Αρχείο συντάκτη nikimargariti

Η αγορά άξιων των βάσεων για τις θετικές σπουδές στην Ελλάδα

Όπως παρουσιάστηκε στο 11ο συνέδριο «Βιολογία Αλλάζει την Κοινωνία» Αθήνα 14-16.12.2018

Παρουσίαση συνεδρίου


Με αφορμή την ανακοίνωση των φετινών (2018) βάσεων των εισαγωγικών εξετάσεων για την είσοδο των υποψηφίων φοιτητών στα ΑΕΙ και ΑΤΕΙ της χώρας, παρουσιάζουμε παρακάτω την στατιστική μελέτη των αποτελεσμάτων για πέντε (5) μαθήματα που αφορούν την εισαγωγή των υποψηφίων των θετικών σπουδών τόσο του 2ου όσο και του 3ου Επιστημονικού Πεδίου, από τα Γενικά Λύκεια όλης της Ελλάδος.
Η διαγραμματική παρουσίαση1 αυτής της μελέτης, αφορά τις τρεις τελευταίες συνεχόμενες χρονιές, που εφαρμόστηκε το «νέο» σύστημα εισαγωγής στην τριτοβάθμια εκπαίδευση, με την εξέταση σε τέσσερα συν ένα (4+1) μαθήματα αντί για έξι (6), που ήταν από το 2006 μέχρι το 2015.
Τα έτη λοιπόν που μελετάμε, είναι τα 2016-2017-2018 και φυσικά τα δεδομένα προέρχονται από τα επίσημα στατιστικά στοιχεία που δημοσίευσε το Υπουργείο Παιδείας Έρευνας και Θρησκευμάτων (Υπουργείο Παιδείας εφεξής).
Αξίζει να αναφερθεί, ότι μονάχα για αυτά τα τρία τελευταία έτη, το Υπουργείο Παιδείας έχει δημοσιεύσει στατιστικώς επεξεργάσιμα αποτελέσματα, τα οποία όμως αφορούν μονάχα τις βαθμολογίες πάνω από τη βάση του 10.
Τα αποτελέσματα δηλαδή που δημοσιεύθηκαν από το Υπουργείο Παιδείας, αφορούν τις βαθμολογίες που πέτυχαν οι υποψήφιοι από το 10 μέχρι το 20, ανά 1 μονάδα, 10-10,9, 11-11,9, 12-12,9, 13-13,9 κ.ο.κ.

2016-2018

Εικόνα 1: Παρουσίαση της κατανομής των βαθμολογιών των μαθημάτων της θετικής κατεύθυνσης, για τα έτη 2016 έως 2018.

Τα στοιχεία που δίνονται ωστόσο από το Υπουργείο Παιδείας, δεν διακρίνουν ομαδοποιημένα ανά πεδίο, τις βαθμολογίες στα κοινά μαθήματα του 2ου και του 3ου επιστημονικού πεδίου (Φυσική, Χημεία) ούτε και για το μάθημα της Έκθεσης, δεν γίνεται ομαδοποίηση των υποψηφίων ανά επιστημονικό πεδίο. Για τις βαθμολογίες κάτω της βάσης του 10, το Υπουργείο Παιδείας δεν έχει δώσει αναλυτικούς πίνακες με το πλήθος των υποψηφίων ανά βαθμό, για κανένα από τα μαθήματα της θετικής κατεύθυνσης, ούτε όμως και των υπολοίπων κατευθύνσεων, δηλαδή δεν μπορούμε να γνωρίζουμε πόσοι από τους υποψήφιους έχουν γράψει βαθμολογίες μεταξύ 1-1,9, 2-2,9 κ.ο.κ. Συνεπώς, είναι αδύνατη η στατιστική τους επεξεργασία. Ωστόσο, δίνονται στον παρακάτω πίνακα τα ποσοστά του πλήθους των υποψηφίων της θετικής κατεύθυνσης, που έγραψαν βαθμολογίες πάνω και κάτω από την βάση του 10, για τα έτη 2016, 2017 και 2018, τα οποία εξετάζονται στην παρούσα εργασία.

Πίνακας 1. Ποσοστιαία κατανομή υποψηφίων θετικών σπουδών σε βαθμολογίες κάτω και πάνω της βάσης του 10 για τα έτη 2016 έως 2018.

