επιχιασμό)

β. Ποια άτομα μπορει να έχουν βελτιωμένες και τις δυο ιδιότητες (γαλακτοπαραγωγή και κρεατοπαραγωγή);

γ. Ποιοι απόγονοι αναμένεται να φέρουν στα κύτταρα τους τέσσερα ολόιδια μόρια DNA για το σύνολο των χρωμοσωμάτων τους;

δ. Ποια άτομα ονομάζονται υβρίδια;

ε. ποια άτομα παράγουν γαμέτες που είναι ολόιδιοι μεταξύ τους;

Β. Αναφέρεται τους λόγους που γνωρίζεται και είναι κατάλληλα τα ποντίκια ως πειραματόζωα.

Γ. ποιοι είναι οι στόχοι τις Ιατρικής και με ποιους τρόπους η σύγχρονη Βιοτεχνολογία τους επιτυγχάνει

Δ. Με δεδομένο ότι τα ποντίκια που θα χρησιμοποιηθούν για την παραγωγή μονοκλωνικών αντισωμάτων έναντι ενός επιλεγμένου αντιγόνου έρχονται για πρώτη φορά σε επαφή με το επιθυμητό αντιγόνο, μπορείτε να εξηγήσετε για ποιο λόγο παίρνουμε τον σπλήνα του ποντικού 15 ημέρες μετά τον εμβολιασμό του με το επιλεγμένο αντιγόνο;

Γνωρίζετε την καμπύλη της πρωτογενούς ανοσοβιολογικής απόκρισης των θηλαστικών, όπως δίνεται παρακάτω.

2017 Blog 8-9-02

Ζήτημα 3ο

Α. Σύμφωνα με την κρατούσα θεωρία για την ικανότητα του οργανισμού μας να παράγει μονάχα τα αντισώματα που αναγνωρίζουν αντιγονικούς καθοριστές (πρωτεΐνες, γλύκοπρωτεΐνες κ.α.) που ανήκουν σε ξένες προς τον οργανισμό ουσίες/σώματα, κατά την εμβρυακή ηλικία μας δοκιμάζονται τα πιθανά αντισώματα που μπορεί να φτιάξει ο οργανισμός επί των αντιγονικών καθοριστών του ίδιου του οργανισμού και καταστρέφονται τα πιθανά λεμφοκύτταρα που αναγνωρίζουν τους αντιγονικούς καθοριστές του οργανισμού μας.

Σύμφωνα με τα παραπάνω μπορείτε να εξηγήσετε για ποιο λόγο ενώ κατά την γονιδιακή θεραπεία της κυστικής ίνωσης το φυσιολογικό αλληλόμορφο ενθέθηκε επιτυχημένα στο γονιδίωμα των κυττάρων στόχων του ασθενούς και εκφράστηκε επίσης επιτυχημένα εντούτοις ο ασθενής δεν θεραπεύτηκε από την ασθένεια;

Β. δίνεται το παρακάτω γενεαλογικό δένδρο, το οποίο αφορά την γενεαλογία των πρόβατων που χρησιμοποιούνται ως πειραματόζωα σε ένα ερευνητικό εργαστήριο γενετικής βελτίωσης ζωών.

2017 Blog 8-9-03

Από το πρώτο ζευγάρι Ι1 και Ι2 επιδιώχθηκε η δημιουργία διαγονιδιακών ζωών που παράγουν στο γάλα τους την ανθρώπινη ινσουλίνη, ενώ από το ζευγάρι Ι3 και Ι4 επιδιώχθηκε η δημιουργία διαγονιδιακών ζωών που παράγουν στο γάλα τους την α1 αντιθρυψίνη του ανθρώπου.

Γνωρίζουμε ότι  το ανθρώπινο γονίδιο της ινσουλίνης έχει μέγεθος 2000 ζεύγη βάσεων  ενώ της α1-αντιθρυψίνης έχει μέγεθος 4000 ζεύγη βάσεων (υποθετικά μεγέθη ζεύγων βάσεων).

Παρακάτω δίνονται τα αποτελέσματα των μοριακών εξετάσεων με PCR που πραγματοποιήθηκαν στα ζώα της ΙΙΙ γενεάς.

2017 Blog 8-9-04

Σύμφωνα με τα παραπάνω δεδομένα:

α. Ποια από τα άτομα της ΙΙ γενεάς είναι ή μπορεί να είναι διαγονιδιακά;

β. Ποιο από τα άτομα της ΙΙΙ γενεάς δημιουργήθηκε με όμοια τεχνολογία όπως και η Dolly και ποια είναι κλώνος στο σύνολο του γενετικού τους υλικού με το ζώο από το οποίο προήλθαν;

Να αιτιολογήστε την απάντηση σας.

Γ. Σε ένα άτομο με υγιής γονείς, διαπιστώθηκε μετα από βιοχημικές εξετάσεις η παραγωγή ινσουλίνης τοσο στο πάγκρεας όσο και στο ήπαρ, δώστε μια ερμηνεία γι΄αυτή την παρατήρηση. Ποιες περαιτέρω εξετάσεις, έπρεπε να γίνουν για να γίνει δυνατή η ερμηνεία;

Ζήτημα 4ο

Σε ένα ερευνητικό ίδρυμα Γεωπονικών Εφαρμογών, οι Γεωπόνοι Βιοτεχνολόγοι, επιδιώκουν την γενετική τροποποίηση της Ελιάς με γονίδιο ενός είδους ιχθύος για την παραγωγή ελαιόλαδου εμπλουτισμένου με ω-3 λιπαρά οξέα.

Οι επιστήμονες διαθέτουν τα εξής: Τα παρακάτω καθώς και όλα τα ένζυμα της τεχνολογίας του ανασυνδυασμένου DNA  που γνωρίζετε από το σχολικό βιβλίο καθώς και όλα τα υλικά και τον τεχνικό εξοπλισμό που απαιτείται.

2017 Blog 8-9-05

Περιοριστικά έζυμα και θέσεις αναγνώρισης τους (δίνεται μόνο ο ένας από τους δυο συμπληρωματικούς κλώνους):

BamHI 5’ G/GATCC3’
XmaI 5’ C/CCGGG3’
HindIII 5’A/AGCTT3’
PstI 5’CTGCA/G3’
KpnI 5’GGTAC/C3’
SalI 5’G/TCGAC3’
XhoI 5’CTCGA/G3’

StuI                                                                         5’AGG/CCT3′

Υπόμνημα:

Υ1: Υποκινητής ενός γονιδίου που εκφράζεται στην σάρκα του ελαιοκαρπου της ελιάς.

Υ2: Υποκινητής ενός γονιδίου που εκφράζεται στον φλοιό του ελαιόκαρπου.

Υ3: Υποκινητής του επιθυμητού γονιδίου του ψαριού.

Υ4: Υποκινητής ενός γονίδιο της ελιάς  που εκφράζεται στα έμβρυα ελιάς,  μέχρι το στάδιο του γαστριδιου (πρώιμο εμβρυακό στάδιο).

Τ- DNA : Τμήμα του Τi πλασμιδίου που ενθέτεται στο φυτικό γονιδίωμα.

Οι επιστήμονες θέλουν το ετερόλογο γονίδιο να εκφράζεται μόνο στους ελαιόκαρπους.

Το γονίδιο του ψαριού φέρει εκατέρωθεν της εξώνικης περιοχής του θέσεις StuI. Καμία άλλη θέση αναγνώρισης από τις παραπάνω περιοριστικές ενδονουκλεασες δεν υπάρχει στο γονίδιο αυτό.

Α. ποια περιοριστική ενδονουκλεάση θα χρησιμοποιήσουν οι επιστήμονες για να πέψουν το πλασμίδιο που δίνεται; Αιτιολογήστε την απάντηση σας.

Β. Πως θα πραγματοποιηθεί  η διάκριση των γενετικά τροποιημένων φυτών από τα μη τροποποιημένα ; αιτιολογήστε την απάντηση σας.

Γ. στο εργαστήριο είναι διαθέσιμο και ένα άλλο Τi πλασμίδιο, είναι αυτό το πλασμίδιο κατάλληλο για την γενετική τροποποίηση της Ελιάς;

2017 Blog 8-9-06

Υπόμνημα:

Υ1: Υποκινητής ενός γονίδιου που εκφράζεται αποκλειστικά στον ελαιόκαρπο.

Υ2: Υποκινητής ενός γονιδίου ογκογενετικού του πλασμιδίου Τi.

Υ3: Υποκινητής καθολικός φυτικός της Ελιάς.

Υ4: Υποκινητής του γονιδίου ανθεκτικότητας στο αντιβιοτικό τετρακυκλίνη.

Δ. Μετά από την επιτυχημένη δοκιμασία γενετικής τροποποίησης της Ελιάς. Οι επιστήμονες θέλουν να δημιουργήσουν φυτά ομόζυγα για το ετερόλογο γονίδιο αυτό. Πώς μπορούν να το επιτύχουν αυτό;

Πρoστατευμένο: Διαγώνισμα Βιολογίας θετικής Κατευθύνσης κεφαλαίου 4 – Τεχνολογία ανασυνδυασμένου DNA

Αυτό το περιεχόμενο είναι προστατευμένο με συνθηματικό. Για να το δείτε εισάγετε το συνθηματικό σας παρακάτω:

Διαγώνισμα κεφαλαίων 1-2-4 Βιολογίας ομάδας Θετικού Προσανατολισμού

ΔΙΑΓΩΝΙΣΜΑ

ΚΕΦΑΛΑΙΟ 1ο –2ο και 4ο

ΘΕΜΑ Α                                                                                                                                                                                       ΜΟΝΑΔΕΣ 25

Να απαντήσετε στις παρακάτω ερωτήσεις επιλέγοντας την λανθασμένη πρόταση ανάμεσα στις σωστές ή την σωστή ανάμεσα στις λανθασμένες.