Screenshot 2018-12-16 at 22.28.26

Όπως φαίνεται καθαρά από τα παραπάνω διαγράμματα (Εικ.1), υπήρξε μέσα σε αυτή την τριετία, μία τάση, ώστε η δεξιά ασυμμετρία που παρατηρούνταν στα μαθήματα Φυσική, Χημεία, Βιολογία να προσεγγίσει την κανονική κατανομή.
Η δεξιά ασυμμετρία παρουσιάζει μία σταθερά ανοδική κατανομή των ποσοστώσεων των βαθμολογίων των υποψηφίων σε αναλογίες από 10 προς 20. Δηλαδή οι λιγότεροι μαθητές έγραψαν 10-10,9, περισσότεροι 11-11,9 κ.ο.κ. ενώ οι περισσότεροι μαθητές έγραψαν μεταξύ 19 και 20! Προφανώς αυτό, δεν μπορεί να αποδοθεί πάρα μόνο στο γεγονός ότι τα θέματα ήταν πολύ εύκολα και συνεπώς με χαμηλή διακριτή ικανότητα, ώστε να ξεχωρίσουν τους άριστους από τους πολύ καλούς, τους πολύ καλούς από τους καλούς και αυτούς από τους μέτριους κ.ο.κ.
Η κανονική κατανομή, είναι η κατηγοριοποίηση των βαθμολογιών των υποψηφίων σε μορφή κώδωνα, δηλαδή οι περισσότεροι μαθητές γράφουν βαθμολογίες μεταξύ 14-16 και λιγότεροι γράφουν βαθμολογίες από 10 έως 14 (με αυξητική τάση μεταξύ 10 με 14) ενώ ακόμη λιγότεροι γράφουν βαθμολογίες μεταξύ 16-20 (με πτωτική τάση μεταξύ 16 με 20).
Τέτοια κατανομή εμφανίζει μονάχα το μάθημα της Έκθεσης, όπως μπορούμε να παρατηρήσουμε από τα διαγράμματα (Εικ.1).
Η κανονική κατανομή, όπως εύκολα γίνεται αντιληπτό, άλλα και όπως είναι γνωστό από τις ποσοτικές επιστήμες (π.χ. Γενετική: Ποσοτικοί χαρακτήρες), ανταποκρίνεται στη φυσική κατανομή των ατόμων ενός πληθυσμού (όπως ο πληθυσμός των υποψηφίων εδώ) για ιδιότητές του, που επηρεάζονται από μεγάλη αλλά και κατά το δυνατόν μετρήσιμη ποικιλία παραγόντων, τόσο γενετικών όσο και περιβαλλοντικών.
Βεβαίως, για τα μαθήματα που εξετάζονται στις πανελλαδικές εξετάσεις θα μπορούσε, υπό μια έννοια, να θεωρηθεί θεμιτό και οι βαθμολογίες των υποψηφίων, πέρα από την κανονική κατανομή, να εμφανίζουν τουλάχιστον δεξιά ασυμμετρία, όπως αυτή των Μαθηματικών (Εικ. 1).
Ωστόσο, δεν πρέπει να ξεχνάμε, ότι οι πανελλαδικές εξετάσεις αφορούν ένα ορισμένο σχολικό εγχειρίδιο για κάθε μάθημα, το οποίο έχει πεπερασμένη και εντελώς καθορισμένη ύλη το ίδιο, αλλά και τα σχολικά εγχειρίδια των προηγούμενων σχολικών τάξεων, τα οποία θεωρητικά αποτελούν το γνωστικό υπόβαθρο για το εγχειρίδιο της Γ’ Λυκείου, που εξετάζεται στις εισαγωγικές εξετάσεις (βλέπε εγκύκλιος Αρ.Πρωτ.222487/Δ2/18-12-2017/ΥΠΠΕΘ) και συνεπώς είναι αυτά τα σχολικά εγχειρίδια, από τα οποία επιτρέπεται να αντληθούν θέματα.
Επίσης, δεν πρέπει να ξεχνάμε πως η μορφή των θεμάτων είναι εντελώς προσδιορισμένη και (θεωρητικώς) περιορίζεται ακόμη περισσότερο η επιλογή τους, από το γεγονός ότι πρέπει να αποφεύγονται θέματα από εκπαιδευτικά βοηθήματα που κυκλοφορούν στην αγορά καθώς και σχετικές ιστοσελίδες (κανόνας που δεν τηρείται φυσικά, για διάφορους λόγους).
Όλοι λοιπόν αυτοί οι λόγοι, δεν αφήνουν πολλά περιθώρια για μεγάλο βαθμό ελεύθερης σκέψης και απόδοσής της, από τους υποψηφίους και φυσικά καθιστά πρακτικώς ανεφάρμοστη τη φράση που βρίσκεται στο τέλος των οδηγιών προς τους εξεταζόμενους και συνοδεύει πάντα τα θέματα: «κάθε απάντηση επιστημονικώς τεκμηριωμένη θεωρείται σωστή».
Για να μπορεί να εφαρμοστεί αυτή η φράση, θα πρέπει να συμβαίνουν τα εξής:
α. Για να μπορέσει να βαθμολογηθεί ορθά το γραπτό ενός μαθητή, που ξεφεύγει από το απόλυτα ορισμένο πλαίσιο της σχολικής ύλης και των λεγομένων του σχολικού εγχειριδίου, δεν αρκεί δυστυχώς ο μαθητής να έχει γράψει και να έχει τεκμηριώσει ορθά τη λύση του, αλλά θα πρέπει β. Και οι βαθμολογητές του να γνωρίζουν την γνώση αυτή, την οποία έχει διατυπώσει ο μαθητής, γεγονός που δεν είναι δυστυχώς απαραίτητο ότι συμβαίνει. γ. Πρέπει επίσης, οι βαθμολογητές για να μπορέσουν να την αξιολογήσουν ορθά μια τέτοια απάντηση ενός μαθητή, να δεχθούν να «παρεκκλίνουν» από τις έτοιμες λύσεις, που έχει δώσει η Κεντρική Επιτροπή Εξετάσεων (ΚΕΕ). δ. Να είναι πρόθυμοι να διαβάσουν ολόκληρο το γραπτό, με περίσσεια προσοχή για το πενιχρό ποσό που πληρώνονται ανά γραπτό, ασχέτως του ελάχιστου χρόνου που διαθέτουν (ειδικότερα όταν το μάθημα που διορθώνουν είναι το τελευταίο που εξετάστηκε στις εξετάσεις) και πέρα των πιέσεων για αύξηση της ταχύτητας των διορθώσεων, ώστε να ανακοινωθούν «εγκαίρως» τα αποτελέσματα από το Υπουργείο Παιδείας, με συνακόλουθη βεβαίως, μείωση της ποιότητας διόρθωσης.
Ακόμη, ειδικότερα για το μάθημα της Βιολογίας που αντιμετωπίζει έντονα αυτό το πρόβλημα (εξαιτίας των λιγοστών βιοεπιστημόνων που βρίσκονται στα σχολεία) σε αντίθεση με τα υπόλοιπα τέσσερα μαθήματα που εξετάζει η παρούσα μελέτη, θα πρέπει για να βαθμολογηθεί αντικειμενικά ο μαθητής που έγραψε κάτι διαφορετικό από τις έτοιμες λύσεις τις ΚΕΕ, άλλα ωστόσο εντελώς σωστό, τόσο επιστημονικά όσο και σύμφωνα με το σχολικό εγχειρίδιο στο οποίο εξετάζεται, οι βαθμολογητές που πρόκειται να το διορθώνουν, θα πρέπει να είναι ειδικοί στο αντικείμενο, δηλαδή βιοεπιστήμονες (με πρόσφατες βασικές σπουδές στις επιστήμες ζωής) και όχι κατά κύριο λόγο επιστήμονες άλλων ειδικοτήτων, όπως χημικοί, φυσικοί ή γεωλόγοι (Π.Ε. 04) που απλώς έχουν «διδάξει» το μάθημα για μερικά χρόνια στο σχολείο, ενώ δεν έχουν διδαχθεί οι ίδιοι στο πανεπιστήμιο επαρκώς ή ακόμη και καθόλου το αντικείμενο που πραγματεύεται το σχολικό βιβλίο της Γ΄ Λυκείου Θετικού Προσανατολισμού.
Και αυτό διότι, αν και το σχολικό εγχειρίδιο της Βιολογίας έχει γραφτεί προ 20ετίας, εντούτοις πραγματεύεται βιολογικά θέματα, που βρίσκονται ακόμη και τώρα στην αιχμή της πλέον ταχύτερα εξελισσόμενης επιστήμης σε ολόκληρο τον επιστημονικό κόσμο (όπως είναι γνωστό η Βιολογία απορροφά την πλειονότητα των κονδυλίων της παγκόσμιας χρηματοδότησης για την έρευνα). Τέτοια θέματα είναι για παράδειγμα, η γονιδιακή θεραπεία, η βιοτεχνολογία μικροοργανισμών, φυτών και ζώων, η κλωνοποίηση θηλαστικών κ.ά.
Πέρα όμως από όλα τα παραπάνω προβλήματα και πολλές ακόμη παθογένειες των πανελλαδικών εξετάσεων, οι εξετάσεις αυτές παραμένουν εν πολλοίς ένας αδιάβλητος θεσμός, μπορεί όχι δίκαιος απαραιτήτως, όμως αδιάβλητος θεσμός και γι’ αυτό το λόγο καταξιωμένος στη συνείδηση της ελληνικής κοινωνίας από τότε που εφαρμόστηκαν.
Με βάση όσα ήδη αναφέρθηκαν και παρατηρώντας τα διαγράμματα της Εικόνας 1, διακρίνεται μία τάση για βελτίωση της ικανότητας διαχωρισμού των υποψηφίων από έτος σε έτος.
Ειδικότερα, για το μάθημα της Βιολογίας, το οποίο έχει, από όλα τα μαθήματα τον μεγαλύτερο συντελεστή (1,3) για το 3ο πεδίο (Επιστήμες Υγείας), που οδηγεί στις Ιατρικές σχόλες και με δεδομένο ότι στη Βιολογία Θετικού Προσανατολισμού εξετάζονται περίπου 13.000-16.000 μαθητές κάθε χρόνο,
γίνεται ορατό ότι:
Κυμαίνονται οι άριστοι (19-20) από ~ 7% με 9% (τα ποσοστά (%) αυτά αντιστοιχούν περίπου σε 1200 άτομα σε όλη την Ελλάδα, σημειώνεται ότι στις Ιατρικές – Οδοντιατρικές και φαρμακευτικές σχόλες της χώρας εισάγονται κάθε χρόνο περίπου 1400 άτομα) και παράλληλα φέτος, εν αντιθέσει με τις προηγούμενες χρονιές το μεγαλύτερο ποσοστό των υποψηφίων που έγραψαν μεγαλύτερη βαθμολογία από 10, κυμάνθηκαν σε βαθμολογίες μεταξύ 17-18 και όχι 18-19 όπως τα δύο προηγούμενα χρόνια. Αυτό μας δείχνει ότι υπάρχει τάση, για μία κατανομή βαθμολογιών πιο κοντά στην κανονική κατανομή, στην οποία υπακούει ο πληθυσμός; Σίγουρα κάτι τέτοιο μόνο θετικό μπορεί να θεωρηθεί, εφόσον βεβαίως, αυτό επιτυγχάνεται με θέματα που διατυπώνονται με επιστημονική και παιδαγωγική ορθότητα και όχι με ασάφειες επιστημονικές και παιδαγωγικές, όπως ήταν για παράδειγμα τα φετινά θέματα, τα οποία μπορούν ενδεχομένως να χαρακτηριστούν μαζί με τα θέματα του 2015** ως τα χειρότερα που έχουν τεθεί ποτέ στο μάθημα, από το 2000 μέχρι τώρα.
Τα θέματα πριν από το 2011 μπορεί κάνεις να πει, ότι ήταν διαφορετικής φιλοσοφίας, περισσότερο προσανατολισμένα στην παράθεση αυτούσιων τμημάτων του σχολικού εγχειρίδιου και με ασκήσεις πολύ μικρού βαθμού δυσκολίας, χωρίς την απαίτηση ιδιαίτερης κριτικής σκέψης, αλλά και χωρίς να στερούνται και προβλημάτων διατύπωσης. Από το 2011 και μετά, η παράθεση των αυτούσιων αποσπάσματων του σχολικού βιβλίου δεν έχει μειωθεί, αντίθετα μάλιστα. Όμως αυτό ζητείται μέσω περισσοτέρων ερωτήσεων συνδυαστικής σκέψης και κριτικής ικανότητας. Εντούτοις αυτές οι ερωτήσεις και οι ασκήσεις πολύ συχνά μετά το 2011, χαρακτηρίζονται από ασάφειες (θέματα: γ2 2018, β και δ 2016, 2015, δ 2014 κ.α.), από ερωτήματα που δεν υπάρχουν απαντήσεις εντός του σχολικού βιβλίου, ούτε και προηγουμένων τάξεων σχολικών εγχειρίδιων Βιολογίας ή είναι ρητώς εκτός εξεταστέας ύλης (π.χ. τα θέματα: η δράση του ενζύμου DNA δέσμαση 2015 και 2016, γ3 2018 κ.α.) και από επιστημονικές ανακρίβειες (θέματα: επαναληπτικά δ 2012, δ2014, δ2015, εσπερινά γ2017 κ.α.) ή έρχονται σε σύγκρουση με γνώσεις προηγουμένων τάξεων στην Βιολογία (θέματα: α2016) ή δίνονται πολλαπλής επιλογής με περισσότερες από μια σωστές επιλογές (α 2018) ή η απάντηση τους ενώ υπάρχει εντός του σχολικού βιβλίου της Γ΄ Λυκείου και εντός εξεταστέας ύλης, αυτή δεν λαμβάνεται υπόψη (θέματα: επαναληπτικά δ2016, γ2018).
Το πρόβλημα βεβαίως δεν έγκειται μόνο στις λανθασμένες εκφωνήσεις, αλλά ακόμη περισσότερο στις λανθασμένες απαντήσεις που δόθηκαν από την ΚΕΕ και θεωρήθηκαν αυτές ως «Σωστές» και όχι οι επιστημονικώς σωστές, που πηγάζουν άλλωστε και από το σχολικό εγχειρίδιο, και που προτάθηκαν από τους συντονιστές των εξεταστικών κέντρων, όπως φέτος (βλέπε άρθρο της Βιολόγου – συντονίστριας των πανελλαδικών εξετάσεων Δρ. Ευγενίας Μπολανάκη στο διαδικτυακό τόπο www. e-sos.gr στις 21-7-2018).
Ειδικότερα για την Βιολογία που αναφέρουμε εδώ, τα θέματα που επιλέγονται για τις πανελλαδικές εξετάσεις από το 2016, είναι ορθά διατυπωμένα και απαντημένα στην αγγλική γλωσσά, αφού αποτελούν συχνά αντιγραφές έτοιμων (εξαιρετικών αναμφίβολα, αν αποδιδόταν ως έχουν) θεμάτων από πανεπιστήμια της αλλοδαπής. Εντούτοις, στις εξετάσεις παρουσιάζεται αδυναμία να αποδοθούν σωστά στην ελληνική γλώσσα αυτά τα θέματα καθώς και οι απαντήσεις που τα συνοδεύουν, αποδίδοντας εντέλει θέματα ασαφή, που επιδέχονται περισσότερες της μιας ερμηνείες, ενώ ταυτόχρονα εμφανίζεται αδυναμία να προσαρμοστούν με ορθό επιστημονικό και παιδαγωγικό τρόπο εντός των ορίων της περιορισμένης και εντελώς καθορισμένης εξεταστέας ύλης των πανελληνίων εξετάσεων. Έτσι, δυστυχώς, ο στόχος της κατανομής των βαθμολογίων των υποψηφίων σε κανονική κατανομή για βαθμολογίες μεγαλύτερες της βάσης του 10, επιτυγχάνεται μόνο αριθμητικά όχι όμως ουσιαστικά, αφού είναι πολύ πιθανό, άριστα προετοιμασμένοι μαθητές να μην γράψουν καλά και να μην επιτύχουν το στόχο τους, οπότε υποχρεώνονται να ξαναδώσουν εξετάσεις ή να μεταναστεύσουν στο εξωτερικό, και αυτό όχι γιατί δεν γνωρίζουν την επιστημονικώς ορθή απάντηση σε αυτά τα ερωτήματα, αλλά διότι δεν είναι φυσικά μάντης, για να μαντέψουν ποια από τις αναρίθμητες λανθασμένες απαντήσεις, θα θεωρηθεί σωστή από την ΚΕΕ!
Από την άλλη πλευρά, είναι πολύ πιθανό μέτρια προετοιμασμένοι μαθητές, που αδυνατούν να απαντήσουν επιστημονικώς ορθά σε αυτά τα ερωτήματα, πέτυχαν κατά τύχη ή λόγω πραγματικός άγνοιας, την λανθασμένη απάντηση που θεωρεί ως σωστή η ΚΕΕ, ακόμη και αν αυτή η ¨σωστή” απάντηση έρχεται σε πλήρη αντίθεση με την εξεταζόμενη ύλη για τις εξετάσεις (βλέπε ερώτημα γ3 και απάντηση του 2018 αλλά και θέμα Δ 2015, όπως και θέμα Γ Εσπερινών Λυκείων 2017, Θέμα Α 2016 και 2018 κ.α)!
Το πρόβλημα ωστόσο, είναι ακόμα βαθύτερο στο συγκεκριμένο μάθημα, καθώς διδάσκεται, κατά κύριο λόγο, όπως αναφέρθηκε και προηγουμένως, από καθηγητές τόσο εντός των σχολείων αλλά όσο και εκτός (φροντιστήρια) που δεν έχουν βασικές σπουδές στις Επιστήμες Ζωής ώστε να είναι γνώστες της επιστήμης της Βιολογίας και των εφαρμογών της, αλλά αντίθετα διδάσκεται από φυσικούς (η πολυπληθέστερη ειδικότητα από τους καθηγητές, μετά τους φιλόλογους και τους μαθηματικούς), χημικούς (η αμέσως λιγότερο πολυπληθέστερη κατηγορία καθηγητών μετά τους φυσικούς, όμως αρκετά κοντά σε πλήθος με τους φυσικούς) και γεωλόγους. Οι ειδικότητες αυτές, είτε δεν διδάχθηκαν καθόλου είτε δεν διδάχθηκαν επαρκώς, στο πρόγραμμα σπουδών του τμήματος που παρακολουθήσαν (μικρό ποσοστό μαθημάτων Βιολογίας, στο σύνολο του προγράμματος σπουδών τους και όχι πάντα υποχρεωτικά) το μοντέρνο και ταχέως εξελισσόμενο αντικείμενο της Βιολογίας. Να σημειωθεί βεβαίως ότι, σημαντικό ρόλο σε αυτό (πρόγραμμα σπουδών των πανεπιστημιακών τμημάτων των ειδικοτήτων που διδάσκουν Βιολογία, εκτός των βιοεπιστημόνων) έχει και η χρονική περίοδος που φοίτησαν στο πανεπιστήμιο ή οι μετέπειτα σπουδές στους, τόσο σε επίπεδο χρονικής περιόδου, όσο και σε επίπεδο αντικειμένου σχετικού ή όχι με τις επιστήμες ζωής και ειδικότερα την Μοριακή Βιολογία-Βιοτεχνολογία και τη Γενετική, που είναι τα αντικείμενα που πραγματεύεται το σχολικό εγχειρίδιο της Γ΄ Λυκείου Θετικού Προσανατολισμού.
Επιπλέον, και πάλι αναφερόμενοι στο μάθημα της Βιολογίας που είναι αυτό που κρίνει την εισαγωγή των υποψηφίων στις περιζήτητες Ιατρικές σχόλες, έχοντας τον υψηλότερο συντελεστή βαρύτητας 1,3 (για κάθε επιπλέον βαθμό στην κλίμακα του 1-20, ο υποψήφιος κερδίζει 330 μόρια!) οφείλουμε να σημειώσουμε ότι από την μια, η εξαιρετικά μεγάλη ζήτηση στις σχόλες αυτές είναι σταθερά ανελαστική από υπάρξεως των πανεπιστημίων στην Ελλάδα και από την άλλη, το μάθημα της Βιολογίας προβλέπεται να διδάσκεται μόνο 2 ώρες την εβδομάδα στην Γ΄ Λυκείου όσο δηλαδή και η Έκθεση με συντελεστή βαρύτητας 0,3 (κάθε επιπλέον βαθμός στην κλίμακα 1-20 δίνει 200 μόρια) και λιγότερο από την Φυσική (συντελεστής 0,3 στο 3ο πεδίο και 0,7 στο 2ο, δηλαδή 270 μόρια για κάθε επιπλέον βαθμό) και την Χημεία (συντελεστής βαρύτητας 0,3 στο 2ο πεδίο και 0,7 στο 3ο πεδίο) που διδάσκονται 3 ώρες! Τέλος, από τα θετικά μαθήματα, τα μαθηματικά που αποτελούν το μάθημα βαρύτητας (1,3 στο 2ο πεδίο) για την εισαγωγή στα πολυτεχνεία διδάσκονται 5 ώρες την εβδομάδα!
Αξίζει δε να παρατηρηθεί ότι, το γνωστικό αντικείμενο της Βιολογίας είναι το μόνο από όλα τα παραπάνω (Μαθηματικά, Νέα Ελληνικά, Φυσική και Χημεία) που δεν εμφανίζει συνοχή στην ύλη ούτε συνέχεια στην διδασκαλία του, στα πλαίσια ολόκληρης της α΄ βαθμιας και β΄ βαθμιας εκπαίδευσης της χώρας μας. Με εξαίρεση ελάχιστα ψήγματα περί νόμων του Μέντελ, μοριακού δόγματος, μίτωση και μείωση στο 5ο κεφάλαιο του βιβλίου της γ΄ γυμνάσιου και μια επαναπροσέγγιση του δόγματος, της μίτωσης και της μείωσης στο 4ο κεφάλαιο του βιβλίου της β’ λυκείου (το οποίο μέχρι το 2015 ήταν εκτός ύλης), όλο το υπόλοιπο περιεχόμενο που πραγματεύεται το βιβλίο της Γ΄ Λυκείου της Βιολογίας Θετικής Ομάδας Προσανατολισμού, είναι εντελώς νέο και άγνωστο, χωρίς συνοχή και συνέχεια με την ύλη της Βιολογίας στις προηγούμενες τάξεις του Λυκείου και του Γυμνασίου.
Ωστόσο, αν όλα αυτά συμβαίνουν στα πλαίσια των συντεχνιών των διαφόρων ειδικοτήτων των εκπαιδευτικών και φυσικά, εάν υπάρχει η συναίνεση του Υπουργείου Παιδείας σε αυτές, προκείμενου μεταξύ άλλων, αφενός μεν να ικανοποιήσει τις συντεχνίες και αφετέρου να περιορίσει τους διορισμούς εκπαιδευτικών, στα γενικότερα πλαίσια των περικοπών, τότε το σύνολο αυτών των αποφάσεων ας ληφθεί από όλες τις πλευρές υπόψη, ότι βαραίνει την ελληνική νεολαία, ψυχικά, σωματικά και πιθανόν χρονικά, αλλά και τους γονείς αυτών, ενώ ωθεί με μαθηματική ακρίβεια στην αρωγή βοήθειας εξωσχολικά, για την εισαγωγή στην σχολή επιθυμίας και σε περίπτωση αποτυχίας, οδηγεί στην μετανάστευση των νεοελλήνων στο εξωτερικό, με δυσάρεστες συνέπειες για την ελληνική κοινωνία.

Η Έκθεση είναι το μάθημα στο οποίο, εξετάζονται όλοι ανεξαιρέτως οι υποψήφιοι κάθε χρόνο (περίπου 80.000) και το μάθημα με τον χαμηλότερο συντελεστή σε κάθε επιστημονικό πεδίο, με μοναδική εξαίρεση όταν ο μαθητής έχει δηλώσει πως θα εξεταστεί και σε πέμπτο μάθημα, είτε την Βιολογία Γενικής παιδείας είτε τα μαθηματικά Γενικής παιδείας και “ανοίγει” έτσι και δεύτερο επιστημονικό πεδίο στο μηχανογραφικό του, όποτε έχει συντελεστή βαρύτητας 0,6 για το επιπλέον επιστημονικό πεδίο. Όμως, είναι και το μάθημα με τις περισσότερες αναβαθμολογήσεις γραπτών (περίπου 12%), σε σχέση με οποιοδήποτε άλλο εξεταζόμενο μάθημα στις πανελλαδικές εξετάσεις. Βεβαίως το μάθημα της Έκθεσης διδάσκεται αποκλειστικά από φιλόλογους (2 ώρες την εβδομάδα στην Γ’ Λυκείου), με συνοχή και συνεχεία της ύλης, σε όλες τις βαθμίδες της εκπαίδευσης.
Η εικόνα της Έκθεσης, όπως προκύπτει από τα διαγράμματα (Εικ. 1), λόγω όλων των παραπάνω χαρακτηριστικών του μαθήματος προσεγγίζει την ιδεατή, και αυτή που οφείλουν να εμφανίζουν όλα τα μαθήματα που εξετάζονται πανελλαδικώς, ώστε να μπορούν να χαρακτηριστούν τα θέματα ικανά να προσεγγίζουν τις πραγματικές ανθρώπινες δυνατότητες ενός πληθυσμού (εδώ του πληθυσμού των υποψηφίων) για ορισμένες δεξιότητες (εδώ αυτές που εξετάζουν οι συγκεκριμένες εξετάσεις). Η Έκθεση, είναι το μόνο από τα μαθήματα που εμφανίζει κανονική κατανομή, δηλαδή οι πολλοί είναι μέτριοι, οι άριστοι ελάχιστοι και οι «κακοί μαθητές» λίγοι, αλλά περισσότεροι από τους άριστους.

Η Φυσική είναι το μάθημα με συντελεστή 0,3 για το 3ο πεδίο και 0,7 για το 2ο πεδίο. Το σύνολο των υποψηφίων κάθε χρόνο που εξετάζεται στο μάθημα της Φυσικής είναι περίπου 30.000 υποψήφιοι από τους οποίους οι ~ 13.000-16.000 ανήκουν στο 3ο πεδίο και οι υπόλοιποι στο 2ο πεδίο. Διδάσκεται σχεδόν αποκλειστικά από Φυσικούς, για 3 ώρες κάθε εβδομάδα στην Γ’ Λυκείου, με συνοχή και συνέχεια της ύλης σε όλες τις εκπαιδευτικές βαθμίδες.
Στα διαγράμματα (Εικ. 1) παρατηρούμε ότι από τότε που τα μαθήματα έγιναν 4 +1 αντί για 6 (μέχρι το 2015), το μεγαλύτερο ποσοστό των υποψηφίων συνωστίζεται στο 19-20. Εξαίρεση, η φετινή χρονιά, που αν και οι περισσότεροι από τους υποψηφίους κατά τη διάκρισή τους από 10-20 ανά 1 μονάδα εμφανίζονται και πάλι μεταξύ 19-20, σε ποσοστό δηλαδή περίπου 10%, αυτό το ποσοστό έχει εμφανώς περιοριστεί, σε αντίθεση με τις δυο προηγούμενες χρονιές. Το υψηλό ποσοστό των αριστούχων, είναι γεγονός αναντίρρητα προβληματικό για ένα μάθημα όπως η Φυσική, το οποίο προσφέρεται για αντικειμενική και επιτυχημένη διάκριση των υποψηφίων. Άρα τα δύο προηγούμενα χρόνια, μπορούμε να πούμε ότι τα θέματα της Φυσικής ήταν πολύ εύκολα, αλλά φέτος (2018), αν και παρέμειναν εύκολα, θα μπορούσαν να χαρακτηριστούν από καλύτερη διακριτική ικανότητα, αφού πέτυχαν την μείωση των αριστούχων, αισθητά σε σχέση με τα δυο προηγούμενα χρόνια.
΄Ας ελπίσουμε ότι τις αμέσως επόμενες χρονιές, η εικόνα της Φυσικής θα προσεγγίσει την εικόνα της Έκθεσης, δηλαδή θα αντιπροσωπεύει πραγματικά την κατανομή του πλήθους των μαθητών για ορισμένες δυνατότητές τους (όπως αυτές ζητούνται και εξετάζονται στις συγκεκριμένες εξετάσεις) σύμφωνα με τα δεδομένα της ανθρώπινης φύσης.

Το μάθημα της Χημείας είναι και αυτό με συντελεστή 0,3 όμως για το 2ο πεδίο σε αντίθεση με τη Φυσική και 0,7 για το 3ο πεδίο. Το σύνολο των υποψηφίων που εξετάζονται στο μάθημα είναι ακριβώς όμοιο με αυτό της Φυσικής ~ 30.000 κάθε χρόνο. Διδάσκεται σχεδόν αποκλειστικά από χημικούς, 3 ώρες την εβδομάδα στην Γ’ Λυκείου και χαρακτηρίζεται από συνοχή και συνεχεία της ύλης σε όλο το εύρος της β΄ βαθμιας εκπαίδευσης.
Η Χημεία διαχρονικά ήταν (από την εποχή των δεσμών ακόμα) και συνεχίζει να παραμένει το ευκολότερο από όλα τα εξεταζόμενα μαθήματα των θετικών σπουδών. Έτσι, δεν είναι τυχαίο που πάντα ήταν και εξακολουθεί να είναι το μάθημα με τους περισσότερους αριστούχους.
Ειδικότερα τα χρόνια πριν το 2016, αλλά και το 2016 με ποσοστό μαθητών που έγραψε μεταξύ 19-20 να είναι πάνω από 13% των υποψηφίων, το 2017 το ποσοστό αυτό έπεσε στο 12% περίπου, αλλά η γενική εικόνα δεν άλλαξε, καθώς τα ποσοστά των μαθητών που έγραψαν μεταξύ 10-20 κατανεμημένα ανά 1 μονάδα εμφανίζουν σταθερή βαθμιαία αύξηση τόσο το 2016 όσο και το 2017 (δεξιά ασυμμετρία), γεγονός που δηλώνει ότι τα θέματα είναι εύκολα στη Χημεία, η οποία δεν καταφέρνει να διαχωρίσει επιτυχημένα τους υποψηφίους σε άριστους, καλούς, μέτριους κ.ο.κ.
Φέτος βεβαίως είναι η πρώτη φορά που οι άριστοι 19-20 είναι λιγότεροι από μία άλλη κατηγορία, αυτή όμως είναι όσοι μαθητές έγραψαν 18-19 ενώ οι άριστοι, είναι η δεύτερη πολυπληθέστερη κατηγορία υποψηφίων με ποσοστό ~ 11 % και η τρίτη πολυπληθέστερη είναι αυτή των μαθητών που έγραψαν μεταξύ 17-18. Δηλαδή και πάλι η συσσώρευση των υποψηφίων γίνεται γύρω από τις υψηλές και όχι γύρω από τις μεσαίες βαθμολογίες, όπως θα ήταν το σωστό.
Οι εξετάσεις στη Χημεία λοιπόν φαίνεται ακόμη ότι αποτυγχάνουν να κατατάξουν τους μαθητές σε κανονική κατανομή.

Τα Μαθηματικά είναι το μάθημα με συντελεστή 1,3 στο 2ο πεδίο, το σύνολο των μαθητών που εξετάζονται στα μαθηματικά κάθε χρόνο είναι ~ 20,000 μαθητές για την θετική κατεύθυνση και άλλοι τόσοι περίπου, για την κατεύθυνση των οικονομικών σπουδών. Τα μαθηματικά διδάσκονται αποκλειστικά από μαθηματικούς, 5 ώρες την εβδομάδα στην Γ΄ Λυκείου και χαρακτηρίζονται από συνοχή και συνέχεια της ύλη τους, σε όλο το φάσμα της εκπαίδευσης στην Ελλάδα.
Το μάθημα των Μαθηματικών ήταν, και φαίνεται ότι εξακολουθεί να ξέρει πώς να συνεχίζει να είναι το πραγματικά δύσκολο μάθημα των πανελληνίων εξετάσεων από τα θετικά μαθήματα. Είναι αυτό, που εμφανίζει σταθερά αριστερή ασυμμετρία με τα ποσοστά των μαθητών που γράφουν 10-20 χωρισμένα μεταξύ τους ανά 1 μονάδα, να μειώνονται βαθμιαία από το 10 έως 20.
Σίγουρα, τα Μαθηματικά σε αντίθετη με τη Φυσική, τη Χημεία και τη Βιολογία κατορθώνουν μία πιο ορθολογική διάκριση μεταξύ των μαθητών υποψηφίων, διατηρώντας το επίπεδο των θεμάτων και τον τρόπο διόρθωσής τους υψηλό.
Είναι δε αξιοπρόσεκτο, πως η κατανομή των βαθμολογίων των υποψήφιων εμφανίζει έντονη δεξιά ασυμμετρία στα μαθήματα της Φυσικής και της Χημείας, που από τη φύση τους απαιτούν μαθηματική γνώση, ενώ από την άλλη πλευρά η κατανομή των βαθμολογίων των υποψηφίων στα μαθηματικά εμφανίζει έντονη αριστερή ασυμμετρία! Θα ήταν βεβαίως πιο αντικειμενική η εικόνα των διαγραμμάτων που εμφανίζονται στην εικόνα 1, αν το Υπουργείο Παιδείας έδινε τα στατιστικά στοιχεία με τρόπο που να διακρίνονται οι βαθμολογίες των υποψηφίων που ανήκουν στο 2ο επιστημονικό πεδίο σε όλα τα μαθήματα στα οποία αυτοί εξετάστηκαν και το ίδιο και για τις βαθμολογίες των μαθητών που ανήκουν στο 3ο επιστημονικό πεδίο.
Να επισημάνουμε ακόμη, ότι το 3ο πεδίο δεν επιλέγεται πλέον μόνο από άριστους μαθητές, αλλά και από πολλά παιδιά που ενδιαφέρονται για τα παραϊατρικά επαγγέλματα, τα οποία χαρακτηρίζονται από σχετικά υψηλό βαθμό επαγγελματικής αποκατάστασης, σε σχέση με πολλές άλλες ειδικότητες άλλων πεδίων. Επίσης το δεύτερο επιστημονικό πεδίο επιλέγεται όχι μόνο από αρίστους μαθητές, με στόχο τις υψηλόβαθμες πολυτεχνικές σχολές της μηχανικής, αλλά και από πολλούς άλλους μαθητές, εξαιτίας της μεγάλης ποικιλίας χαμηλόβαθμων, κυρίως περιφερικών, ΑΕΙ και ΑΤΕΙ, προκειμένου να εξασφαλίσουν την εισαγωγή τους σε κάποια σχολή

Αξίζει ωστόσο να σημειωθεί ότι λίγοι είναι οι μαθητές που εξετάζονται με αξιώσεις τόσο στο μάθημα των μαθηματικών όσο και στο μάθημα της Βιολογίας, οι μαθητές αυτοί είναι κατά κανόνα πολύ υψηλού επιπέδου μαθητές, οι οποίοι δεν έχουν αποφασίσει κατά την διάρκεια του έτους, αν θα ήθελαν να σπουδάσουν στο πολυτεχνείο ή στην ιατρική και έτσι θέλοντας να έχουν το δικαίωμα της επιλογής και όντας μαθητές πολύ υψηλού επιπέδου, αποφασίζουν να εξεταστούν και στα δυο αυτά πολύ απαιτητικά μαθήματα, οπού συνήθως τα καταφέρνουν εξίσου καλά και στα δυο.
Από την άλλη πλευρά, οι λιγότερο «δυνατοί» μαθητές που επιλεγούν και τα δυο αυτά μαθήματα, έχουν ως γνώμονα, ότι στο ένα από τα δυο μαθήματα δεν θα επενδύσουν ιδιαίτερη προσπάθεια και κόπο, άλλα θέλουν με αυτό τον τρόπο να “ανοίξουν” τις χαμηλόβαθμες σχόλες και των δυο επιστημονικών πεδίων, ώστε να εξασφαλίσουν την εισαγωγή τους σε κάποια από αυτές, χωρίς απαραίτητα να είναι η σχολή αυτή ο πραγματικός στόχος τους.
Πάντως οι μαθητές που δεν ανήκουν στην κατηγορία των άριστων, και αποφασίζουν να εξεταστούν τόσο στο μάθημα της Βιολογίας όσο και στο μάθημα των Μαθηματικών και επενδύουν ισάξια προσπάθεια και κόπο και στα δυο αυτά μαθήματα, συνήθως βγαίνουν χαμένοι τόσο σε επίπεδο κόπου όσο και σε τελικό αποτέλεσμα, καθώς είναι πραγματικά δύσκολο να επιτύχουν άριστες ή έστω πολύ υψηλές βαθμολογίες και στα δυο αυτά μαθήματα, που είναι τα πλέον απαιτητικά όπως προκύπτει πολύ εύκολα και από το παραπάνω διάγραμμα (Εικ. 1), από όλα τα θετικά μαθήματα των πανελλαδικών εξετάσεων.

Πέρα όμως από τα θετικά μαθήματα, αν επεκτείνουμε την έρευνά μας και για τα υπόλοιπα μαθήματα που εξετάζονται στις εισαγωγικές εξετάσεις μόνο για το έτος 2018, βλέπουμε ότι φέτος στο μάθημα των λατινικών και στο μάθημα Αρχές οικονομικής θεωρίας, η εικόνα είναι όπως φαίνεται, παρόμοια με την εικόνα της χημείας και της φυσικής των δυο προηγούμενων ετών, που όπως αναλύθηκε, δεν μπορούσαν πάρα να θεωρηθούν αποτυχημένα θέματα, μιας και δεν επιτυγχάνουν ικανοποιητική διάκριση μεταξύ των υποψηφίων, αφού το μεγαλύτερο ποσοστό των μαθητών επιτυγχάνουν βαθμολογίες μεταξύ 19-20! Σίγουρα και ο δρόμος των φιλολόγων και των οικονομολόγων είναι ακόμη μακρύς, για να επιτύχουν σωστή και αξιοκρατική κατανομή υποψηφίων στο μάθημα των λατινικών και των οικονομικών αντιστοίχως.