Α. Το καλαμπόκι (zea mays) έχει μεγαλύτερη ποσότητα DNA στον πυρήνα του, απ’ ότι έχει ο άνθρωπος. Έτσι, αναμένουμε :

α. Το καλαμπόκι έχει περισσότερα χρωμοσώματα από τον άνθρωπο.

β. Ο άνθρωπος είναι σίγουρα εξελικτικά κατώτερος από το φυτό αυτό.

γ. Ο άνθρωπος και το καλαμπόκι έχουν τον ίδιο λόγο και τον ίδιο καρυότοπο και την ίδια αλληλουχία βάσεων , αλλά θα διαφέρουν ως προς την διαζώνωση.

δ. Το καλαμπόκι δεν αποκλείεται να έχει λιγότερα χρωμοσώματα από τον άνθρωπο, και διαφορετικό λόγο , και διαφορετικό καρυότυπο από τον άνθρωπο.

Β. Μιτογόνος ουσία είναι ……………… και ουσία που σταματάει την κυτταρική διαίρεση στην μετάφαση της μίτωσης είναι η…………………

α) φυτοαιματογλουτίνη , κολχικίνη

β) κολχικίνη, φυτοαιματογλουτίνη

γ) υπότονο διάλυμα , Giemsa

δ) Giemsa , υπότονο διάλυμα

Γ. Στον γενετικό κώδικα υπάρχουν ………………… αμινοξέα που κωδικοποιούνται μονοσήμαντα, ……………… αμινοξέα που κωδικοποιούνται από έξι κωδικόνια συνώνυμα μεταξύ τους και δεν υπάρχει κανένα αμινοξύ που να κωδικοποιείται από …………… συνώνυμα κωδικόνια.

α. 2, 4, 1

β. 2, 6, 7

γ. 2, 5, 3

δ. 2, 3, 5

4. Η αναδίπλωση των χρωμοσωμάτων των ευκαρυωτικών κυττάρων είναι σταδιακά από τη διπλή έλικα με διάμετρο…………….nm , σε …………….. 11 nm και κατόπιν σε ινίδιο χρωματίνης ………………… nm. Σε αυτό το στάδιο το χρωμόσωμα είναι παρατηρήσιμο με ……………….. …………….

5. Δίνεται το παρακάτω μόριο mRNA:

UACUACCACCAUGCCCAUGCCCGAGCGCUAGCCCAUG

α) Ποια είναι η κωδική αλυσίδα του γονιδίου που το κωδικοποιεί ;

β) Ποια είναι η μη-κωδική αλυσίδα του γονιδίου που κωδικοποιεί το RNA μόριο που συνδέεται με το 5ο κωδικόνιο;

γ) Ποια είναι η κωδική αλυσίδα του γονιδίου rRNA που αναγνωρίζει τμήμα τεσσάρων νουκλεοτιδίων στην 5αμετάφραστη περιοχή του mRNA ;

1.

Α) 3’ TACTACCACCATGCCCATGCCCGAGCGCTAGCCCATG 5’

B) 5’ ATGCCCTAGCGCGAGCCCATGCCCATGACCACTT3’

Γ) 5’ TACTACCACCATGCCCATGCCCGAGCGCTAGCCCATG3’

Δ)5’ΤACTACCCACCCATGCCCATGCCCGAGCGCTAGCCCATG3’

2.

A)5’AACCATGGAGCTCTGACCAA3’……

B)5’AACCATGCTCGTGTGACCAA3’…….

Γ)3’AACCCTCATGTGACTCCCAA…….

Δ)ΑACCATGCTCGTGTGACCAA5’…….

3.

A)5’ACCTACGCAC3’……..

B)3’ACGATGCACC5’……..

Γ)3’ATGCCCGAT5’………

Δ)3’CAGGTGGTGA5’……….

ΘΕΜΑ Β                                                                                                                                                                                   ΜΟΝΑΔΕΣ 25

Α. Να συμπληρωθεί ο πίνακας που παρουσιάζεται παρακάτω :

  1. 1. DNA<==> RNA–> ΠΟΛΥΠΕΠΤΙΔΙΟ
  1. 2. DNA—>  RNA—> ΠΟΛΥΠΕΠΤΙΔΙΟ
  2. 3. DNA—>RNA—> ΠΟΛΥΠΕΠΤΙΔΙΟ
  3. 4. DNA<===>  RNA—-> ΠΟΛΥΠΕΠΤΙΔΙΟ
  4. 5. DNA—-> RNA<===> ΠΟΛΥΠΕΠΤΙΔΙΟ
α) Μέσα σε ρετροϊούς.

β) Μιτοχόνδρια, κύτταρα, χλωροπλάστες.

γ) Κύτταρα μολυσμένα από ρετροϊούς.

δ) Κύτταρα μολυσμένα από RNA ιούς με δίκλωνο RNA.

ε) Μέσα σε ιούς

στ) Δεν έχει ανακαλυφθεί τέτοια περίπτωση σε έμβια όντα.

Σημείωση: Σε κάθε παραπάνω περίπτωση ισχύει και η αντιγραφή του DNA ενώ στην 1η και 3η περίπτωση ισχύει και η αντιγραφή RNA.

5 ΜΟΝΑΔΕΣ

Β. Σε ποια στάδια της έκφρασης της γενετικής πληροφορίας σ’ ένα ανθρώπινο κύτταρο βρίσκει εφαρμογή η συμπληρωματικότητα;


4 ΜΟΝΑΔΕΣ

Γ. Να υπολογιστεί το πλήθος των νουκλεοσωμάτων ενός ανθρώπινου γαμέτη, αν γνωρίζεται ότι υπάρχουν νουκλεοσώματα στα άκρα των χρωμοσωμάτων και μεταξύ δύο νουκλεοσωμάτων υπάρχουν 54 ζεύγη νουκλεοτιδίων.

5 ΜΟΝΑΔΕΣ

Δ. Ένας οργανισμός με γονιδίωμα 16 χρωμοσωμάτων πόσα μόρια DNA έχει το κάθε κύτταρο της 1ης μειωτικής διαίρεσης του. Σε ποσα ζευγάρια από τους κλώνους του DNA σε κάθε κύτταρο από αυτά τα κύτταρα, οι κλώνοι είναι πανομοιότυποι και σε πόσα είναι συμπληρωματικοί μεταξύ τους.

3+3 ΜΟΝΑΔΕΣ

Ε. Αντιστοιχίστε με ποιο τρόπο είναι δυνατή η παρατήρηση των κυτταρικών δομών της πρώτης στήλης με τις μεθόδους της δεύτερης στήλης.

1)ΜΟΡΙΟ DNA

2)NOYΚΛΕΟΣΩΜΑ

3)ΜΕΤΑΦΑΣΙΚΟ ΧΡΩΜΟΣΩΜΑ

4)ΠΛΑΣΜΙΔΙΟ

5)ΘΗΛΙΑ ΑΝΤΙΓΡΑΦΗΣ

α)ΚΡΥΣΤΑΛΛΟΓΡΑΦΙΑ ΑΚΤΙΝΩΝ Χ

β) ΗΛΕΚΤΡΟΝΙΚΟ ΜΙΚΡΟΣΚΟΠΙΟ

γ)ΟΠΤΙΚΟ ΜΙΚΡΟΣΚΟΠΙΟ

5 ΜΟΝΑΔΕΣ

ΘΕΜΑ Γ

Α. Δίνονται δύο βακτήρια διαφορετικού είδους που το καθένα διαθέτει από ένα πλασμίδιο.

Το βακτήριο (Α) διαθέτει το πλασμίδιο (α) που φέρει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό str και τον παράγοντα μεταφοράς F+, καθώς και το γονίδιο (i)

(P)

Γονίδιο (i)

GAAATGGAATTCTGAAAATTT Υ (P)

CTTTACCTTAAGACTTTTAAA Υ

Το πλασμίδιο (β) που διαθέτει το κύτταρο (B), έχει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό Amp , και το γονίδιο (ii)

Γονίδιο (ii)

                         Υ CCATCATCGAAATGGAATTCTGAAAATTTCCTATT

(P)Y GGTAGTAGCTTTACCTTAAGACTTTTAAAGGATAA

Όπου (P) φωσφορική ομάδα.

Μεταξύ των βακτηρίων (Α) και (Β) πραγματοποιήθηκε βακτηριακή σύζευξη. To βακτήριο δέκτης του πλασμιδίου, δεν μπορεί πλέον ν’ αξιοποιήσει λειτουργικά το προϊόν που κωδικοποιούσε πριν από τη σύζευξη του το γονίδιο του πλασμιδίου του, όμως, παραμένει ανθεκτικό στο αντιβιοτικό στο οποίο διέθετε ανθεκτικότητα, ενώ παράγει και τα προϊόντα που κωδικοποιουνται από το πλασμιδιο που δεχθηκε.

Σημείωση: Τα δύο πλασμίδια δεν ανασυνδυάζονται.