2018

Εικόνα 2: Κατανομή βαθμολογιών όλων των μαθημάτων έτους 2018

Ανακεφαλαιώνοντας λοιπόν, όπως προκύπτει από τη διαγραμματική ανάλυση των στατιστικών στοιχείων των πανελλαδικών εξετάσεων που δημοσιεύει κάθε χρόνο από το 2016 το Υπουργείο Παιδείας και αφορούν τις βαθμολογίες των υποψηφίων στην κλίμακα 10-20 ανά μία μονάδα, για τα μαθήματα που αφορούν τη θετική κατεύθυνση, φαίνεται πως υπάρχει μία βελτίωση από έτος σε έτος ώστε να προσεγγίσουν τα αποτελέσματα κατά ένα τρόπο την κανονική κατανομή σε όλα τα μαθήματα εκτός βεβαίως της Έκθεσης που το επιτυγχάνει κάθε χρόνο (παρόλο που φέτος ήταν περισσότεροι όσοι έγραψαν μεταξύ 10-14 από ότι 16-20). Η Βιολογία δείχνει να κινείται με ταχύτερο ρυθμό προς αυτόν τον στόχο, χωρίς όμως να βελτιώνονται οι προβληματικές παράμετροι που αναφέρθηκαν προηγουμένως (κάθε χρόνο: ασάφειες στις εκφωνήσεις και λανθασμένα τόσο επιστημονικώς όσο και παιδαγωγικός ερωτήματα των θεμάτων των πανελλαδικών εξετάσεων, συνοδευόμενα από λανθασμένες επιστημονικώς απαντήσεις, αλλά και πολύ μεγάλο ποσοστό διορθωτών που δεν είναι απαραίτητα γνώστες της επιστήμης της Βιολογίας), σε συνεπεία ο στόχος αυτός να επιτυγχάνεται πλασματικά. Αμέσως μετά έρχεται η Χημεία και τελευταία η Φυσική, που φαίνεται να κινείται πιο αργά από όλα τα θετικά μαθήματα προς αυτό τον στόχο. Τα Μαθηματικά είναι το μόνο μάθημα από τα θετικά, που εμφανίζει σταθερά ικανό τρόπο διάκρισης των μαθητών υποψηφίων, μιας και εμφανίζει και τα τρία χρόνια που μελετάμε αριστερή κατανομή ποσοστών.
Συνοψίζοντας επομένως, όπως διαμορφώνεται η εικόνα στη διαγραμματική παρουσίαση των βαθμολογίων των υποψηφίων για τις θετικές σπουδές κατά τα έτη 2016, 2017 και 2018 (Εικ.1), μπορούμε να εξάγουμε, πως έγιναν βήματα, αλλά χρειάζονται ακόμη και άλλα, κυρίως όμως προς την ποιοτική και όχι μόνο προς την ποσοτική βελτίωση της κατανομής, έτσι ώστε να φτάσουν τα θέματα και ο τρόπος διόρθωσής τους στα θετικά μαθήματα, να προσεγγίζουν την εικόνα της κανονικής κατανομής, η οποία αντιπροσωπεύει τον ανθρώπινο πληθυσμό σε χαρακτήρες όπως αυτούς που εξετάζονται σε αυτές τις εξετάσεις, για τους υποψηφίους..
Όμως πέρα από την στατιστική, δεν πρέπει να παραβλέπουμε και όσα αναφέρθηκαν προηγουμένως στην αρχή του άρθρου, για τους περιορισμούς και τις ισχυρές παθογένειες και στρεβλώσεις των πανελλαδικών εξετάσεων, με κύριο χαρακτηριστικό εδώ, το γεγονός ότι αυτοί οι αριθμοί που παρουσιάζονται στο παρόν άρθρο, δείχνουν μόνο την τάση για την κατανομή του πλήθους των υποψηφίων σε βαθμολογίες, δεν εξετάζεται όμως ο τρόπος που επιτυγχάνεται αυτό.
Μη ξεχνάμε για όλα τα μαθήματα την πολύ σημαντική παθογένεια της αποστήθισης των λεγομένων κατά γράμμα, των εντός εξεταστέας ύλης εδαφίων των σχολικών εγχειριδίων, με τα όσα λάθη τους και την περιορισμένη ύλη τους, χώρια από την παλαιότητα (τουλάχιστον για την βιολογία που η εξέλιξη της γίνεται με ταχύτατους ρυθμούς) της πληροφορίας που περιέχουν. Η στρέβλωση αυτή είναι αρκετή, για να είναι αδύναμη η οποία διακριτική ικανότητα των θεμάτων των πανελλαδικών εξετάσεων όσο επιτυχημένα και αν είναι αυτά.
Στόχος λοιπόν θα πρέπει να είναι οι πανελλαδικές εξετάσεις πέρα από αδιάβλητες να είναι και αξιοκρατικές, επιλέγοντας τους αυριανούς επιστήμονες της Χώρας μας, με κριτήρια που πραγματικά κατορθώνουν να κατανέμουν τους υποψηφίους όχι εκεί που έτυχε, άλλα εκεί που πέτυχαν με βάση τον κόπο και τα προσόντα τους.

Αξίζει να αναφερθεί ότι φέτος είναι η πρώτη χρονιά που γίνεται δυνατή η εισαγωγή παιδιών από τα ΕΠΑΛ σε όλα τα Εκπαιδευτικά Ιδρύματα της Τριτοβάθμιας Εκπαίδευσης της Χώρας, μεταξύ αυτών και σχολών όπως οι περιζήτητες Ιατρικές και οι Πολυτεχνικές (εδώ εξετάζονται μόνο τα θέματα των ΓΕΛ).

1Η διαγραμματική παρουσίαση των αποτελεσμάτων έγινε από τον οικονομολόγο Msc. Γ. Καρακατσάνη.
Πηγή δεδομένων: Επίσημα πίνακες του Υπουργείου Παιδείας για τα έτη 2016-2018 όπως αυτοί δημοσιεύθηκαν στο διαδίκτυο από τον ιστότοπο του Υπουργείου Παιδείας www.minedu.gr.

Διαγώνισμα κεφαλαίων 1-2-4 Βιολογίας ομάδας Θετικού Προσανατολισμού

ΔΙΑΓΩΝΙΣΜΑ

ΚΕΦΑΛΑΙΟ 1ο –2ο και 4ο

ΘΕΜΑ Α                                                                                                                                                                                       ΜΟΝΑΔΕΣ 25

Να απαντήσετε στις παρακάτω ερωτήσεις επιλέγοντας την λανθασμένη πρόταση ανάμεσα στις σωστές ή την σωστή ανάμεσα στις λανθασμένες.

Α. Το καλαμπόκι (zea mays) έχει μεγαλύτερη ποσότητα DNA στον πυρήνα του, απ’ ότι έχει ο άνθρωπος. Έτσι, αναμένουμε :

α. Το καλαμπόκι έχει περισσότερα χρωμοσώματα από τον άνθρωπο.

β. Ο άνθρωπος είναι σίγουρα εξελικτικά κατώτερος από το φυτό αυτό.

γ. Ο άνθρωπος και το καλαμπόκι έχουν τον ίδιο λόγο και τον ίδιο καρυότοπο και την ίδια αλληλουχία βάσεων , αλλά θα διαφέρουν ως προς την διαζώνωση.

δ. Το καλαμπόκι δεν αποκλείεται να έχει λιγότερα χρωμοσώματα από τον άνθρωπο, και διαφορετικό λόγο , και διαφορετικό καρυότυπο από τον άνθρωπο.

Β. Μιτογόνος ουσία είναι ……………… και ουσία που σταματάει την κυτταρική διαίρεση στην μετάφαση της μίτωσης είναι η…………………

α) φυτοαιματογλουτίνη , κολχικίνη

β) κολχικίνη, φυτοαιματογλουτίνη

γ) υπότονο διάλυμα , Giemsa

δ) Giemsa , υπότονο διάλυμα

Γ. Στον γενετικό κώδικα υπάρχουν ………………… αμινοξέα που κωδικοποιούνται μονοσήμαντα, ……………… αμινοξέα που κωδικοποιούνται από έξι κωδικόνια συνώνυμα μεταξύ τους και δεν υπάρχει κανένα αμινοξύ που να κωδικοποιείται από …………… συνώνυμα κωδικόνια.

α. 2, 4, 1

β. 2, 6, 7

γ. 2, 5, 3

δ. 2, 3, 5

4. Η αναδίπλωση των χρωμοσωμάτων των ευκαρυωτικών κυττάρων είναι σταδιακά από τη διπλή έλικα με διάμετρο…………….nm , σε …………….. 11 nm και κατόπιν σε ινίδιο χρωματίνης ………………… nm. Σε αυτό το στάδιο το χρωμόσωμα είναι παρατηρήσιμο με ……………….. …………….

5. Δίνεται το παρακάτω μόριο mRNA:

UACUACCACCAUGCCCAUGCCCGAGCGCUAGCCCAUG

α) Ποια είναι η κωδική αλυσίδα του γονιδίου που το κωδικοποιεί ;

β) Ποια είναι η μη-κωδική αλυσίδα του γονιδίου που κωδικοποιεί το RNA μόριο που συνδέεται με το 5ο κωδικόνιο;

γ) Ποια είναι η κωδική αλυσίδα του γονιδίου rRNA που αναγνωρίζει τμήμα τεσσάρων νουκλεοτιδίων στην 5αμετάφραστη περιοχή του mRNA ;

1.

Α) 3’ TACTACCACCATGCCCATGCCCGAGCGCTAGCCCATG 5’

B) 5’ ATGCCCTAGCGCGAGCCCATGCCCATGACCACTT3’

Γ) 5’ TACTACCACCATGCCCATGCCCGAGCGCTAGCCCATG3’

Δ)5’ΤACTACCCACCCATGCCCATGCCCGAGCGCTAGCCCATG3’

2.

A)5’AACCATGGAGCTCTGACCAA3’……

B)5’AACCATGCTCGTGTGACCAA3’…….

Γ)3’AACCCTCATGTGACTCCCAA…….

Δ)ΑACCATGCTCGTGTGACCAA5’…….

3.

A)5’ACCTACGCAC3’……..

B)3’ACGATGCACC5’……..

Γ)3’ATGCCCGAT5’………

Δ)3’CAGGTGGTGA5’……….

ΘΕΜΑ Β                                                                                                                                                                                   ΜΟΝΑΔΕΣ 25

Α. Να συμπληρωθεί ο πίνακας που παρουσιάζεται παρακάτω :

  1. 1. DNA<==> RNA–> ΠΟΛΥΠΕΠΤΙΔΙΟ
  1. 2. DNA—>  RNA—> ΠΟΛΥΠΕΠΤΙΔΙΟ
  2. 3. DNA—>RNA—> ΠΟΛΥΠΕΠΤΙΔΙΟ
  3. 4. DNA<===>  RNA—-> ΠΟΛΥΠΕΠΤΙΔΙΟ
  4. 5. DNA—-> RNA<===> ΠΟΛΥΠΕΠΤΙΔΙΟ
α) Μέσα σε ρετροϊούς.

β) Μιτοχόνδρια, κύτταρα, χλωροπλάστες.

γ) Κύτταρα μολυσμένα από ρετροϊούς.

δ) Κύτταρα μολυσμένα από RNA ιούς με δίκλωνο RNA.

ε) Μέσα σε ιούς

στ) Δεν έχει ανακαλυφθεί τέτοια περίπτωση σε έμβια όντα.

Σημείωση: Σε κάθε παραπάνω περίπτωση ισχύει και η αντιγραφή του DNA ενώ στην 1η και 3η περίπτωση ισχύει και η αντιγραφή RNA.

5 ΜΟΝΑΔΕΣ

Β. Σε ποια στάδια της έκφρασης της γενετικής πληροφορίας σ’ ένα ανθρώπινο κύτταρο βρίσκει εφαρμογή η συμπληρωματικότητα;


4 ΜΟΝΑΔΕΣ

Γ. Να υπολογιστεί το πλήθος των νουκλεοσωμάτων ενός ανθρώπινου γαμέτη, αν γνωρίζεται ότι υπάρχουν νουκλεοσώματα στα άκρα των χρωμοσωμάτων και μεταξύ δύο νουκλεοσωμάτων υπάρχουν 54 ζεύγη νουκλεοτιδίων.

5 ΜΟΝΑΔΕΣ

Δ. Ένας οργανισμός με γονιδίωμα 16 χρωμοσωμάτων πόσα μόρια DNA έχει το κάθε κύτταρο της 1ης μειωτικής διαίρεσης του. Σε ποσα ζευγάρια από τους κλώνους του DNA σε κάθε κύτταρο από αυτά τα κύτταρα, οι κλώνοι είναι πανομοιότυποι και σε πόσα είναι συμπληρωματικοί μεταξύ τους.

3+3 ΜΟΝΑΔΕΣ

Ε. Αντιστοιχίστε με ποιο τρόπο είναι δυνατή η παρατήρηση των κυτταρικών δομών της πρώτης στήλης με τις μεθόδους της δεύτερης στήλης.

1)ΜΟΡΙΟ DNA

2)NOYΚΛΕΟΣΩΜΑ

3)ΜΕΤΑΦΑΣΙΚΟ ΧΡΩΜΟΣΩΜΑ

4)ΠΛΑΣΜΙΔΙΟ

5)ΘΗΛΙΑ ΑΝΤΙΓΡΑΦΗΣ

α)ΚΡΥΣΤΑΛΛΟΓΡΑΦΙΑ ΑΚΤΙΝΩΝ Χ

β) ΗΛΕΚΤΡΟΝΙΚΟ ΜΙΚΡΟΣΚΟΠΙΟ

γ)ΟΠΤΙΚΟ ΜΙΚΡΟΣΚΟΠΙΟ

5 ΜΟΝΑΔΕΣ

ΘΕΜΑ Γ

Α. Δίνονται δύο βακτήρια διαφορετικού είδους που το καθένα διαθέτει από ένα πλασμίδιο.

Το βακτήριο (Α) διαθέτει το πλασμίδιο (α) που φέρει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό str και τον παράγοντα μεταφοράς F+, καθώς και το γονίδιο (i)

(P)

Γονίδιο (i)

GAAATGGAATTCTGAAAATTT Υ (P)

CTTTACCTTAAGACTTTTAAA Υ

Το πλασμίδιο (β) που διαθέτει το κύτταρο (B), έχει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό Amp , και το γονίδιο (ii)

Γονίδιο (ii)

                         Υ CCATCATCGAAATGGAATTCTGAAAATTTCCTATT

(P)Y GGTAGTAGCTTTACCTTAAGACTTTTAAAGGATAA

Όπου (P) φωσφορική ομάδα.

Μεταξύ των βακτηρίων (Α) και (Β) πραγματοποιήθηκε βακτηριακή σύζευξη. To βακτήριο δέκτης του πλασμιδίου, δεν μπορεί πλέον ν’ αξιοποιήσει λειτουργικά το προϊόν που κωδικοποιούσε πριν από τη σύζευξη του το γονίδιο του πλασμιδίου του, όμως, παραμένει ανθεκτικό στο αντιβιοτικό στο οποίο διέθετε ανθεκτικότητα, ενώ παράγει και τα προϊόντα που κωδικοποιουνται από το πλασμιδιο που δεχθηκε.

Σημείωση: Τα δύο πλασμίδια δεν ανασυνδυάζονται.

α. Τι γνωρίζεται για τα πλασμίδια; 5 ΜΟΝΑΔΕΣ

β. Ποια είναι η κωδική αλυσίδα του γονιδίου (ii) ; 1 ΜΟΝΑΔΑ

Αιτιολογήστε την απάντηση σας. 7 ΜΟΝΑΔΕΣ

γ. Εξηγήστε για ποιον λόγο το βακτήριο δέκτης, όπως αναφέρεται στην εκφώνηση, δεν μπορεί πλέον να χρησιμοποιεί το προϊόν της μεταγραφής του γονιδίου του. 7 ΜΟΝΑΔΕΣ

Β. Γνωρίζετε ότι η βακτηριακή DNA πολυμεράση κινείται με ταχύτητα 50 νουκλεοτίδια / δευτερόλεπτο. Σε πόσο χρόνο αναμένετε ότι θα ολοκληρωθεί η αντιγραφή του πλασμιδίου του βακτηρίου Α το οποίο έχει μέγεθος 5000 ζεύγη νουκλεοτιδίων;

Αν :

α) Στη θέση έναρξης της αντιγραφής του πλασμιδίου δημιουργείται μια θηλιά που αποτελείται από δύο αμφίδρομες διχάλες, όπου δρουν τέσσερα μόρια DNA πολυμερασών για την επιμήκυνση των νέων κλώνων.

β) Στη θέση έναρξης της αντιγραφής δημιουργείται μία θηλιά με δύο διχάλες αμφίδρομες , όπου δρουν δύο μόρια DNA πολυμερασών για την επιμήκυνση των νέων κλώνων.

3 ΜΟΝΑΔΕΣ

γ) Να αποδώσετε τα δύο σχήματα. 2 ΜΟΝΑΔΕΣ

ΘΕΜΑ Δ

Α. Σ’ ένα κύτταρο εκτελείται η διαδικασία της μετάφρασης, ένα ριβόσωμα φέρει ένα μόριο tRNA που μεταφέρει ένα πεπτίδιο με τριάντα πεπτιδικούς δεσμούς και μόλις μετακινείται κατά μία θέση, ώστε αυτό το tRNA να βρεθεί στην πρώτη θέση του ριβοσώματος. Το ολοκληρωμένο πρόδρομο πολυπεπτίδιο αποτελείται από 100 αμινοξέα. Σε ποια νουκλεοτίδια του μεταφράσιμου τμήματος του mRNA βρίσκεται το παραπάνω ριβόσωμα και σε ποια κωδικόνια ; 6 ΜΟΝΑΔΕΣ

Β. Ένα έμβρυο με καρυότοπο 46 χρωμοσωμάτων διαθέτει 3 χρωμοσώματα 21 και ένα φυλετικό χρωμόσωμα χ.

α) Πόσα μόρια DNA διαθέτει το έμβρυο αυτό στον καρυότοπο του;

β) Πόσους κλώνους DNA διαθέτει το έμβρυο αυτό στην φάση G1 ενός σωματικού κύτταρου του;

γ) Το έμβρυο αυτό πόσα ζεύγη ομόλογων χρωμοσωμάτων διαθέτει;
δ) Το έμβρυο αυτό είναι διπλοειδές άτομο;

ε) Το έμβρυο αυτό έχει πυρηνικό γονιδίωμα όσο και ένα φυσιολογικό κορίτσι; 5ΜΟΝΑΔΕΣ

Γ. Σας δίνεται το θραύσμα ενός μικρού ιικού γονιδίου που κωδικοποιεί για ένα ολιγοπεπτίδιο το οποίο έχει κοπεί με ένα ένζυμο περιορισμού κατά την κατασκευή γονιδιωματικής βιβλιοθήκης .

AAGGTTGAGAATGGGGCCCTTAATTGGCT

              AACTCTTACCCCGGGAATTAACCGATTCC

α) Να βρεθεί ο προσανατολισμός της ως προς τη θέση του υποκινητή.

β) Να βρεθεί η αλληλουχία της περιοριστικης ενδονουκλεασης που χρησιμοποιηθηκε κατά την κατασκευή της γονιδιωματικής βιβλιοθήκης αυτού του ιου που διαθέτει το παραπάνω γονίδιο. Το ένζυμο δρα με προσανατολισμό 5′ προς 3′ αναγνωρίζοντας μια αλληλουχία έξι ζευγών νουκλεοτιδιών.

γ) Να γραφεί το μόριο του RNA που θα προκύψει αν υποθέσουμε ότι είναι δυνατό το παραπάνω μόριο να μεταγράφει σε εκχύλισμα μιτοχονδρίων του ανθρώπου, όπως ακριβώς σας δίνεται.

1+2+3 ΜΟΝΑΔΕΣ

Δ. Ένα βακτήριο E. coli έχει μετασχηματιστεί μ’ ένα πλασμίδιο πάνω στο οποίο φέρεται ολόκληρο το φυσιολογικό οπερόνιο της λακτόζης αλλά απουσιάζει το ρυθμιστικό του γονίδιο.

Το βακτήριο αυτό ωστόσο, δεν μπορεί ν’ αναπτυχθεί σε περιβάλλον με μοναδική πηγή C τη λακτόζη.

Εξηγήστε δύο λόγους για τους οποίους είναι δυνατόν να γίνεται αυτό. 8 ΜΟΝΑΔΕΣ

ΚΑΛΗ ΕΠΙΤΥΧΙΑ

‘Υλη Βιολογίας Ομάδας Θετικού Προσανατολισμού, ποια είναι άραγε;

ΝΙΚΟΛΕΤΤΑ ΜΑΡΓΑΡΙΤΗ

Με αφορμή το ΦΕΚ 2893/2017 αρ. 134932/Δ2 σχετικά με την εξεταστέα ύλη, για τις εξετάσεις εισαγωγής στην Τριτοβάθμια Εκπαίδευση, του μαθήματος της Βιολογίας Θετικού Προσανατολισμού, από το οριζόμενο στο παραπάνω ΦΕΚ σχολικό εγχειρίδιο για το μάθημα αυτό.

Πιο συγκεκριμένα εντός εξεταστέας ύλης είναι;

Α) Ολόκληρο το κείμενο για τα κεφάλαια 1,2,4,5,6 και 9 ενώ για τα κεφάλαια 8 και 7 είναι το σύνολο του κειμένου των δύο αυτών κεφαλαίων με εξαίρεση τις εκτός εξεταστέας ύλης παραγράφους τους (μία για το 7ο κεφάλαιο «Η παραγωγή της Πενικιλίνης αποτελεί σημαντικό σταθμό στην πορεία της Βιοτεχνολογίας» και δύο για το 8ο κεφάλαιο «Εμβόλια, αντιβιοτικά»).

Β) Εντός εξεταστέας ύλης είναι όλες οι εικόνες του κάθε κεφαλαίου, με εξαίρεση όσες αφορούν τις εκτός ύλης παραγράφους των κεφαλαίων 7 και 8, ανεξαρτήτως του χρωματικού πλαισίου που περιβάλλει την κάθε εικόνα. Ενώ εντός ύλης προς εξέταση είναι και οι λεζάντες των εικόνων των παραπάνω κεφαλαίων. Όταν οι εικόνες παρουσιάζουν χημικούς τύπους τότε δεν απαιτείται η απομνημόνευση αυτών.

Γ) Είναι εντός εξεταστέας ύλης τα τμήματα του καθενός από τα παραπάνω κεφάλαια με τίτλο «Ταξίδι στο χρόνο».

Δ) Είναι εντός εξεταστέας ύλης η περίληψη που υπάρχει στο τέλος καθενός από τα παραπάνω κεφάλαια.

Ε) Είναι εντός εξεταστέας ύλης, οι εργασίες – δραστηριότητες σε οποιοδήποτε από τα παραπάνω κεφάλαια.

ΣΤ) Είναι εντός ύλης οι πίνακες που υπάρχουν σε καθένα από τα παραπάνω κεφάλαια.

Ζ) Είναι εντός εξεταστέας ύλης, οι ερωτήσεις στο τέλος κάθε κεφαλαίου.

Η) Είναι εντός εξεταστέας ύλης, τα τμήματα των παραπάνω κεφαλαίων με τίτλο «σκεφτείτε» σε οποιοδήποτε από τα κεφάλαια αυτά υπάρχουν τέτοια τμήματα.

Θ) Τέλος, ποιες από τις γνώσεις που έχουν αποκτήσει οι υποψήφιοι από τις προηγούμενες τάξεις της γυμνασιακής και λυκειακής τους εκπαίδευσης στο μάθημα της Βιολογίας και οι οποίες δεν αναφέρονται στο βιβλίο της Γ’ Λυκείου, όπως αυτό αναφέρεται στο παραπάνω ΦΕΚ, είναι δυνατόν να τους ζητηθούν άμεσα ή έμμεσα; (Εδώ νοούνται προϋπάρχουσες γνώσεις, οι οποίες είναι απαραίτητες για να γίνει κατανοητό ένα τμήμα ή μία έννοια στο βιβλίο της Γ’ Λυκείου, η οποία δεν αναλύεται επαρκώς στο βιβλίο της Γ΄ Λυκείου καθώς θεωρείται γνωστή από προηγούμενες τάξεις.)

Προκείμενου να γίνει ποιο σαφές το ερώτημα μου, θα φέρω το παράδειγμα (υπάρχουν πολλά παραδείγματα, άλλα επιλέγεται ένα πρόσφατο) των θεμάτων των εισαγωγικών εξετάσεων των ημερησίων λυκείων του 2016, όπου τέθηκε το παρακάτω ερώτημα πολλαπλής επιλογής:

«Θέμα Α. Ερώτημα Α3:

Τα σωματικά κύτταρα του προβάτου Dolly περιείχαν:

α. ανασυνδυασμένο DNA

β. Το σύνολο του γενετικού υλικού του κυττάρου του μαστικού αδένα εξάχρονου προβάτου που χρησιμοποιήθηκε στη διαδικασία της κλωνοποίησης.

γ. το γονίδιο που είναι υπεύθυνο για την σύνθεση  της α1-αντιθρυψίνης

δ. το μιτοχονδριακό DNA του ωαρίου στο οποίο τοποθετήθηκε ο πυρήνας του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το κεφάλαιο 9 του σχολικού βιβλίου της Γ΄ Λυκείου, τη διαδικασία κλωνοποίησης, τον ορισμό και τη δημιουργία διαγονιδιακών ζώων.

Από το κεφάλαιο 1 του σχολικού βιβλίου της Γ΄ Λυκείου, ότι τα μιτοχόνδρια είναι μητρικής προέλευσης.

Από το κεφάλαιο 4 του σχολικού βιβλίου της Γ΄ Λυκείου, τον ορισμό του ανασυνδυασμένου DNA.

Θα έπρεπε όμως, να γνωρίζει τη θέση των μιτοχονδρίων στα κύτταρα (ότι δηλαδή αυτά δεν βρίσκονται εντός του πυρήνα, άλλα στο κυτταρόπλασμα ενός ευκαρυωτικού κυττάρου) και ποια κύτταρα διαθέτουν μιτοχόνδρια (ευκαρυωτικά τόσο τα σωματικά όσο και οι γαμέτες), γνώσεις που απέκτησε από την Β’ Λυκείου!

Όμως στην σελίδα 149 του σχολικού βιβλίου της Β’ Λυκείου, υπάρχει το ένθετο με τίτλο ΝΤΟΛΥ. Το ένθετο αυτό στην τελευταία παράγραφο του αναφέρει: ” Το μητρικό πρόβατο είχε αποκτήσει με την βοήθεια της Γενετικής Μηχανικής , την ιδιότητα να παράγει γάλα με ινσουλίνη. Η ιδιότητα αυτή πέρασε φυσικά και στην κόρη της την Ντόλυ.”

Ποια είναι λοιπόν η σωστή απάντηση που πρέπει να επιλέξει ο μαθητής, η α (το γενετικό υλικό της Ντόλυ ήταν ανασυνδυασμένο με ανθρώπινο γενετικό υλικό, αφού έφερε το ανθρώπινο γονίδιο της ινσουλίνης στο πυρηνικό DNA της, μιας και το πυρηνικό γενετικό υλικό της, ήταν πανομοιότυπο με το πυρηνικό γενετικό υλικό του μαστικού σωματικού κυττάρου του εξάχρονου προβάτου που χρησιμοποιήθηκε ως κύτταρο δότης του πυρήνα) ή η δ; (στο πρώτο κεφάλαιο του βιβλίου της Γ΄ Λυκείου, αναφέρεται ότι τα μιτοχόνδρια είναι μητρικής προέλευσης και η εξήγηση αυτού δίνεται στο ένθετο (που είναι εκτός ύλης, σύμφωνα με το αναφερόμενο παραπάνω ΦΕΚ!) του κεφαλαίου 5 του ίδιου βιβλίου, όπου αναφέρεται ότι τα σπερματοζωάρια φέρουν τα μιτοχόνδρια τους στην ουρά τους και κατά την γονιμοποίηση, η ουρά του σπερματοζωαρίου δεν εισέρχεται στο ωάριο. Όμως για να επιλέξει ο μαθητής αυτή την απάντηση, που θεωρήθηκε και η μοναδική σωστή από την ΚΕΕ, πρέπει να γνωρίζει ότι τα μιτοχόνδρια του ωαρίου δεν είναι στον πυρήνα του, αλλά στο κυτταρόπλασμα του, ώστε να ξέρει ότι τα μιτοχόνδρια του διπλοειδούς κυττάρου που έδωσε την Ντόλυ, ήταν εκείνα που υπήρχαν στο κυτταρόπλασμα του απύρηνου ωαρίου που χρησιμοποιήθηκε και όχι στον πυρήνα του μαστικού σωματικού κυττάρου, του οποίου ο πυρήνας χρησιμοποιήθηκε. Ωστόσο, τη γνώση, ότι τα μιτοχόνδρια δεν βρίσκονται στον πυρήνα των ευκαρυωτικών κυττάρων, άλλα στο κυτταρόπλασμα τους, οι μαθητές την απέκτησαν στην β’ Λυκείου. Στο βιβλίο της Γ’ Λυκείου, δεν γίνεται σε κανένα σημείο του οποιαδήποτε τέτοια αναφορά, εκτός από την εικόνα 1.9. όπου όμως δεν διευκρινίζεται ποιος είναι ο πυρήνας του κυττάρου καθώς και στο απόσπασμα στο κεφ. 1 “Στα ευκαρυωτικά κύτταρα το γενετικό υλικό κατανέμεται στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. Συνήθως όμως ο όρος γονιδίωμα αναφέρεται στο γενετικό υλικό που βρίσκεται στον πυρήνα” όπου όμως και πάλι δεν γίνεται σαφές ότι τα μιτοχόνδρια δεν είναι εντός του πυρήνα). Πώς λοιπόν, μπορεί να διαλέξει ο μαθητής τη μοναδική σωστή απάντηση, αφού αν δεν κάνει χρήση των γνώσεων που απέκτησε από την βιολογία γενικής παιδείας της Β’ Λυκείου, δεν μπορεί να επιλέξει την απάντηση δ. Αλλά, από την άλλη πλευρά, αν χρησιμοποιήσει τις γνώσεις της Β’ Λυκείου, τότε σωστή απάντηση είναι και η α.

Ένας μαθητής δηλαδή της Γ’ Λυκείου που δίνει εισαγωγικές εξετάσεις οφείλει να γνωρίζει από τη Β’ Λυκείου που βρίσκονται τα μιτοχόνδρια, ώστε μπορεί να αποκλείσει την επιλογή β στο παραπάνω ερώτημα κλειστού τύπου και να επιλέξει το δ, αλλά δεν πρέπει να γνωρίζει τι λέει το σχολικό βιβλίο της Β’ Λυκείου για την Ντόλυ, ώστε να μην επιλέξει το α;

Επίσης να παρατηρηθεί ότι:

Ι) Στο αναφερόμενο ΦΕΚ και στο οριζόμενο από αυτό εξεταζόμενο σχολικό βιβλίο ορίζονται ως εκτός εξεταστέας ύλης, τα τμήματα του σχολικού βιβλίου με τίτλο:

i) Παραθέματα

ii) «Ας ερευνήσουμε …» στο τέλος κάθε κεφαλαίου.