α. Τι γνωρίζεται για τα πλασμίδια; 5 ΜΟΝΑΔΕΣ

β. Ποια είναι η κωδική αλυσίδα του γονιδίου (ii) ; 1 ΜΟΝΑΔΑ

Αιτιολογήστε την απάντηση σας. 7 ΜΟΝΑΔΕΣ

γ. Εξηγήστε για ποιον λόγο το βακτήριο δέκτης, όπως αναφέρεται στην εκφώνηση, δεν μπορεί πλέον να χρησιμοποιεί το προϊόν της μεταγραφής του γονιδίου του. 7 ΜΟΝΑΔΕΣ

Β. Γνωρίζετε ότι η βακτηριακή DNA πολυμεράση κινείται με ταχύτητα 50 νουκλεοτίδια / δευτερόλεπτο. Σε πόσο χρόνο αναμένετε ότι θα ολοκληρωθεί η αντιγραφή του πλασμιδίου του βακτηρίου Α το οποίο έχει μέγεθος 5000 ζεύγη νουκλεοτιδίων;

Αν :

α) Στη θέση έναρξης της αντιγραφής του πλασμιδίου δημιουργείται μια θηλιά που αποτελείται από δύο αμφίδρομες διχάλες, όπου δρουν τέσσερα μόρια DNA πολυμερασών για την επιμήκυνση των νέων κλώνων.

β) Στη θέση έναρξης της αντιγραφής δημιουργείται μία θηλιά με δύο διχάλες αμφίδρομες , όπου δρουν δύο μόρια DNA πολυμερασών για την επιμήκυνση των νέων κλώνων.

3 ΜΟΝΑΔΕΣ

γ) Να αποδώσετε τα δύο σχήματα. 2 ΜΟΝΑΔΕΣ

ΘΕΜΑ Δ

Α. Σ’ ένα κύτταρο εκτελείται η διαδικασία της μετάφρασης, ένα ριβόσωμα φέρει ένα μόριο tRNA που μεταφέρει ένα πεπτίδιο με τριάντα πεπτιδικούς δεσμούς και μόλις μετακινείται κατά μία θέση, ώστε αυτό το tRNA να βρεθεί στην πρώτη θέση του ριβοσώματος. Το ολοκληρωμένο πρόδρομο πολυπεπτίδιο αποτελείται από 100 αμινοξέα. Σε ποια νουκλεοτίδια του μεταφράσιμου τμήματος του mRNA βρίσκεται το παραπάνω ριβόσωμα και σε ποια κωδικόνια ; 6 ΜΟΝΑΔΕΣ

Β. Ένα έμβρυο με καρυότοπο 46 χρωμοσωμάτων διαθέτει 3 χρωμοσώματα 21 και ένα φυλετικό χρωμόσωμα χ.

α) Πόσα μόρια DNA διαθέτει το έμβρυο αυτό στον καρυότοπο του;

β) Πόσους κλώνους DNA διαθέτει το έμβρυο αυτό στην φάση G1 ενός σωματικού κύτταρου του;

γ) Το έμβρυο αυτό πόσα ζεύγη ομόλογων χρωμοσωμάτων διαθέτει;
δ) Το έμβρυο αυτό είναι διπλοειδές άτομο;

ε) Το έμβρυο αυτό έχει πυρηνικό γονιδίωμα όσο και ένα φυσιολογικό κορίτσι; 5ΜΟΝΑΔΕΣ

Γ. Σας δίνεται το θραύσμα ενός μικρού ιικού γονιδίου που κωδικοποιεί για ένα ολιγοπεπτίδιο το οποίο έχει κοπεί με ένα ένζυμο περιορισμού κατά την κατασκευή γονιδιωματικής βιβλιοθήκης .

CTTCCTTGAGAATGGGGCCCTTAATTGGCT

              AACTCTTACCCCGGGAATTAACCGACTTCC

α) Να βρεθεί ο προσανατολισμός της ως προς τη θέση του υποκινητή.

β) Να βρεθεί η αλληλουχία της περιοριστικης ενδονουκλεασης που χρησιμοποιηθηκε κατά την κατασκευή της γονιδιωματικής βιβλιοθήκης αυτού του ιου που διαθέτει το παραπάνω γονίδιο. Το ένζυμο δρα με προσανατολισμό 5′ προς 3′ αναγνωρίζοντας μια αλληλουχία έξι ζευγών νουκλεοτιδιών.

γ) Να γραφεί το μόριο του RNA που θα προκύψει αν υποθέσουμε ότι είναι δυνατό το παραπάνω μόριο να μεταγράφει σε εκχύλισμα μιτοχονδρίων του ανθρώπου, όπως ακριβώς σας δίνεται.

1+2+3 ΜΟΝΑΔΕΣ

Δ. Ένα βακτήριο E. coli έχει μετασχηματιστεί μ’ ένα πλασμίδιο πάνω στο οποίο φέρεται ολόκληρο το φυσιολογικό οπερόνιο της λακτόζης αλλά απουσιάζει το ρυθμιστικό του γονίδιο.

Το βακτήριο αυτό ωστόσο, δεν μπορεί ν’ αναπτυχθεί σε περιβάλλον με μοναδική πηγή C τη λακτόζη.

Εξηγήστε δύο λόγους για τους οποίους είναι δυνατόν να γίνεται αυτό. 8 ΜΟΝΑΔΕΣ

ΚΑΛΗ ΕΠΙΤΥΧΙΑ

Επαναληπτικό Διαγώνισμα Βιολογίας Θετικού Προσανατολισμού κεφαλαίων 1,2,4 &7

Ζήτημα 1.

Α. Επιλέξτε την ορθή απάντηση:

  1. κατά την μεταγραφη των γονιδιων του οπερονιου της λακτοζης δημιουργουνται…………………. mRNA

Α. 1, β. 2, γ. 3, δ.4                                                                     (5 μονάδες)

  1. Από τα ………διαφορετικα κωδικονια , …………κωδικοποιουν αμινοξεα και ………οδηγουν στον τερματισμο της πρωτεινοσυνθεσης.

Α. 180, 20, 4 β. 20, 17, 3 γ. 20, 17, 4, δ. 64, 61, 3                                     (5 μοναδες)

  1. Σωστο – Λαθος:

Α. Για να κατασκευστει μια cDNA βιβλιοθηκη απομονωνεται το ολικο mRNA από κυτταρα που εκφραζουν το γονιδιο που θελουμε να μελετησουμε.

Β. Η μεταβολή του πληθυσμού σε συνάρτηση με τον χρόνο μιας συνεχούς καλλιέργειας φυσιολογικών κυττάρων E.coli, εμφανίζει καμπύλη διαύξησης.

Γ. Στην αντιγραφή του βακτηριακου DNA συμμετέχουν 2 DNA πολυμερασες.

Δ. Ένα φυσιολογικο ανθρωπινο σωματικο κυτταρο εχει στον πυρηνα του 24* 10 9 βασεις κατά την μεταφαση της μιτωσης του.

Ε. κατά την πεψη ενός κυκλικου μοριου DNA από την EcoRI σπαζουν περισσοτεροι φωσφοδιεστερικοι δεσμοι από ότι ενός γραμμικου μοριου DNA.

Δινεται ότι το κάθε μοριο διαθετει 4 θεσεις αναγνωρισης της EcoRI.                (15 μοναδες)

Ζητημα 2

Α. Γιατι τα κυτταρα ενός πολυκυτταρου οργανισμου, παροτι εχουν όλα τα ιδια γονιδια  διαφερουν στην μορφη και την λειτουργια τους; (5 μοναδες)

Β. Ένα διπλοειδες κυτταρο υφισταται μιτωση και στη συνεχεια  τα θυγατρικα κυτταρα υφιστανται μειωση.

Σχεδιαστε ένα κοινο διαγραμμα οπου θα φαινονται οι μεταβολες της ποσοτητας του γενετικου υλικου του ενός κυτταρου σε σχεση με το χρονο. Αιτιολογηστε την απαντηση σας.

Δινεται ότι το γενετικο υλικο του πυρηνα του κυτταρου, κατά την μεταφαση της μιτωσης του, εχει μηκος 4* 10 8 ζευγη βασεων. (10 μοναδες)

Γ. Στο παρακατω σχημα φαινεται η διχαλα αντιγραφης ενός πλασμιδιου. Αφου μεταφερετε το σχημα στο τετραδιο σας, συμπληρωστε τον προσανατολισμο των αλυσιδων στα ακρα της διχαλας, καθως και τον προσανατολισμο της αντιγραφης σε κάθε αλυσιδα. Τελος, να χαρακτηρισετε τον τροπο συνθεσης των νεων αλυσιδων του DNA.

2017 Επαναλληπτικό 1 2 4 7-01

Αιτιολογηστε συντομα την απαντηση σας.  (2+2+2+4 = 10 μοναδες)

Ζητημα 3

Μια συνεχης καλλιεργεια βακτηριων E. coli περιεχει εξαρχης δυο στελεχη βακτηριων. Τα βακτηρια που ανηκουν στο ένα στελεχος διαθετουν ένα πλασμιδιο το οποιο περιεχει ένα γονιδιο ανθεκτηκοτητας στο αντιβιοτικο καναμυκινη. Τα βακτηρια που ανηκουν στο άλλο στελεχος διαθετουν ένα διαφορετικο πλασμιδιο που φερει ένα διαφορετικο γονιδιο ανθεκτικοτητας στην καναμυκινη ( το οποιο κωδικοποιει την ιδια πρωτεινη με το γονιδιο ανθεκτικοτητας του πρωτου πλαδμιδιου), και ένα γονιδιο ανθεκτικοτητας στην πενικιλινη.