Τα τμήματα αυτά δεν απαντώνται σε κανένα σημείο του βιβλίου όπως αυτό ορίζεται από το προαναφερόμενο ΦΕΚ!

Σημείωση: Παρακαλώ όπως ενημερωθώ μεσώ ηλεκτρονικού ταχυδρομείου για τον αριθμό πρωτοκόλλου που έλαβε η επιστολή μου.

ΜΑΡΓΑΡΙΤΗ ΝΙΚΟΛΕΤΤΑ

ΕΚΠΑΙΔΕΥΤΙΚΟΣ

Συνημμένα:

1.Απόσπασμα του αναφερόμενου ΦΕΚ

2.Αποσπάσματα από τα βιβλία της Β’ και Γ’ Λυκείου.

3.Απόσπασμα των θεμάτων των Ημερήσιων Λυκείων 2016 στη Βιολογία Ομάδας Θετικού Προσανατολισμού.

Λύσεις Βιολογίας θετικού προσανατολισμού Πανελληνίων εξετάσεων 2017 – Ημερήσια

Βιολογία Ομάδας Θετικού Προσανατολισμού

ΘΕΜΑΤΑ 2017 ΗΜΕΡΗΣΙΑ ΓΕΛ:  Οι Απαντήσεις

ΘΕΜΑ Α

Οι ζητούμενες απαντήσεις, είναι :

A1: δ , Α2 : δ , Α3 : β , Α4 : γ , Α5 : α

ΘΕΜΑ Β

B1

Ι → Α

Ι Ι → Ε

ΙΙΙ → ΣΤ

ΙVB

VZ

VI →Γ

VII → Δ

Β2

Η δοθείσα εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο.

Αιτιολόγηση : Γνωρίζουμε ότι στα προκαρυωτικά κύτταρα οι διαδικασίες της μεταγραφής ενός γονιδίου που κωδικοποιεί για μόριο mRNA και της μετάφρασης αυτού του μορίου mRNA, συμβαίνουν ταυτόχρονα. Δηλαδή, πριν ολοκληρωθεί η μεταγραφή, έχει ήδη ξεκινήσει η μετάφραση του νεοσυντιθέμενου μορίου mRNA καθώς είναι άμεσα δυνατή η πρόσδεση της μικρής ριβοσωμικής υπομονάδας στην 5′ αμετάφραστη περιοχή του mRNA. Αυτό είναι δυνατό καθώς τα βακτηριακά κύτταρα δεν διαθέτουν πυρηνική μεμβράνη και επομένως το μόριο DNA βρίσκεται στο κυτταρόπλασμα στην περιοχή του πυρηνοειδούς μαζί με τα ριβοσώματα, τα οποία είναι τα ειδικά σωματίδια του κυττάρου, που μαζί με άλλα μόρια (π.χ tRNA , rRNA κ.α ) και αρκετή ενέργεια πραγματοποιούν την διαδικασία της πρωτεϊνοσύνθεσης του κυττάρου.

Β3

Το ιδανικό φάρμακο είναι εκείνο που δεν επιφέρει καμία παρενέργεια στον οργανισμό ενώ ταυτόχρονα θεραπεύει αποτελεσματικά. Το ιδανικό φάρμακο είναι τα αντισώματα.

Τα αντισώματα είναι πρωτεϊνικά μόρια που παράγει ο οργανισμός των θηλαστικών (και των πτηνών) και έχουν την δυνατότητα να συνδέονται εκλεκτικά με ένα ορισμένο τμήμα ( αντιγονικός καθοριστής ) ενός ξένου προς τον οργανισμό σώματος (αντιγόνο).

Το αντιγόνο είναι ξένη προς τον οργανισμό ουσία που μπορεί να προκαλέσει ανοσολογική απόκριση, δηλαδή παραγωγή από τον οργανισμό ειδικών κυττάρων (λεμφοκυττάρων) και κυτταρικών προϊόντων ( π.χ αντισώματα) που θα δράσουν για την εξουδετέρωση του.

Τα αντισώματα παράγονται από τα Β-λεμφοκύτταρα του οργανισμού, κάθε διαφορετικό Β-λεμφοκύτταρο παράγει συγκεκριμένο διαφορετικό αντίσωμα, κατάλληλο για την αναγνώριση και την σύνδεση του μ’ έναν συγκεκριμένο αντιγονικό καθοριστή. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων είναι όλα όμοια μεταξύ τους και ονομάζονται μονοκλωνικά αντισώματα.

Τα μονοκλωνικά αντισώματα βρίσκουν πολλές εφαρμογές ως διαγνωστικά εργαλεία στην Βιολογία και την Ιατρική. Τα μονοκλωνικά αντισώματα δεν μπορούν να παραχθούν σε μεγάλες ποσότητες από τα Β-λεμφοκύτταρα όταν αυτά αναπτύσσονται σε κυτταροκαλλιέργειες in vitro καθώς τα φυσιολογικά Β – λεμφοκύτταρα (κυτταρική σειρά) δεν μπορούν να διαιρεθούν περισσότερες από 50 με 70 φορές, μιτωτικά, στην κυτταροκαλλιέργεια.

Προκειμένου λοιπόν να παραχθούν τα μονοκλωνικά αντισώματα που θέλουμε σε μεγάλες ποσότητες, πρέπει να συντηχθούν τα ειδικά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα (τα κύτταρα αυτά έχουν παραχθεί σε ένα ποντίκι εμβολιασμένο με τον επιθυμητό αντιγονικό καθοριστή, το οποιο πραγματοποιεί πρωτογενή ανοσοβιολογική απόκριση εναντίον αυτού του αντιγονικού καθοριστή) με καρκινικά Β-λεμφοκύτταρα ποντικού (μυέλωμα). Τα κύτταρα που προκύπτουν από την σύντηξη, ονομάζονται υβριδώματα και εμφανίζουν τις δύο ιδιότητες που θέλουμε, να παράγουν τα επιθυμητά αντισώματα και να διαιρούνται για πολύ περισσότερες φορές από 50-70 διαιρέσεις σε κυτταροκαλλιέργεια in vitro. Η τελευταία ιδιότητα είναι ιδιότητα των καρκινικών κυττάρων.

Έτσι προκειμένου να παράγουμε μονοκλωνικά αντισώματα που αναγνωρίζουν και συνδέονται με την χορειακή γοναδοτροπίνη του ανθρώπου ώστε να δημιουργήσουμε ένα ευαίσθητο διαγνωστικό έλεγχο για την εγκυμοσύνη στα πρώτα στάδια της, πρέπει :

α) Να χορηγήσουμε με ένεση σ’ ένα υγιές ποντίκι, ανθρώπινη χορειακή γοναδοτροπίνη, που έχουμε απομονώσει από γυναίκα που είναι έγκυος στα πρώτα στάδια της εγκυμοσύνης. Θεωρούμε δεδομένο ότι το ποντίκι δεν παράγει χορική γοναδοτροπίνη όμοια με του ανθρώπου, ώστε η ανθρώπινη ορμόνη να λειτουργήσει ως αντιγόνο σε αυτό. Επίσης, το ποντίκι που εμβολιάστηκε με την ανθρώπινη ορμόνη, ζει σε στείρο περιβάλλον ώστε να μην παράγει κατά το δυνατό αλλά αντισώματα, διαφορετικά από τα ζητούμενα, ώστε να διευκολυνθούμε στην απομόνωση των κατάλληλων Β-λεμφοκυττάρων

β) 15 μέρες μετά τον εμβολιασμό του, όταν έχει μεγιστοποιηθεί η ανοσολογική πρωτογενής αντίδραση του ποντικιού έναντι της ανθρώπινης ορμόνης, από το ποντίκι αφαιρείται ο σπλήνας του. Ο σπλήνας είναι δευτερογενές λεμφικό όργανο των θηλαστικών, στο οποίο πραγματοποιείται η ανοσολογική απόκριση .Επομένως, στον σπλήνα θα υπάρχουν πολλά Β-λεμφοκύτταρα του ποντικιού που παράγουν το επιθυμητό αντίσωμα.

γ) Από τον σπλήνα του ποντικιού απομακρύνονται τα επιθυμητά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα .

δ) Τα κατάλληλα Β-λεμφοκύτταρα του ποντικιού συντήκονται με καρκινικά Β-λεμφοκύτταρα ποντικιού που αναπτύσσονται σε κυτταροκαλλιέργεια (μυέλωμα). Τα προϊόντα της κυτταρικής σύντηξης ονομάζονται υβριδώματα. Τα Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντισωμα δίνουν στο υβρίδωμα τη δυνατότητα να παράγει το επιθυμητό αντισωμα και τα καρκινικά κύτταρα προσδίδουν αθανασία.

ε) Από τα υβριδώματα που παράγονται κάποια ευαισθητοποιούνται με την ανθρώπινη χορειακή γοναδοτροπίνη, όποτε κλωνοποιούνται (μιτωτικά) και στην συνέχεια κατά ένα μέρος τους διαφοροποιούνται σε πλασματοκύτταρα, τα οποία παραγάγουν και εκκρίνουν μεγάλες ποσότητες του επιθυμητού αντισώματος ενώ τα υπόλοιπα φυλάγονται στην κατάψυξη (-800C) για μεταγενέστερη χρήση.

Τα παραγόμενα από τα κατάλληλα υβριδώματα, μονοκλωνικά αντισώματα, που αναγνωρίζουν την ανθρώπινη χορειακή γοναδοτροπίνη, μπορούν τώρα να χρησιμοποιηθούν ως διαγωνιστικά εργαλεία για τον έλεγχο της ύπαρξης κύησης, κυρίως σε γυναίκες που βρίσκονται στα πρώτα στάδια της εγκυμοσύνης.

Η λήψη αίματος από μια γυναίκα που επιθυμεί να μάθει αν είναι έγκυος και η χρήση των μονοκλωνικών αντισωμάτων για τον ποσοτικό και ποιοτικό προσδιορισμό της χορειακής γοναδοτροπίνης της, μας επιτρέπει να γνωρίζουμε αν είναι έγκυος (εφόσον διαθέτει την ορμόνη στο αίμα της, ποιοτικός έλεγχος) και σε ποια αρχική εβδομάδα της κύησης βρίσκεται (ανάλογα με την ποσότητα της ορμόνης που εντοπίστηκε) .

Β4

Η τεχνολογία του ανασυνδυασμένου DNA έχει δώσει τη δυνατότητα δημιουργίας γονιδιωματικών βιβλιοθηκών των οργανισμών.

Η γονιδιωματική βιβλιοθήκη ενός οργανισμού είναι το σύνολο των βακτηρικών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό (με άγαρ) και κάθε κλώνος φέρει ενσωματωμένο σε ένα μόριο φορέα κλωνοποίησης (πλασμίδιο ή DNA λ-φάγου αντιστοίχως) ένα ορισμένο τμήμα από το DNA του οργανισμού, του οποίου δημιουργούμε την βιβλιοθήκη.

Αυτό το τμήμα του DNA του οργανισμού δότη του γενετικού υλικού (δηλαδή του οργανισμού του οποίου δημιουργούμε την γονιδιωματική βιβλιοθήκη), υπάρχει σε πολλαπλά αντίγραφα σε κάθε κλώνο της βιβλιοθήκης, δηλαδη, το DNA του οργανισμού δότη έχει κλωνοποιηθεί.

Το σύνολο των κλώνων της γονιδιωματικής βιβλιοθήκης φέρει το σύνολο του γονιδιώματος του οργανισμού δότη (συνήθως χωρίς το μιτοχόνδριακό ή/και το χλωροπλαστικό DNA -το τελευταίο μόνο σε περίπτωση φυτικού οργανισμού- αναφερόμενο σε ευκαρυωτικό οργανισμό) σε πολλά διαφορετικά τμήματα σε πολλά αντίγραφα το κάθε τμήμα. Γονιδιωματικές βιβλιοθήκες δημιουργούνται και για προκαρυωτικούς και για ευκαρυωτικούς οργανισμούς.

Γνωρίζουμε ότι τα κύτταρα ενός πολυκυτταρικού οργανισμού φέρουν όλα τα ίδιο γενετικό υλικό (εκείνο το DNA, του ζυγωτού του οργανισμού αυτού) αφού όλα είναι προϊόντα μίτωσης του πρώτου διπλοειδούς κυττάρου (ζυγωτό) αυτού του οργανισμού. ‘Έτσι όλα τα απόγονα κύτταρα από την μίτωση κυττάρων που διαιρούνται, ενός ζωικού οργανισμού, όπως είναι τα μυϊκά και τα ηπατικά, θα φέρουν το ίδιο DNA (θεωρούμε ότι δεν έχουν συμβεί καινοφανείς μεταλλάξεις στα όργανα αυτά).

Η δημιουργία της γονιδιωματικής βιβλιοθήκης ενός οργανισμού περιλαμβάνει τα εξής βήματα:

Α) Απομόνωση κυττάρων του οργανισμού π.χ μυϊκά ή/και ηπατικά.

Β) Απομόνωση του DNA των κυττάρων αυτών, με λύση των κυττάρων.

Γ) Πέψη του DNA των κυττάρων αυτών με μία ορισμένη περιοριστική ενδονουκλέαση π.χ EcoRI. H περιοριστική ενδονουκλέαση αναγνωρίζει και κόβει με συγκεκριμένη φορά, μία ορισμένη δίκλωνη αλληλουχία DNA μήκους 4-8 ζευγών βάσεων. Η EcoRI για παράδειγμα αναγνωρίζει την δίκλωνη αλληλουχία:

5’GAATΤC3’

3’CTTAAG5’

και κόβει μεταξύ του G και του Α με προσανατολισμό 5’→3’ αφήνοντας αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα). Κάθε περιοριστικό ένζυμο δημιουργεί τέτοια κολλώδη άκρα όπως αυτά προκύπτουν με βάση την αλληλουχία αναγνώρισης DNA που αναγνωρίζει αυτό το ένζυμο. Για την EcoRI:

 

5’G 3′           5′ AATΤC3’

3’CTTAA 5′           3′G5’

AATT : κολλώδες άκρο Ι

TTAA : κολλώδες άκρο ΙΙ

Τα κολλώδη άκρα Ι και ΙΙ είναι συμπληρωματικά. Κάθε περιοριστικό ένζυμο κόβει το δίκλωνο DNA σε δυο φωσφοδιεστερικούς δεσμούς 3’→5’ και το ανάλογο πλήθος δεσμών υδρογόνου, σύμφωνα με την αλληλουχία αναγνώρισης του. Η ΕcoRI σπάει 8 δεσμούς υδρογόνου μεταξύ των 4 ζευγών βάσεων Α και Τ.

Δ) Απομόνωση κατάλληλου φορέα κλωνοποίηση, πλασμίδιο ή DNA φαγού λ και πέψη του φορέα κλωνοποίησης με το ίδιο περιοριστικό ένζυμο που χρησιμοποιήθηκε στο προηγούμενο βήμα, ώστε να δημιουργηθούν συμπληρωματικά κολλώδη άκρα .

Ε) Ανάμιξη και ανασυνδυασμός των τμημάτων DNA του οργανισμού δότη και των κομμένων φορέων κλωνοποίησης με την προσθήκη DNA δεσμάσης για την ένθεση – δημιουργία δυο 3′->5′ φωσφοδιεστερικων δεσμών ανα σημειο συνδεσης- ενός τμήματος DNA του οργανισμού δότη σε έναν φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακους φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου της καλλιέργειας (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών, για την ανάπτυξη αποικιών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Εφόσον σύμφωνα με τα δεδομένα της εκφώνησης τα ένζυμα και οι τεχνικές που χρησιμοποιούνται είναι ίδια τόσο για τη δημιουργία της βιβλιοθήκης του ηπατικού όσο και του μυϊκού κυττάρου, οι δύο γονιδιωματικές βιβλιοθήκες θα είναι ίδιες, εφόσον δεν φέρουν τα κύτταρα που απομονώσαμε από αυτά τα όργανα μεταλλάξεις.

cDNA βιβλιοθήκη ενός κυτταρικού τύπου ενός ευκαρυωτικού οργανισμού είναι το σύνολο των βακτηριακών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό και φέρουν σε πολλαπλά αντίγραφα, το ολικό ώριμο mRNA του κυτταρικού τύπου με τη μορφή δίκλωνου DNA ενσωματωμένο σε φορείς κλωνοποίησης (πλασμίδια ή DNA λ-φάγου, αντιστοίχως).

Η διαδικασία δημιουργίας της cDNA βιβλιοθήκης ενός κυτταρικού τύπου εν συντομία, είναι:

Α) Απομόνωση κυττάρων του κυτταρικού τύπου του οργανισμού π.χ μυϊκά ή ηπατικά στο κατάλληλο αναπτυξιακό στάδιο στην επιθυμητή φάση του κυτταρικού κύκλου των κυττάρων, στις επιθυμητές συνθήκες για τον οργανισμό.

Β) Απομόνωση του ολικού ώριμου mRNA των κυττάρων αυτών με ήπια λύση των κυττάρων.

Γ) Χρήση του ολικού ωρίμου mRNA ως καλούπι για την σύνθεση cDNA με την βοήθεια της αντίστροφης μεταγραφάσης.

Δ) Δημιουργία δίκλωνου DNA από το cDNA με την βοήθεια της DNA πολυμεράσης.

Ε) Ένθεση του δίκλωνου DNA, μετά από κατάλληλη κατεργασία, σε φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακούς φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους αντιστοίχως.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Η cDNA βιβλιοθήκη ενός κυτταρικού τύπου διαφέρει ανάλογα με το αναπτυξιακό στάδιο του οργανισμού καθώς και την φάση των κυττάρων του οργανισμού δότη, που έγινε η απομόνωση του ολικού ώριμου mRNA των κυττάρων του, εξαιτίας του γεγονότος ότι, διαφορετικά γονίδια εκφράζονται σε κάθε χρονική στιγμή.

Επίσης, η cNAD βιβλιοθήκες δύο διαφορετικών κυτταρικών τύπων του ίδιου οργανισμού, την ίδια χρονική στιγμή, διαφέρουν εξαιτίας της κυτταρικής διαφοροποίησης, δηλαδή της επιλεκτικής έκφρασης διαφορετικών γονιδίων από κάθε κύτταρο που ανήκει σε διαφορετικό κυτταρικό τύπο του ίδιου οργανισμού, όπως το ήπαρ και οι μύες, ώστε κάθε κύτταρο του κάθε κυτταρικού τύπου, να διαθέτει τις κατάλληλες πρωτεΐνες για την σωστή δομή και λειτουργία του, στο ορισμένο αναπτυξιακό στάδιο του οργανισμού και τις συνθήκες που επικρατούν στον οργανισμό και στο περιβάλλον του, έτσι ώστε να ανταποκριθούν καταλλήλως τα κύτταρα του κάθε κυτταρικού τύπου.

Βεβαίως κάθε κύτταρο ενός οργανισμού παράγει και πρωτεΐνες που είναι αναγκαίες για τις βασικές λειτουργίες του όπως π.χ τις λειτουργίες της μεταγραφής και της μετάφρασης καθώς και της αντιγραφής για τα μυϊκα και τα ηπατικά κύτταρα, τα οποία διαιρούνται. Επομένως, οι cDNA βιβλιοθήκες ενός ηπατικού και ενός μυϊκού κυττάρου αναμένεται να έχουν πολλούς διαφορετικούς κλώνους και ορισμένους κοινούς κλώνους.

ΘΕΜΑ Γ

Γ1

Θεωρούμε ότι η α1 αντιθρυψίνη που αναφέρεται στην εκφώνηση του ερωτήματος είναι η πρωτεΐνη του ανθρώπου που παράγεται στο ήπαρ και η έλλειψη της οδηγεί σε πνευμονικό εμφύσημα.

Γνωρίζουμε ότι μπορούμε σήμερα να δημιουργήσουμε διαγονιδιακά ζώα, δηλαδή ζώα, που με την τεχνολογία του ανασυνδυασμένου DNA, φέρουν ένα ετερόλογο γονίδιο, δηλαδή γονίδιο ενός άλλου είδους όπως παραδείγματος χάριν του ανθρώπου, στο γονιδίωμά τους. Τα ζώα αυτά χρησιμοποιούνται σήμερα ως εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών (gene farming) καθώς είναι δυνατή η έκφραση των ανθρώπινων γονιδίων από τα ζωικά κύτταρα.

Για να εκφράσει ένα γονίδιο πρέπει στα κύτταρα του κυτταρικού τύπου του ευκαρυωτικού οργανισμού οπου θα εκφράζεται αυτό το γονίδιο, να υπάρχουν οι κατάλληλοι μεταγραφικοί παράγοντες οι οποιοι αναγνωρίζουν και συνδέονται με τον υποκινητή του γονιδίου αυτού, δηλαδή του γονιδίου, που εκφράζεται. Μόνο όταν ο σωστός συνδυασμός μεταγραφικών παραγόντων έχει συνδεθεί στον υποκινητή του γονιδίου, είναι δυνατή η σύνδεση της RNA πολυμεράσης με τον υποκινητή του γονιδίου αυτού, ώστε να ξεκινήσει σωστά η μεταγραφή του.

Επίσης δεδομένου ότι ο γενετικός κώδικας είναι σχεδόν καθολικός, δηλαδή όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα και σε συνδυασμό με το γεγονός πως τα ριβοσώματα των οργανισμών μπορούν να χρησιμοποιηθούν ως θέσεις πρωτεινοσυνθεσης για οποιοδήποτε μόριο mRNA οποιουδήποτε οργανισμού ή ιού. Το ζωικό κύτταρο θα μπορεί να μεταφράσει το mRNA που θα προκύψει από την μεταγραφή του ανθρώπινου γονιδίου, το οποίο είναι ενσωματωμένο κατάλληλα στο γονιδίωμα του ζώου.

Ένα διαγονιδιακό ζώο που θέλουμε να παράγει την ανθρώπινη α1-αντιθρυψίνη στα μαστικά του κύτταρα, θα πρέπει να έχει δημιουργηθεί με τέτοιο τρόπο ώστε το ανθρώπινο γονίδιο που με μικροέγχυση έχει εισέλθει στο γονιμοποιημένο ωράριο του ζώου, να έχει τοποθετηθεί στο γονιδίωμα του ζώου με τέτοιο τρόπο, ώστε να βρίσκεται υπό τον έλεγχο του υποκινητή ενός γονιδίου του ζώου, το οποίο εκφράζεται αποκλειστικά στα μαστικά κύτταρα. Τέτοιο γονίδιο του ζώου, είναι το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος του ζώου.

Σύμφωνα με τα δεδομένα της εκφώνησης, το ανθρώπινο γονίδιο της α1-αντιθρυψίνη έχει τοποθετηθεί με το σωστό προσανατολισμό μέσα στο γονίδιο της καζεΐνης του γάλακτος του ζώου, δηλαδή η κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης έχει τοποθετηθεί με το 5’ άκρο της προς τον υποκινητή του γονιδίου της ζωικής καζεΐνης και συνεπώς η μη-κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης θα έχει το 3’άκρο της προς τον υποκινητή του γονιδίου της καζεΐνης του ζώου. Έτσι , κατά την μεταγραφή του γονιδίου της καζεΐνης του ζώου από την RNA πολυμεράση του ζώου, θα μεταγράφεται η μη κωδική αλυσίδα του γονιδίου της ανθρώπινης α1-αντιθρυψίνης. ‘Έτσι το ζωικό κύτταρο στη συνέχεια, μετά την μεταγραφή του γονιδίου της ανθρώπινης α1-αντιθρυψίνης, θα ωριμάσει αρχικά (αν το ανθρώπινο γονίδιο δεν έχει απομονωθεί από cDNA βιβλιοθήκη ανθρωπίνων ηπατικών κυττάρων) και θα μεταφράσει στη συνέχεια, το κατάλληλο mRNA για την παραγωγή της ανθρώπινης πρωτεΐνης σε πρόδρομη μορφή. Η λειτουργική πρωτεΐνη α1-αντιθρυψίνη του ανθρώπου, θα δημιουργηθεί από τους μετά-μεταφραστικούς μηχανισμούς του ζώου, που δεν διαφέρουν από εκεινους του ανθρώπου καθώς και τα δυο είδη είναι θηλαστικά.

Γ2

Μας δίνεται το δίκλωνο γραμμικό τμήμα DNA:

5’GAATTCCGCAAATTAA

3’CTTAAGGCGTTTAATT5’

To οποίο πέπτεται από το περιοριστικό ένζυμο ΕcoRI . Το περιοριστικό ένζυμο EcoRI αναγνωρίζει την δίκλωνη αλληλουχία

5’GAATTC3’

3’ CTTAAG5’

και κόβει με προσανατολισμό 5’→3’ μεταξύ του G και Α σπάζοντας τους φοσφωδιεστερικούς δεσμούς μεταξύ τους και ταυτόχρονα σπάει και τους 8 δεσμούς υδρογόνου μεταξύ των συμπληρωματικών ζευγών Α και Τ, αφήνοντας μονόκλωνες αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα).

Δηλαδή μετά την επίδραση της EcoRI το δοθέν τμήμα DNA πέπτεται ως εξής, εφόσον φέρει μοναδική θέση αναγνώρισης του περιοριστικού ενζύμου στα αριστερά.

ΕΙΚΟΝΑ Α

5’G3΄            5΄AATTCCGCAAATTAA

3’CTTAA5΄           3′ GGCGTTTAATT5’

3′ TTAA5’ KOΛΛΩΔΕΣ ΑΚΡΟ Ι

AATΤ ΚΟΛΛΩΔΕΣ ΑΚΡΟ ΙΙ

Η τεχνολογία του ανασυνδυασμένου DNA είναι το σύνολο των τεχνικών και των μεθόδων που μας επιτρέπουν την επέμβαση μας στο γενετικό υλικό των οργανισμών.

Μέσω της τεχνολογίας αυτής είναι δυνατή η ένθεση ενός γραμμικού δίκλωνου τμήματος DNA, που έχει κοπεί σε δύο σημεία με την ίδια περιοριστική ενδονουκλέαση, ώστε να φέρει στα δύο άκρα του συμπληρωματικά κολλώδη άκρα. Το τμήμα αυτό μπορεί να ενθεθει σ΄ ένα πλασμίδιο, όταν το πλασμίδιο έχει κοπεί σε μοναδικό σημείο από την ίδια περιοριστική ενδονουκλέαση ώστε να φέρει συμπληρωματικά κολλώδη άκρα στο σημείο τομής.

2017 Blog 8-9-01

Όπως προκύπτει από τις εικόνες Α και Β είναι αδύνατη η έκθεση του τμήματος που μας δίνεται σε πλασμίδιο που έχει κοπεί μία φορά με το ΕcoRI, καθώς το τμήμα που μας δίνεται διαθέτει μόνο μία φορά την αλληλουχία που αναγνωρίζεται από την ΕcoRI και επομένως φέρει ένα μονάχα κολλώδες άκρο στην μία ακριανή πλευρά του (εικόνα Α).

Η ένθεση του τμήματος που μας δίνεται θα ήταν εφικτή με το δοθέν πλασμίδιο, μονάχα αν ήταν δυνατό να προστεθεί το κατάλληλο κολλώδες άκρο, με την βοήθεια κατάλληλου ενζύμου, στο δεξιό άκρο του τμήματος μας.

Γ3

Σύμφωνα με τα δεδομένα της εκφώνησης έχουμε το παρακάτω γενεαλογικό δέντρο:

2017 Blog 8-9-01 extra 1

Η μελέτη της κληρονομικότητας στον άνθρωπο εμφανίζει πολλές δυσκολίες καθώς ο άνθρωπος δεν εμφανίζει τα χαρακτηριστικά του κατάλληλου οργανισμού μοντέλου για την Γενετική. Ο άνθρωπος έχει μεγάλο χρόνο γενεάς, αφήνει λίγους απογόνους και δεν επιδέχεται επιλεκτικές διασταυρώσεις. Επομένως, η μελέτη της Γενετικής του ανθρώπου γίνεται με την δημιουργία γενεαλογικών δέντρων, δηλαδή μιας διαγραμματικής απεικόνισης των γάμων και των γεννήσεων μιας οικογένειας για πολλές γενεές .

Σύμφωνα με τα δεδομένα της άσκησης μια γυναίκα (Γ1) παντρεύτηκε με δύο διαφορετικούς συζύγους στην διάρκεια της ζωής της και απέκτησε με τον καθένα από ένα παιδί .

Η γυναίκα έχει ομάδα αίματος 0, και ο ένας σύζυγος της έχει ομάδα αίματος ΑΒ (Σ1) ενώ ο άλλος έχει ομάδα αίματος Α (Σ2). Το παιδί Π1 έχει ομάδα αίματος 0 και το παιδί Π2 έχει ομάδα αίματος Β.

Γνωρίζουμε ότι η ταυτοποίηση των ομάδων αίματος του ανθρώπου μπορεί να γίνει με τη χρήση κατάλληλων διαγνωστικών εργαλείων, όπως είναι τα μονοκλωνικά αντισώματα.