Τα βακτηρια  της καλλιεργειας αναπτυσονται σε ζυμωτηρα στον οποιο προσθετουμε την χρονικη στιγμη τ1 χ ποσοτητα καναμυκινης, την στιγμη τ2 y/2 ποσοτητα πενικιλινης και την στιγμη τ3 y ποσοτητα πενικιλινης.

Το ακολουθο διαγραμμα δειχνει τις μεταβολες στον πληθυσμο των μικροοργανισμων σε σχεση με τον χρονο.

2017 Επαναλληπτικό 1 2 4 7-02

Α. Να εξηγησετε γιατι, παροτι και τα δυο στελεχη διαθετουν ένα γονιδιο ανθεκτικοτητας στην καναμυκινη, μετα την προσθηκη του αντιβιοτικου στο θρεπτικο υλικο την χρονικη στιγμη τ1, παρουσιαζεται μερικη μειωση του πληθυσμου των βακτηριων. (5 μοναδες)

Β. Να χαρακτηρισετε κάθε φαση της καλλιεργειας όπως εμφανιζεται στο διαγραμμα και να αιτιολογησετε την απαντηση σας. (5 μοναδες)

Γ. Να εξηγησετε γιατι τα βακτηρια της καλλιεργειας «αντιδρουν» διαφορετικα αναμεσα στις δυο περιπτωσεις προσθηκης πενικιλινης.(5 μοναδες)

Δ. Σε μια νεα δημιουργια της καλλιεργειας, προσθετουμε μικροτερες ποσοτητες καναμυκινης και πενικιλινης σε σχεση με τις αρχικες. Πιστευετε ότι αυτό θα επηρεασει τον ρυθμο αναπτυξης των βακτηριων της καλλιεργειας; Να αιτιολογησετε την απαντηση σας. Σχεδιαστε το νέο πιθανο διαγραμμα του ρυθμου αναπτυξης των βακτηριων συμφωνα με την απαντηση σας. Υποθεστε ότι οι προσθηκες των αντιβιοτικων εγιναν στις ιδιες αντιστοιχες στιγμες όπως φαινονται στο διαγραμμα που σας δοθηκε. (2+3+5=10)

Ζητημα 4

Τρια δειγματα πλασμιδιακου DNA πεπτονται με διαφορες περιοριστικες ενδονουκλεασες και στη συνεχεια αναλυονται σε πηκτωμα αγαροζης. Τα αποτελεσματα είναι αυτά που φαινονται στις εικονες. Γνωριζετε ότι κανενα πλασμιδιο δεν εχει δυο ιδιες θεσεις αναγνωρισης. Επισης είναι γνωστο ότι το πλασμιδιο 1  εχει μηκος 20.000 ζευγη βασεων, το πλασμιδιο 2 εχει μηκος 15.000 ζευγη βασεων  και το πλασμιδιο 3 εχει μηκος 10.000 ζευγη βασεων.

2017 Επαναλληπτικό 1 2 4 7-03

2017 Επαναλληπτικό 1 2 4 7-04

Σημείωση: Στο τρίτο πηκτωμα αγαροζης με την σειρά  που δίνονται στο πρώτο πλασμιδιο η ζώνη στις 10.000 ζεύγη νουκλεοτιδιων είναι διπλάσια σε πάχος από όλες τις υπολοίπων των τεσσάρων πηκτωματων αγαροζης.

Α. Σχεδιαστε τον περιοριστικο χαρτη καθε πλασμιδιου (για το πλασμιδιο 1 αρκει μια εκδοχη). Δεν απαιτηται αιτιολογηση. (6 μοναδες).

Β. Δινεται η αλληλουχια ενός  υποθετικου γονιδιου του πλασμιδιου 2 που κωδικοποιει τη συνθεση μιας πρωτεινης.

Αλυσιδα1. …TCGACGGGTACGCTATGCGCCGTTTTGTAAAAACGAGGACTTTG…

Αλυσιδα 2….ΑGCTGCCCATGCGATACGCGGCAAAACATTTTTGCTCCTGAAAC…

Η υπογραμμιση δηλωνει την 5΄αμεταφραστη περιοχη .

  1. ποια αλυσιδα είναι η κωδικη και ποια η μη κωδικη και σημειωστε τα 5΄και 3΄ακρα της κάθε αλυσιδας. Αιτιολογηστε την απαντηση σας. (μοναδες 5).
  2. Ο υποκινητης του παραπανω γονιδιου αποτελειται από 120 βασεις. Από αυτές, το 15% είναι αδενινες. Να βρειτε τα ποσοστα και τους αριθμους των υπολοιπων. (μοναδες 3).

Γ. Δινεται το ακολουθο γονιδιο το οποιο κωδικοποιει τη συνθεση μιας πρωτεινης του ανθρωπου:

5’ AGCGAATTCGCTCTGCAG…GGATCC…GCTAT…ATG…GAATTC…TAGCTGCAG…GGATCC3’

3’ TCGCTTAAGCGAGACGTC…CCTAGG…CGATA…TAC…CTTAAG…ATCGACGTC…CCTAGG5’

3’ ΑΜΕΤΑΦΡΑΣΤΗ ΑΛΜ

Οπου ΑΛΜ= Αλληλουχιες ληξης της Μεταγραφης. Οι ΑΛΜ βρισκονται στις αλληλουχίες που ακολουθουν αμεσως μετα την 3′ αμεταφραστη περιοχη του δοθεντος γονιδιου. Η αλληλουχία του υποκινητή είναι η υπογραμμισμένη στα αριστερά αλληλουχία του γονιδίου που δίνεται.

Να προσδιορισετε ποια/ποιες περιοριστικη/ες ενδονουκλεαση/ες μπορει/ουν να χρησιμοποιηθει/ουν για την πεψη του γονιδιου, ώστε στη συνεχεια να ενθεθει ακεραιο σε καποιο από τα πλασμιδια του προηγούμενου ερωτήματος και να μπορει να εκφραζεται επιτυχως. Να αιτιολογηθει η απαντηση σας.

Δ. Να προσδιορισετε ποιο/α πλασμιδιο/α θα μπορουσε/αν να χρησιμοποιηθει/ουν ως φορεας/εις κλωνοποιησης για το γονιδιο του προηγουμενου ερωτηματος, με βαση την απαντηση σας στο προηγουμενο ερωτημα. Να εξηγησετε επισης ποιες άλλες προυποθεσεις θα πρεπει να πληροι/ουν αυτό/α το/τα πλασμιδιο/α ώστε να μπορει να χρησιμοποιηθει επιτυχως ως φορεας κλωνοποιησης.

(μοναδες 2+4=6)

Δίνονται:

Θέση αναγνώρισης της PstI……………… Θέση αναγνώρισης της BamHI

5’ CTGCAG3’…………………………………………………………5’GGATCC3’

3’ GACGTC5’ …………………………………………………………3’CCTAGG5’

 

Δημιουργημένο απο την α’ φοιτήτρια της Ιατρικής Κωνσταντίνα Ραουζαίου

Διαγώνισμα Κεφάλαιο 6 Μεταλλάξεις Βιολογία Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

 Επιλέξτε την ορθή απάντηση:

  1. Πόσα αντίγραφα του γονίδιου των αλυσίδων δ διαθέτουμε φυσιολογικά στα χρωμοσώματα μας, σε ένα ευθροκύτταρο μας, που κυκλοφορεί στο αίμα μας:

α. 2 β. 4   γ. 6  δ. 12  ε.0

  1. Ένα ενήλικο ετερόζυγο άτομο με γονότυπο ββς έχει τις εξής αιμοσφαιρίνες:

α. HbA, HbS, HbF, HbA2

β. HbA, HbS, HbF, HbA2 και μπορει και HbAS

γ. HbA, HbS

δ. HbS, HbF

ε. HbA, HbS, HbA2

  1. Έμβρυο 18 εβδομάδων με γονότυπο ββς διαθέτει τις εξής πολυπεπτιδικές αλυσίδες για τις αιμοσφαιρίνες του.

α. α,β,γ,βς

β. α,γ,δ

γ. α,γ

δ. α,β,δ

ε. β,δ,γ

  1. Ένα άτομο με σύνδρομο Klinefelter, διαθέτει:

α. Φυσιολογικό πλήθος αλληλομόρφων γονίδιων.

β. Διπλάσιο πλήθος όλων των γονίδιων που εδράζουν στα φυλετικά χρωμοσώματα

γ. Δυο αντίγραφα για κάθε αυτοσωμικό γονίδιο, δυο αντίγραφα για το γονίδιο της αιμοροφίλιας και τρία αντίγραφα για κάθε γονίδιο που εδράζεται στην ομόλογη περιοχή των φυλετικών χρωμοσωμάτων.

δ. Τέσσερα γονίδια α, δυο γονίδια β, δυο γονίδια γ, δυο γονίδια δ στην φάση G1 του κυτταρικού κύκλου.

ε. Υψηλά επίπεδα HbF εάν έχει γονότυπο ομόζυγο για το γονίδιο βς και εμφανίζει ανθεκτικότητα στην προσβολή από το πλασμώδιο.

  1. Άτομο με γονότυπο ααααββςγγδδ, διαθέτει:

α. HbA 100%

β. HbS 100%

γ. ΗbS & HbA σε αναλογία 1:1

δ. Σε συνθήκες έλλειψης οξυγόνου όλα τα κύτταρα των ερυθρών αιμοσφαιρίων δρεπανώνονται.

ε. Οι δυο νόμοι του Μέντελ, ισχύουν για το σύνολο των αναφερόμενων γονίδιων.

Ζήτημα 2ο                                                                                   Μονάδες 25

  1. Μια γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που πραγματοποιήθηκε διαπιστώθηκε ότι διαθέτει 45 χρωμοσώματα καθώς απουσίαζε ένα φυλετικό χρωμόσωμα και διέθετε μόνο ένα Χ φυλετικό, ενώ εμφανίζει και φαινοτυπικά χαρακτηριστικά συνδρόμου Down.

α. Τι είδους μεταλλάξεις φέρει το έμβρυο; (2)

β. Ποιος από τους δυο γονείς μπορεί να ευθύνεται για το σύνδρομο τις μονοσωμίας; Με ποιο τρόπο μπορεί να προέκυψε ο μεταλλαγμένος γαμέτης; (1 + 5)

γ. Το έμβρυο εμφανίζει μειωμένα επίπεδα αιμοσφαιρινών. Δώστε μια πιθανή εξήγηση για την εμφάνιση του φαινομένου Down και των μειωμένων επιπέδων των αιμοσφαιρινών  στο έμβρυο. (7)

2. Ποιες μεταλλάξεις χαρακτηρίζονται ως διπλασιασμός; Αναφέρετε τρία παραδείγματα γονίδιων που ο διπλασιασμός αποτέλεσε στην μια περίπτωση θετικής μετάλλαξης και στις άλλες περιπτώσεις αρνητική μετάλλαξη. (2+3)

  1. Συγκρίνετε τους μηχανισμούς προστασίας από τις μεταλλάξεις μεταξύ των προκαρυωτικών και των ευκαρυωτικών κυττάρων. (5)

Ζήτημα 3ο                                                                                                                  Μονάδες 25

  1. Δίνεται η παρακάτω μεταλλαγμένη αλληλουχία της κωδικής αλυσίδας του γονιδίου β, των αλυσίδων β των αιμοσφαιρινών μας (αλληλόμορφο Const. Christine). Στην αλληλουχία των 95 νουκλεοτιδίων που δίνεται δεν εμφανίζεται κωδικόνιο λήξης, ούτε κάποιο εσώνιο.

GGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTGTTGGG…95 ΝΟΥΚΛΕΟΤΙΔΙΑ…ΑTGTTTAGTGATGGCCTGGCTGATCACCTGGA 3′

α. Σύμφωνα με τον γενετικό κώδικα, ποιο κωδικόνιο και ποιο αμινοξύ βρίσκεται και κωδικοποιείται  αντιστοίχως, ακριβώς μπροστά από τα 95 νουκλοτιδια; (3)

β. Προσδιορίστε την θέση του υποκινητή του μεταλλαγμένου γονιδίου β. (1) και γράψτε στο τετράδιο σας τις αλληλουχίες του γονιδίου που είναι εξονικες, αλλά δεν συνδέεται μαζί τους το ριβοσωμα. (2).

γ. Αυτό το μεταλλαγμένο αλληλόμορφο, φέρει μια σημειακή μετάλλαξη αντικατάστασης βάσης, σε σχέση με το αλληλόμορφο βς. Ποια είναι αυτή η αλλαγή; Ποιο αμινοξύ κωδικοποιείται ; (3)

δ. Προσδιορίστε το αμινοξύ που κωδικοποιείται από το κωδικόνιο που ακολουθεί την αλληλουχία των 95 νουκλεοτιδίων. (3)

2.

α. Σε ένα άτομο εληφθησαν δείγματα μυϊκού ιστού και πραγματοποιήθηκε καρυότυπος. Τα αποτελέσματα έδειξαν τρεις διαφορετικούς καρυοτύπους, σε τρία διαφορετικά κύτταρα του.

α. ΧΟ+44  β. ΧΥ+44    γ. ΧΥΥY+44.

Εξηγήστε πως είναι δυνατόν να υπάρξει τέτοιο άτομο. (7)

β. Σε ένα άτομο με γονότυπο βςβς, επιχειρήθηκε η ένθεση, με την βοήθεια κατάλληλου ιού φορέα, του φυσιολογικού γονιδίου β, στο γονιδίωμα των αιμοποιητικων κυττάρων του. Ποιος θα είναι ο φαινότυπος του ατόμου αυτού,

 

ως προς την δρεπανοκυτταρικη αναιμία, μετά την ένθεση του φυσιολογικού γονιδίου β, στο γονιδίωμα των αιμοποιητικων κυττάρων του (2); Αιτιολογήστε την απάντηση σας. (4)

 

 

Ζήτημα 4ο                                  Μονάδες 25

 

Α. Δίνεται το παρακάτω γενεαλογικό δένδρο:

2017 Κεφάλαιο 6 Μεταλλάξεις blog-01

 

Το ζευγάρι ΙΙΙ1 x ΙΙΙ2 απέκτησε τρία παιδία, τα οποία: Το πρώτο εμφανίζει ελαφριάς μορφής αναιμίας, το δεύτερο παιδί βαριά μορφή β-θαλασσαιμία και μικρό ποσοστό δρεπανοκυττάρων κατά τη δοκιμασία δρεπάνωσης, ενώ εμφανίζει και υψηλή συγκέντρωση HbF και τέλος το τρίτο παιδί  εμφάνισε στους πρώτους μήνες της ζωής του πολύ βαριά μορφής αναιμία, ενώ στις κυτταρολογικές εξετάσεις εμφανίστηκαν πολύ υψηλού επιπέδου ποσοστά δρεπανοκυττάρων.

Έγιναν μοριακές εξετάσεις τόσο για την β-θαλασσαιμία όσο και για την δρεπανοκυτταρική αναιμία. Τα αποτελέσματα φαίνονται στα παρακάτω πηκτώματα αγαρόζης.

Η απόσταση της θέσης  περιορισμού NhdI από την θέση περιορισμού MstII, είναι 20 ζεύγη βάσεων το οποίο δεν αποδίδεται στο σχήμα.

2017 Κεφάλαιο 6 Μεταλλάξεις blog-02

 

Οι μοριακές εξετάσεις έγιναν για το γονίδιο της δρεπανοκκυτταρικής αναιμίας. Χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση MstII, η οποία κόβει το παθολογικό αλληλόμορφο.

Για την β θαλασσαιμία χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση  NhdI, η οποία πέπτει το φυσιολογικό αλληλόμορφο εντός της 5’ αμετάφραστης περιοχής του γονίδιου και αφήνει ανέπαφο το παθολογικό αλληλόμορφο. Η επιλογή της NhdI, έγινε δεδομένου ότι το άτομο ΙΙ1 έπασχε από πολύ βαριά μορφή β-θαλασσαιμίας και είχαν ελεγχθεί σε προγενέστερο μοριακό έλεγχο, τα υπεύθυνα  γονίδια του. Κανένα άτομο της γενεαλογίας δεν εμφάνισε α-θαλασσαιμία.

1. Με βάση τα αποτελέσματα του μοριακού έλεγχου προσδιορίστε τους γονότυπους των ατόμων του δένδρου που ελέγχθηκαν με μοριακές εξετάσεις ως προς την HbA. (5)

  1. Προσδιορίστε την πιθανότητα εμφάνισης που είχε το άτομο IV2. (3)

3. Εξηγήστε πως μπορεί να προέκυψε το άτομο IV3, τι είδους μεταλλάξεις συνέβησαν.(4)

4. Προσδιορίστε τον γονότυπο των ατόμων ΙΙΙ1 και ΙΙΙ2 ως προς τα γονίδια των αιμοσφαιρίνων  HbA2, HbF. Γνωρίζετε ότι το άτομο IV1 εμφανίζει ελαφριά μορφή αναιμίας, παρόλο που είναι ετερόζυγο, επειδή σε περαιτέρω βιοχημικές αναλύσεις διαπιστώθηκε ότι δεν ανιχνεύεται HbA2. (2)

5. Ποιο θα είναι το πρότυπο των ζωνών του γονίδιου βς στο πήκτωμα αγαρόζης, όταν αυτό πέπτεται ταυτοχρόνως με τις περιοριστικές ενδονουκλεάσες MstII & NhdI ;(3)

6. Γνωρίζουμε ότι τα ώριμα ερυθρά αιμοσφαίρια δεν διαθέτουν πυρήνα, διαθέτουν όμως ριβοσωμάτα. Είναι τα ώριμα ερυθρά αιμοσφαίρια ζωντανά κύτταρα; (3)

Β. Παρακάτω δίνεται τμήμα του 1ου εξωνίου του γονιδίου για τη β-αλυσίδα της αιμοσφαιρίνης HbA. Κάθε τμήμα προέρχεται από διαφορετικό αλληλόμορφο.

Γονίδιο βi

AGGCTTATGGTGCACCTTACGCCAGAGGAG

TCCGAATTACCACGTGGAATGCGGTCTCCTC

Γονίδιο βii

AGGCTTATGGTGCACCTTACGCCAGTGGAG

TCCGAATACCACGTGGAATGCGGTCACCTC

Γονίδιο βiii

AGGCTTATGGTGCACCTTACGCCAGTAGGAG

TCCGAATACCACGTGGAATGCGGTCATCCTC

Γονίδιο βiv

AGGCTTATCGGTGCACCTTACGCCAGAGGAG

TCCGAATAGCCACGTGGAATGCGGTCTCCTC

Να βρεθεί το είδος της γονιδιακής μετάλλαξης για τα  παθολογικά αλληλόμορφα γονίδια.

Ποιό είναι το γονίδιο βς ; (4+1)

Πρoστατευμένο: Διαγώνισμα κεφαλαίου 7 Βιολογίας Θετικού Προσανατολισμού

Αυτό το περιεχόμενο είναι προστατευμένο με συνθηματικό. Για να το δείτε εισάγετε το συνθηματικό σας παρακάτω:

Διαγώνισμα βιολογίας θετικού προσανατολισμού. Κεφάλαια: 1-2-4-7

Ζήτημα 1.                                                                                                   Μονάδες 25

  1. Δίνεται το παρακάτω σχήμα που αναπαριστά ένα χρωμόσωμα.

 

Επαναληπτικό 1-2-4-7-01

Το τμήμα Α θέλουμε να κλωνοποιηθεί in vitro.  Η αντιγραφή τελειώνει κάθε φορά στο τέλος του μητρικού κλώνου που λειτουργεί ως καλούπι.

Μετά από πόσους κύκλους αντιγραφής θα υπάρχει στον δοκιμαστικό σωλήνα για πρώτη φορά το επιθυμητό τμήμα Α.

α. Νo x 2κ

β. 2κ

γ. κ

δ.2

ε. 3

  1. Το τμήμα Α αποτελεί γονίδιο. Το προϊόν της μεταγραφής διαθέτει 70% πουρίνες, από αυτές το 30% δημιουργεί δυο δεσμούς υδρογόνου σε δίκλωνο μόριο. Γνωρίζετε ακόμη ότι η πουρίνη που σχηματίζει δυο δεσμούς υδρογόνου και συμμετέχει στο μεταγράψιμο τμήμα, του γονιδίου Α στην μη κωδική αλυσίδα, αποτελεί το 20% του κλώνου αυτού, στο γονίδιο Α.

Ο λόγος A+T/G+C του γονιδίου Α είναι (στον μη κωδικό κλώνο) στο τμήμα που αντιπροσωπεύεται στο προϊόν της μεταγραφής, μετά την ολοκλήρωση της διαδικασίας.

α. περίπου 7/3

β.1

γ. περίπου ½

δ. περίπου 2/3

ε. Δεν υπολογίζεται

  1. Για την μεταγραφή αυτού του γονιδίου απαιτήθηκε να ξετυλιχθούν 14 νουκλεοσώματα, στα οποία συμπεριλαμβάνονται και εκείνα στα σημεία Μ και Ν, που φαίνονται στην εικόνα 1. Το μήκος του RNA που παράχθηκε αποτελείται από 2746 νουκλεοτίδια. Το χρωμόσωμα έχει μήκος 2 χ 106 ζ.β. και ξεκινάει και τελειώνει με νουκλεόσωμα.  Ποιο είναι το πλήθος των ιστόνων που απαιτούνται για το πακετάρισμα του;

α.  περίπου 2 χ 104

β. περίπου 16 χ 104

γ. περίπου 8 χ 104

δ. 32 χ 104

ε. περίπου 106

  1. Το μεταφράσιμο τμήμα του γονιδίου Α αποτελείται από 600 κωδικόνια. Η 5’ αμετάφραστη περιοχή του, προκαλεί τη δημιουργία συμπλόκου έναρξης με τέτοιο ρυθμό ώστε το αμέσως προηγούμενο ριβόσωμα να έχει ήδη μεταφράσει 10 κωδικόνια μέχρι να συνδεθεί το επόμενο μόριο tRNA σε αυτό . Πόσα   πλήρη ριβοσώματα θα αποτελούν το πολύσωμα του mRNA του γονιδίου Α όταν το πρώτο ριβόσωμα έχει ολοκληρώσει την πολυπεπτιδική αλυσίδα;

α. 60

β.65

γ. 66

δ. 59

ε. 66,6

  1. Η θέση Ε που φαίνεται στο σχήμα έχει την αλληλουχία:

5’ ——————–GGAATTCC——————-3’

3’———————CCTTAAGG——————5’

Α. Υπάρχει η περιοριστική ενδονουλεάση MdI, η οποία αναγνωρίζει την παραπάνω αλληλουχία οκτώ νουκλεοτιδίων και πέμπτει τους φωσφοδιεστερικούς δεσμούς 5’-G-G-3’ καθώς και τους 14 δεσμούς υδρογόνου μεταξύ των παρεμβαλλόμενων ζευγών βάσεων. Πάσα διαφορετικά τμήματα που περιέχουν το γονίδιο Α προκύπτουν μετά την πέψη του χρωμοσώματος με τα ένζυμα EcoRI και MdI, ταυτόχρονα;

α. 1

β.2

γ. 3

δ. 4

ε. Κανένα.

Β. Το διπλανό πλασμίδιο χρησιμοποιήθηκε ως φορέας κλωνοποίησης του τμήματος Α. Πόσα διαφορετικά ανασυνδυασμένα πλασμίδια μπορούν να προκύψουν;

Δίνεται ο φορέας κλωνοποίησης  που θα χρησιμοποιηθεί.

Επαναληπτικό 1-2-4-7-02

 

α. 1

β. 2

γ. 3

δ.4

ε. Κανένα.

Ζήτημα 2.                                                                                           Μονάδες 25

  1. Να αναφέρετε τους λόγους για τους οποίους το βακτήριο Ε. coli χρησιμοποιείται ως οργανισμός μοντέλο της Μοριακής Βιολογίας. (μόρια 4)
  2. Εξηγήστε για ποιο λόγο προσθέτουμε αζωτούχες και φωσφορικές ενώσεις στις πετρελαιοκηλίδες που πρόκειται να «καθαριστούν» με την δράση μικροοργανισμών οι οποίοι μεταβολίζουν το πετρέλαιο.  (μόρια 5)
  3. Κατατάξτε τα γονίδια των οργανισμών ως προς τη θέση τους στο κύτταρο και ως προς τη θέση του γενετικού τους τόπου. (μόρια 5)
  4. Στην εικόνα 1 φαίνεται ένα μέρος μιας βιολογικής διαδικασίας που βρίσκεται σε εξέλιξη.

CUCUUTCT

GAGAAACATGCATACGAC                    Εικόνα 1

α. Να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας.               (μόρια 2)

β. Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1. (μόρια 3)

γ. Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού.              (μόρια 1)

  1. Τα παρακάτω βήματα περιγράφουν μια εργαστηριακή καλλιέργεια μικροοργανισμών. Να τοποθετήσετε τα βήματα στη σωστή σειρά, γράφοντας μόνο τον αντίστοιχο αριθμό. α.προετοιμασία κατάλληλων θρεπτικών υλικών β. εμβολιασμός μικρής ποσότητας του μικροοργανισμού γ. απομόνωση οργανισμού στο εργαστήριο δ. ανάπτυξη καλλιέργειας σε κατάλληλες συνθήκες ε. αποστείρωση θρεπτικών υλικών και μέσων.           (μόρια 5)

Ζήτημα 3.                                                                                                    Μονάδες 25

  1. Δίνονται τα παρακάτω τρία σχήματα, δυο από αυτά αφορούν ακριβώς το ίδιο τμήμα ενός κλώνου ενός μορίου DNA σε διαφορετικές χρονικές στιγμές του κυτταρικού κύκλου ενός ευκαρυωτικού κυττάρου, στο οποίο ανήκει αυτός ο κλώνος DNA. Το τρίτο σχήμα αφορά την ίδια ακριβώς διαδικασία με μια από τις δυο διαδικασίες in vivo που δίνονται. Η διαδικασία που παριστάνεται στο τρίτο σχήμα πραγματοποιείται in vitro.

 

Επαναληπτικό 1-2-4-7-03

Α. Ποιες διαδικασίες αφορούν τα σχήματα 1, 2 και 3;

Β. Να ονομάσετε τις πρωτεΐνες α,β,γ,δ και ε.

Γ. Ποια είναι η λειτουργία του σημείου 1 στο μόριο του DNA;

Ποιες διαφορές γνωρίζετε μεταξύ των σημείων 1 στο μόριο του DNA ανάμεσα στους προκαρυωτικούς και τους ευκαρυωτικούς οργανισμούς;

Υπάρχουν διαφορές μεταξύ των δυο κατηγοριών οργανισμών που αναφέρθηκαν και για τις πρωτεΐνες α, που αναγνωρίζουν τα σημεία όπως το 1;

Δ. Τι είδους βιολογικά μακρομόρια είναι οι κλώνοι ι και ιι καθώς και ιιι;

Ποια δομική διαφορά εντοπίζεται μεταξύ των κλώνων ι και ιιι;

Ε. Ποιες πρωτεΐνες έδρασαν και ποιες πρόκειται να δράσουν ακόμη εκατέρωθεν του σημείου 2;

ΣΤ. πόσες πρωτεΐνες έδρασαν στο σημείο 3; Ονομάστε τις πρωτεΐνες αυτές.

Ζ. Ποιες από τις πρωτεΐνες που εμφανίζονται στα σχήματα εκτελούν εργασίες που έχουν το ίδιο τελικό αποτέλεσμα;

Η. Σε ποιο από τα τρία σχήματα γνωρίζετε ότι ένα προκαρυωτικό ένζυμο  «διαβάζει» ευκαρυωτικό γενετικό υλικό;

Θ. Ποια από τις διαδικασίες που φαίνονται στα σχήματα εκτελείται μια φορά στο δεδομένο τμήμα DNA, στην ζωή του κυττάρου;

Ι. Εξηγήστε τις πρακτικές εφαρμογές που βρίσκει η διαδικασία η οποία εκτελείται in vitro.                                                                                         (μόρια 1.5, 1.5, 1, 2, 2, 1, 2, 1, 1, 1)

  1. Σε ένα εργαστήριο Μοριακής Βιολογίας, επαναλήφθηκαν τα πειράματα που απέδειξαν τον μετασχηματισμό των προκαρυωτικών κυττάρων.

Οι οργανισμοί μελετήθηκαν με σύγχρονα μέσα και τεχνικές που μας παρέχει η τεχνολογία του ανασυνδυασμένου DNA.

Οι επιστήμονες δημιούργησαν την γονιδιωματική βιβλιοθήκη των δυο στελεχών του βακτηρίου D. pneumoniae και απομόνωσαν το γονίδιο που κωδικοποιεί για την πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος στα λεία στελέχη.

Στην συνέχεια με τεχνικές Γενετικής Μηχανικής μετασχημάτισαν ένα πληθυσμό από αδρά στελέχη του βακτηρίου. Από τον πληθυσμό που μετασχηματίστηκε και τον αρχικό πληθυσμό των λείων βακτηρίων, λήφθηκε δείγμα κυττάρων, στο οποίο πραγματοποιήθηκε PCR για την ενίσχυση του γονιδίου που ελέγχει για το κάλυμμα, από το γονιδίωμα των βακτηρίων. Τα αποτελέσματα αναλύθηκαν και πήραμε τα εξής:

Επαναληπτικό 1-2-4-7-04

 

Α. Ποιο από τα βακτηρία που αναλύθηκαν είναι το αδρό , ποιο το λείο και ποιο το μετασχηματισμένο αδρό σε λείο;                                                                         (μόρια 1,5)

Β. Δίνεται ο ένας από τους δύο κλώνους του γονιδίου που ενισχύθηκε και δυο μόρια tRNA που μετείχαν στην μετάφραση του.

5′ …TCAATTAGTGTACCCTTTATGATCACCTGGGTACATTGATTAGAT…3′

3′ UUA5′ και 5′ GUA 3′  τα αντικωδικόνια των δυο μορίων tRNA .

Ο κλώνος που δίνεται είναι ο κωδικός ή ο μη κωδικός του γονιδίου;

Αιτιολογήστε την απάντηση σας.                                                                           (μόρια 1 και 1,5)

Γ. Γνωρίζετε ότι μεταξύ της αλληλουχίας αναγνώρισης του mRNA από την μικρή ριβοσωμική υπομονάδα και του κωδικονίου έναρξης υπάρχουν τέσσερα νουκλεοτίδια της 5′ αμετάφραστης περιοχής. Ποια θα είναι η αλληλουχία της κωδικής αλυσίδας του γονιδίου rRNA που θα συνδέεται με το μόριο mRNA το οποίο θα προκύπτει κατά την μεταγραφή του δοθέντος γονιδίου;                                                                                                                  (μόρια 1)

Δ. Τα αδρά στελέχη του D. pneumoniae,  που χρησιμοποιήθηκαν για να μετασχηματιστούν δεν διαθέτουν πλασμίδια και είναι ανθεκτικά στο αντιβιοτικό τετρακυκλίνη (tet). Οι ερευνητές είχαν στην διάθεσή τους, τους παρακάτω φορείς κλωνοποίησης.

Ποιον  μπορούν επιλέξουν για να επιτύχουν τον μετασχηματισμό;

Αιτιολογείστε την απάντηση σας.                                                                            (μόρια 1 και 2,5)

 

Επαναληπτικό 1-2-4-7-05

Όπου: Polilynker: Πολλές, διαδοχικές, αλληλεπικαλυπτόμενες, μοναδικές θέσεις αναγνώρισης περιοριστικών ενδονουκλεασών. Τουλάχιστον μια από αυτές είναι κατάλληλη για την ένθεση του επιθυμητού γονιδίου.

Ε. Τα ανασυνδυασμένα βακτήρια καλλιεργήθηκαν στο εργαστήριο και πήραμε τις παρακάτω καμπύλες: Βιομάζα = f(t) και Πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος = f(t).

Επαναληπτικό 1-2-4-7-06

 

Γνωρίζουμε ότι το γονίδιο του λείου πνευμονιόκοκκου που ανασυνδυάστηκε, διαθέτει μια θέση περιορισμού NdeI, εντός του μεταφράσιμου τμήματος του. Μια καλλιέργεια,  όπως η παραπάνω (διάγραμμα 2), παρουσίασε την εξής εικόνα ως προς την παραγωγή της ετερόλογης πρωτεΐνης από τα μετασχηματισμένα αδρά στελέχη.

Μέτα από την απομόνωση των κυττάρων της καλλιέργειας και στη συνέχεια την απομόνωση των γονιδίων από τους πλασμιδιακούς φορείς κλωνοποίησης και στην  περαιτέρω πορεία πέψης του γονιδίου που ευθύνεται για το κάλυμμα των λείων στελεχών του πνευμονιόκοκκου από την NdeI, έδειξε ότι τα μισά γονίδια μπορούσαν να κοπούν και τα άλλα μισά όχι. Εξηγήστε σύντομα το φαινόμενο. Είναι γνωστό ότι  η καλλιέργεια δεν εκτέθηκε σε κανέναν  εξωγενή μεταλλαξιγόνο παράγοντα και  θεωρούμε ότι σε κάθε κύτταρο ξενιστή εισέρχεται μόνο ένα πλασμίδιο φορέας κλωνοποίησης, το οποίο αντιγράφεται μόνο μια φορά εντός του ξενιστή του.                                                    (μόρια 2,5)

Ζήτημα 4ο                                                                                                   Μονάδες 25

  1. Ένα στέλεχος E. coli, μετασχηματίζεται με το γονίδιο που ευθύνεται για το κάλυμμα (κάψα) του λείου στελέχους του πνευμονόκοκκου. Για τον μετασχηματισμό χρησιμοποιήθηκαν τρεις διαφορετικοί φορείς κλωνοποίησης, όπως φαίνονται παρακάτω και δημιουργηθηκαν τρεις διαφορετικες υγρες καλλιεργειες των μετασχηματισμενων κυτταρων που η καθεμιά έχει μετασχηματιστεί με διαφορετικό  φορέα κλωνοποίησης. Οι καλλιέργειες αναπτύσσονται αρχικά σε γλυκόζη και μετά την εξάντληση της, η αύξηση της κάθε καλλιέργειας συνεχίζεται με λακτόζη. Σε ποια χρονική στιγμή αναμένεται να εκφράζεται η ετερόλογη πρωτεΐνη σε καθεμιά από τις τρεις καλλιέργειες;

Επαναληπτικό 1-2-4-7-08

2.

Επαναληπτικό 1-2-4-7-07

2. Δίνονται οι παραπάνω καμπύλες α, β, γ που αφορούν τρεις διαφορετικές υγρές καλλιέργειες. Ποια από αυτές αντιστοιχεί στην αύξηση της καλλιέργειας E. coli, σε υγρό θρεπτικό υλικό με πηγή άνθρακα  λακτόζη, ποια με γλυκόζη και ποια με γαλακτόζη. Γνωρίζεται ότι σε κάθε μια από τις καλλιέργειες η πηγή άνθρακα βρίσκεται σε ίσες συγκεντρώσεις  με τις υπόλοιπες καλλιέργειες που εξετάζονται;

Δίνεται ακόμη ότι το βακτήριο E. coli, μπορεί να προσλάβει και να μεταβολίσει την γαλακτόζη. Η γαλακτόζη εντός του κυττάρου μετατρέπεται μετά από τρία μεταβολικά βήματα σε 6-φωσφόρο-γλυκόζη που αποτελεί το προϊόν και του πρώτου μεταβολικού βήματος της καταβολικής οδού διάσπασης της γλυκόζης στο κύτταρο.

 

 

 

Διαγώνισμα Κεφάλαιο 5 – Μενδελική Κληρονομικότητα

Ζήτημα 1ο                                                                                                μονάδες 25

Α.

  1. Στην περίπτωση του φυτού Anthirrium sp.

Α. Δεν ισχύει ο νόμος του διαχωρισμού των αλληλομόρφων για τον χαρακτήρα χρώμα άνθους.

Β. Τα ετερόζυγα άτομα εμφανίζουν φαινότυπο στον οποίο εκφράζονται ταυτόχρονα και τα δύο αλληλόμορφα του γονίδιου που ελέγχει το χρώμα του άνθους.

Γ. Άτομα με διαφορετικό φαινότυπο ως προς τον χαρακτήρα χρώμα άνθους έχουν και διαφορετικό γονότυπο πάντα.

Δ. Φυσιολογικά άτομα με διαφορετικό φαινότυπο για το χρώμα του άνθους δεν αποκλείεται να έχουν ίδιο γονότυπο.

 

  1. Από την διασταύρωση δυο φυτών του ιδίου είδους και αγνώστου φαινοτύπου προέκυψαν στην πρώτη θυγατρική γενεά:

9[ιώδη] : 4 [μπλε] : 3 [κόκκινα]

Το χρώμα αυτών των φυτών ελέγχεται:

Α. Μονογονιδιακά από δυο αλληλόμορφα

Β. Μονογονιδιακά από τρία αλληλόμορφα

Γ. Απο τρία ανεξάρτητα γονίδια με δυο αλληλόμορφα το καθένα

Δ. Απο δυο ανεξάρτητα γονίδια με δυο αλληλόμορφα το καθένα.

  1. Σε μια αυτοσωμική επικρατή νόσο που ελέγχεται μονογονιδιακά:

Α. Το υπολειπόμενο αλληλόμορφο αποκλείεται να εκφράζεται

Β. Το ετερόζυγο άτομο δεν εμφανίζει τη νόσο

Γ. Το αλληλόμορφο που επικρατεί ως προς την έκφραση , επικρατεί πάντα και φαινοτυπικώς

Δ. Το αλληλομόρφο που δεν εκφράζεται δεν αποκλείεται να επικρατεί και φαινοτυπικώς.

  1. Ένα γονίδιο με πέντε διαφορετικά αλληλόμορφα με σχέση πλήρους επικράτειας υποτέλειας διαδοχικά μεταξύ τους δημιουργεί

Α. 15 διαφορετικούς γονοτύπους

Β. 10 διαφορετικούς ετερόζυγους γονοτύπους

Γ. 20 διαφορετικούς φαινοτύπους

Δ. Τα δυο πρώτα είναι σωστά

  1. Στο γενεαλογικό δένδρο που φαίνεται παρακάτω εξετάζονται οι ασθένειες της αιμορροφιλίας και της β-θαλασσαιμίας.

Δεδομένου ότι όλα τα άτομα της γενεάς Ι είναι ετερόζυγα, να υπολογιστεί η πιθανότητα το άτομο ΙΙΙ1 να είναι υγιές.

Α. ½

Β. 2/3

Γ. ¼

Δ. 1/16

Διαγ 5 blog-05

 

Σημείωση: Το άτομο ΙΙ1 νοσεί από β θαλασσαιμία και το άτομο ΙΙ2 από αιμορροφιλία.                                                                                              (15)

 

Β.   Τις παρακάτω ερωτήσεις χαρακτηρίστε τις ως σωστές ή λανθασμένες:                                                                                                                 (10)

  1. Η αιμοσφαιρίνη είναι πολυγονιδιακός χαρακτήρας.
  2. Στην μελέτη του διυβριδισμού οι χαρακτήρες που μελέτησε ο Mendel δεν εμφάνιζαν επιχιασμό.
  3. Σε ένα αρσενικό άτομο οι νόμοι του Mendel ισχύουν για όλα τα γονίδια που βρίσκονται στον πυρήνα των σωματικών τους κυττάρων.
  4. Τα φυτά προϊόντα της αυτογονιμοποίησης εμφανίζουν ποικιλότητα στις πρώτες γενεές και βαθμιαία σε βάθος γενεών τείνουν σε ομοιομορφία.
  5. Ο τρόπος κληρονόμισης των μονογονιδιακών χαρακτήρων προσδιορίζεται από τον φαινότυπο των ετερόζυγων ατόμων πάντα.

Ζήτημα 2ο                                                                       μονάδες 25

 

  1. Εξηγήστε για ποιο λόγο η πιθανότητα να προκύψει είτε αγόρι είτε κορίτσι είναι ίση με ½. Και κάθε κύηση είναι ανεξάρτητο γεγονός που δεν επηρεάζεται από τα αποτελέσματα των προηγουμένων κυήσεων.; (8)

 

  1. Ένας τράγος διασταυρώθηκε με 64 κατσίκες. 24 από τις κατσίκες αυτές γέννησαν και νεκρούς απογόνους ενώ κάθε κατσίκα απέκτησε συνολικά 3 κατσικάκια. Υπολογίστε πόσες ακόμη κατσίκες από τις 64 που διασταυρωθήκαν με αυτόν τον τράγο είναι ετερόζυγες ως προς το θνησιγόνο αλληλόμορφο, αλλά δεν εντοπιστήκαν καθώς γέννησαν τρία υγιή κατσικάκια η καθεμιά.                                                                                                              (7)

 

  1. Γνωρίζοντας ότι υπάρχουν τέσσερα πολλαπλά αλληλόμορφα για το χρώμα του τριχώματος στα ποντίκια. Με σχέση πλήρους επικράτειας – υποτέλειας μεταξύ τους, πόσες διαφορετικές πιθανές διασταυρώσεις γονοτύπων  μπορούν να γίνουν,  αν το άτομο με τον πλέον επικρατή φαινότυπο  διασταυρώνεται με το άτομο με τον αμέσως  επόμενο κατά σειρά κυριαρχίας φαινότυπο και αποκτούν απογόνους, με φαινοτύπους όμοιους με τους γονείς τους  σε ίσες αναλογίες.                                                                       (10)

 

 

 

Ζήτημα 3ο                                                                        μονάδες 25                                                                                                                                                     

 

  1. Δίνεται το παρακάτω γενεαλογικό δένδρο που αφορά ένα αυτοσωμικό υπολειπόμενο γνώρισμα. Δεχόμενοι ότι όλα τα εισερχόμενα στην γενεαλογία άτομα είναι ετερόζυγα καθώς και τα άτομα της γενεάς Ι, βρείτε την πιθανότητα το άτομο V1 να εμφανίζει το γνώρισμα. (8)

Διαγ 5 blog-02

2. Το φυσιολογικό αλληλόμορφο του γονίδιου για την αιμορροφιλία πέμπεται σε δυο ισομεγέθη τμήματα, υπό την επίδραση της EcoRI

Ένα ζευγάρι έχει αποκτήσει δυο αγόρια και δυο κορίτσια. Το πήκτωμα της αγαρόζης των τεσσάρων παιδιών έδωσε την ακόλουθη εικόνα:

Διαγ 5 blog-03

 

Σημείωση: Όπου jβ, είναι Ζεύγη Βάσεων. Κατά την ηλεκτροφόρηση του DNA σε πήκτωμα αγαρόζης, γνωρίζετε ότι σε δεδομένο χρόνο εφαρμογής του ηλεκτρικού πεδίου στο πήκτωμα, τα μικρότερου μήκους τμήματα DNA διανύουν μεγαλύτερη απόσταση εντός του πηκτώματος.

Να προσδιορίσετε τους γονοτύπους των παιδιών 1,2,3,4 του ζευγαριού καθώς και τους γονοτύπους των γονέων τους.                                         (4)

Αιτιολογήστε την απάντηση σας.                                                                     (5)

3. Στους γορίλες (Gorilla gorilla), υπάρχει το γονίδιο WRS υπεύθυνο για το χρώμα του τριχώματος και το γονίδιο QPR που ελέγχει το μέγεθος του ύβου πίσω από το κεφάλι. Οι γορίλες μπορεί να είναι μαύροι ή ασημόραχοι και μπορεί να έχουν μεγάλο , μεσαίο ή μικρό ύβο.

Σε ένα παμμεικτικο πληθυσμό γοριλων πραγματοποιήθηκαν διασταυρώσεις μεταξύμαύρων αρσενικών με μεσαίο ύβο  με θηλυκα με τα ιδιά αυτά χαρακτηριστικά και έδωσαν :

 

F1:

3200 θηλυκά [μαύρα, μεγάλο ύβο]

3100 θηλυκά [μαύρα, μεσαίο ύβο]

1200 θηλυκά [ ασημόραχα, μεγάλο ύβο]

1000 θηλυκά [ασημόραχα, μεσαίο ύβο]

3300 αρσενικά [μαύρα, μεσαίο ύβο]

3100 αρσενικά [μαύρα, μικρό ύβο]

900 αρσενικά [ασημόραχα, μεσαίο ύβο]

1000 αρσενικά [ασημόραχα, μικρό ύβο]

 

Να ερμηνευθούν τα αποτελέσματα όταν γνωρίζετε πως μεταξύ των χαρακτηριστικών δεν παρατηρούνται φαινοτυπικες διακυμάνσεις.                                                   (8)

 

 

 

 

Ζήτημα 4ο                                                                 μονάδες 25

 

  1. Στο παρακάτω γενεαλογικό δένδρο μελετάται μια ασθένεια αυτοσωμική υπολειπόμενη. Όλα εισερχόμενα στη γενεαλογία άτομα είναι υγιή και ομόζυγα.

Διαγ 5 blog-04

 

Α. Να βρεθούν όλοι οι γονότυποι των ατόμων της γενεαλογίας.             (3)

Β. Αν τα άτομα Α και Β αποκτήσουν παιδί με ποια πιθανότητα θα νοσεί;                                                                                                                     (3)

Γ. Αν το πρώτο παιδί είναι φυσιολογικό με ποια πιθανότητα το δεύτερο θα είναι αγόρι με την ασθένεια;                                                                (3)

Δ. Αν το πρώτο παιδί νοσεί με ποια πιθανότητα το δεύτερο θα είναι υγιές;                                                                                                                   (3)

  1. Δίνεται το παρακάτω γενεαλογικό δένδρο που αφορά έναν χαρακτήρα του ανθρώπου. Τα άτομα με μαύρο χρώμα εμφανίζουν μια ασθένεια των οφθαλμών.

Να βρεθούν οι γονότυποι των ατόμων του δένδρου.                                            (13)

Διαγ 5 blog-01