Ένα άτομο με ομάδα αίματος 0 δεν εμφανίζει κανένα αντιγόνο ούτε Α, ούτε Β στην επιφάνεια των ερυθροκυττάρων του, επομένως κατά την ταυτοποίηση με αντι-Α-αντισώματα και αντί-Β-αντισώματα, δεν θα πραγματοποιηθεί ανοσολογική αντίδραση in vitro, μεταξύ των ερυθροκυττάρων του ατόμου και των αντί-Α και αντί-Β αντισωμάτων.

Ένα άτομο με ομάδα αίματος ΑΒ θα εμφανίζει στην επιφάνεια των ερυθροκυττάρων του και το αντιγόνο Α και το αντιγόνο Β και in vitro, θα εμφανίζει ανοσολογική αντίδραση με τα δυο διαφορετικά είδη αντισωμάτων που αναγνωρίζουν αυτά τα αντιγόνα. Ομοίως σκεπτόμενοι, άτομα με ομάδα αίματος Α αντιδρά ανοσολογικά μόνο με το αντι-Α-αντίσωμα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με τα αντί-Α-αντίσωματα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με το αντι-Β-αντίσωματα.

Γνωρίζουμε ότι το γονίδιο Ι που ελέγχει για τις ομάδες αίματος είναι αυτοσωμικό και έχει τρία πολλαπλά αλληλόμορφα τα ΙΑ, ΙΒ , και i . Τα ΙΑ και ΙΒ είναι συνεπικρατή μεταξύ τους και επικρατούν του i. Tο αλληλόμορφο ΙΑ κωδικοποιεί για μια πρωτεΐνη που μετατρέπει μια πρόδρομη ουσία σε αντιγόνο Α, το οποίο τοποθετείται στην επιφάνεια των ερυθροκυττάρων. Ομοίως το ΙΒ κωδικοποιεί την πρωτεΐνη που σχηματίζει το αντιγόνο Β, ενώ το αλληλόμορφο i δεν κωδικοποιεί για κάποια πρωτεΐνη. Έτσι άτομα με γονότυπο ΙΑ ΙΑ και ΙΑI έχουν φαινότυπο ομάδα αίματος Α. Τα άτομα με το γονότυπο ΙΒ ΙΒ ή ΙΒ i έχουν φαινότυπο ομάδα αίματος Β, άτομα γονότυπου ΙΑΙΒ έχουν φαινότυπο ομάδα αίματος ΑΒ και τέλος τα άτομα γονότυπου ii έχουν ομάδα αίματος 0.

Σύμφωνα με τα παραπάνω και με δεδομένο ότι κάθε γονέας κληροδοτέι ένα πλήρες απλοειδές γονιδίωμα σε κάθε απόγονο του σύμφωνα με τον 1ₒ νόμο του Μendel, ο οποίος αναφέρει ότι κατά τον σχηματισμό των γαμετών, τα αλληλόμορφα γονίδια διαχωρίζονται και κατανέμονται στους γαμέτες τυχαία μεν άλλα ισοπιθανα δε. Η γονιμοποίηση είναι τυχαίο γεγονός.

Έχουμε λοιπόν τις εξής δύο διασταυρώσεις :

  1. Ρ1 : Γ1 Χ Σ1

F1 : Παιδί Α

Δηλαδή : Ρ1 : ii × IA I B

γαμέτες : i, i / IA , IB

γαμέτες/ γαμέτες

IA

IB

i

IAi

IBi

i

IAi

IBi

Oι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών μιας διασταύρωσης και τρόπου συνδυασμού τους, μεταξύ τους.

Γονοτυπική αναλογία F1 γενεάς: IAi : IBi

Φαινοτυπική αναλογία F1 γενεάς: [ Α ] : [ B ]

Δηλαδή η γυναίκα αυτή μπορεί να αποκτήσει με τον σύζυγο 1, παιδιά με ομάδα αίματος Α ή με ομάδα αίματος Β. Δεν μπορεί να αποκτήσει παιδιά με ομάδα αίματος ΑΒ και παιδιά με ομάδα αίματος 0. Θεωρούμε ότι δεν εμφανίζονται νέες μεταλλάξεις και όλα συμβαίνουν φυσιολογικά.

Β) Ρ2 : Γ1 x Σ2

F1 : Παιδί Β

Δηλαδή : P2 : ii x IAIA ή P2 : ii x IA i

γαμέτες: i , i / IA , IA γαμέτες : i , i / IA , i

F1 :

γαμέτες/ γαμέτες

IA

IA

i

IAi

IAi

i

IAi

IAi

ή

F1 :

γαμέτες/ γαμέτες

IA

i

i

IAi

ii

i

IAi

ii

F1

Γονοτυπική αναλογία : 100% IAi                   ή                  Γονοτυπική αναλογία : ΙΑi : ii

Φαινοτυπική αναλογία : 100 % [A]                  ή                   Φαινοτυπική αναλογία : [Α] : [0]

Επομένως , αναλόγως με τον γονότυπο του συζύγου 2, η γυναίκα αυτή με τον άνδρα αυτό, μπορεί είτε να αποκτήσει μόνο παιδιά με ομάδα αίματος Α ή παιδιά με ομάδα αίματος Α και με ίση αναλογία παιδιά με ομάδα αίματος 0.

Επομένως, με βάση τις παραπάνω, το παιδί Π1 αφού έχει ομάδα αίματος 0 είναι παιδί του Σ2, ο οποίος θα έχει ομάδα αίματος Α και γονότυπο ΙΑi και το παιδί Π2, αφού έχει ομάδα αίματος Β είναι παιδί του Σ1.

Δηλαδή το γενεαλογικό δέντρο είναι :

2017 Blog 8-9-01 extra 2

Γ4

Γνωρίζουμε ότι όλοι οι μικροοργανισμοί όπως και όλα τα έμβια όντα απαιτούν για την ανάπτυξη τους πηγή άνθρακα (C) στο περιβάλλον τους σε κατάλληλες ποσότητες, αφού όλα τα βιολογικά μακρομόρια που δομούν τα κύτταρα (πρωτεΐνες, DNA, RNA, λιπίδια και υδατάνθρακες) αποτελούνται από C. Οι ετερότροφοι μικροοργανισμοί προμηθεύονται από τo περιβάλλον τους τον C, με μορφή οργανικών ενώσεων, ενώ οι αυτότροφοι προμηθεύονται από τον C από τον CO2 της ατμόσφαιρας.

Το βακτήριο E.coli είναι ετερότροφο και απαιτεί ως πηγή άνθρακα είτε γλυκόζη (κατά προτίμηση), είτε λακτόζη, είτε κάποιον άλλον υδατάνθρακα που θα μπορεί να τον μεταβολίσει. Οι Γάλλοι επιστήμονες, Jacob και Monod απέδειξαν ότι το βακτήριο E. coli μπορεί να μεταβολίζει την λακτόζη (δισακχαρίτης αποτελούμενος από γλυκόζη και γαλακτόζη) χάρη στην ύπαρξη στο γονιδίωμα του, του οπερονίου της λακτόζης.

Το οπερόνιο της λακτόζης, απέδειξαν οι Γάλλοι επιστήμονες, ότι αποτελείται από τρία γονίδια που ονομάζονται δομικά ( με τη σειρά: Ζ,Υ,Α) τα οποία βρίσκονται υπό τον έλεγχο του ίδιου υποκινητή. Την έκφραση των δομικών γονιδίων του οπερονίου ελέγχουν δύο ρυθμιστικές αλληλουχίες του. Η μία ονομάζεται χειριστής και βρίσκεται μεταξύ της αλληλουχίας του υποκινητή του οπερονίου, και του πρώτου δομικού γονιδίου Ζ του οπερονίου.

Η άλλη ρυθμιστική αλληλουχία της έκφρασης των δομικών γονιδίων του οπερονίου της λακτόζης, ονομάζεται ρυθμιστικό γονίδιο και βρίσκεται μπροστά από τον υποκινητή του οπερονίου. Το ρυθμιστικό γονίδιο διαθέτει τον δικό του υποκινητή και τις δικές του αλληλουχίες λήξης της μεταγραφής.

Το ρυθμιστικό γονίδιο εκφράζεται συνεχώς και κωδικοποιεί λίγα μόρια μιας πρωτεΐνης, που ονομάζεται πρωτεΐνη καταστολεας. Η πρωτεΐνη αυτή έχει τέτοια στερεοδιάταξη ώστε να αναγνωρίζει την αλληλουχία του χείριστη και να συνδέεται με αυτήν. Η σύνδεση του καταστολέα με τον χειριστή παρεμποδίζει την μεταγραφή των δομικών γονιδίων του οπερονίου της λακτόζης.

΄Όμως, όταν εντός του βακτηρικού κυττάρου υπάρχει λακτόζη, τότε ο ίδιος ο διασακχαρίτης συνδέεται με την πρωτεΐνη καταστολέα σε κατάλληλο σημείο της. Η συνδεση αυτή οδηγεί σε αλλαγή στην στερεοδιάταξη της πρωτεΐνης καταστολέα ώστε αυτή τώρα να μην μπορεί να συνδέεται πλέον με τον χειριστή του οπερονίου. Οπότε, η ίδια η λακτόζη λειτουργεί ως επαγωγέας της έκφρασης των δομικών γονιδίων του οπερονίου, που την καταβολίζει. Δηλαδή, όταν το βακτήριο αναπτύσσεται σε περιβάλλον με μόνη πηγή άνθρακα λακτόζη, εκφράζεται το οπερόνιο της λακτόζης, δηλαδή μεταγράφεται και μεταφράζεται. Με την μεταγραφή του παράγεται ένα μόριο mRNA που φέρει τρεις πληροφορίες για την σύνθεση τριών διαφορετικών πρωτεϊνών (με τη σειρά β-γαλακτοζιδάση, περμεάση, τρανσακετυλάση) κατά την μετάφρασή του, οι οποίες συμμετέχουν στον καταβολισμό της λακτόζης.

Σύμφωνα λοιπόν με τα παραπάνω μπορούμε να ερμηνεύσουμε το δοθέν διάγραμμα, με βάση το οποίο, λίγο πριν την χρονική στιγμή t1, η πηγή άνθρακα του θρεπτικού υλικού έχει εξαντληθεί. Τη χρονική στιγμή t1 προστίθεται λακτόζη στο θρεπτικό υλικό. Μέτα την προσθήκη λακτόζης παρατηρείται σιγμοειδής αύξηση (παρατηρήθηκε εκθετική αύξηση στην παραγόμενη από τα κύτταρα ποσότητα mRNA, μέχρι μία ορισμένη μέγιστη τιμή πέρα από την οποία η ποσότητα του mRNA/βακτήριο δεν αυξάνεται άλλο) στην καμπύλη μεταβολής της συνάρτησης mRNA ανά κύτταρο =f(t).

Μετά την προσθήκη της λακτόζης στην καλλιέργεια την χρονική στιγμή t1, το βακτήριο E.coli άρχισε να εκφράζει το οπερόνιο της λακτόζης και να παράγει το mRNA από την μεταγραφή του, ενώ ταυτόχρονα, επειδή το κύτταρο διαθέτει πλέον πηγή C και επομένως ενέργεια και υλικά για την κάλυψη των αναγκών του και για την σύνθεση των βιολογικών μακρομορίων του, εκφράζει εκτός από το οπερόνιο της λακτόζης και τα υπόλοιπα γονίδια που σχετίζονται με την ανάπτυξη κάθε βακτηρίου για το δεδομένο περιβάλλον όπου αναπτύσσεται. Η παραγωγή των μορίων mRNA θα φτάσει κάποια χρονική στιγμή την μέγιστη δυνατή τιμή πέρα από την οποία δεν μπορεί να αυξηθεί άλλο, αφού αυτές είναι οι μέγιστες ενδογενείς δυνατότητες των βακτηρίων της καλλιέργειας σε αυτό το δεδομένο περιβάλλον.

ΘΕΜΑ Δ

Δ1

Στο φυσιολογικό γονίδιο της αλυσίδας β της αιμοσφαιρίνης Α (HbA) αντιστοιχεί η αλληλουχία ΙΙΙ της δοθείσας εικόνας 4. Στο παθολογικό γονίδιο βς αντιστοιχεί η αλληλουχία Ι της εικόνας 4.

Αιτιολόγηση: Γνωρίζουμε ότι η αιμοσφαιρίνη Α (ΗbA) είναι μία πρωτεΐνη των ερυθρών αιμοσφαιρίων μας, υπεύθυνη για την μεταφορά του οξυγόνου (02 )στους ιστούς. Η αιμοσφαιρίνη Α αποτελείται από 4 πολυπεπτιδικές αλυσίδες 2α και 2β.

Οι αλυσίδες β της ΗbA κωδικοποιούνται από ένα αυτοσωμικό γονίδιο, το γονίδιο β, στο οποίο έχουν βρεθεί περισσότερα από 300 πολλαπλά παθολογικά αλληλόμορφα. Ένα παθολογικό αλληλόμορφο του γονιδίου β είναι το γονίδιο βς το οποίο κωδικοποιεί για τις αλυσίδες βς που συνδεόμενες ανά 2, με 2 αλυσίδες α, δίνουν την μεταλλαγμένη αιμοσφαιρίνη ΗbS, αιτία της ασθένειας της δρεπανοκυτταρικής αναιμίας μίας σοβαρής αυτοσωμικής υπολειπόμενης νόσου.

Η διαφορά της πολυπεπτιδικής αλυσίδας β (φυσιολογική) από της βς (παθολογική ) είναι το 6ο αμινοξύ των πολυπεπτιδίων όπου η β φέρει ως αμινοξύ γλουταμινικό οξύ και η βς φέρει βαλίνη.

Γνωρίζουμε ότι η μεταφορά της γενετικής πληροφορίας από το γονίδιο στην πολυπεπτιδική αλυσίδα γίνεται μέσω της μεταφοράς της πληροφορίας από την μία αλυσίδα του γονιδίου στο κινητό αντίγραφο της γενετικής πληροφορίας, που είναι ένα μονόκλωνο μόριo mRNA, μέσω της διαδικασίας μεταγραφής του γονιδίου. Αντίγραφό λοιπόν της κωδικής αλυσίδας του γονιδίου (που φέρει άμεσα την γενετική πληροφορία του γονιδίου) είναι ένα μόριο mRNA, το οποίο μεταφέρεται στα ριβοσώματα για την παραγωγή του πολυπεπτιδίου, μέσω ενός κώδικα αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών (γενετικός κώδικας) χάρη στα μόρια tRNA.

O Γενετικός κώδικας είναι:

α) Τρίλεπτας, τρία νουκλεοτίδια του mRNA κωδικοποιούν ένα αμινοξύ (κωδικόνιο).

β) Συνεχής , κατά την μετάφραση δεν παραλείπεται κανένα νουκλεοτίδιο.

γ) Μη επικαλυπτόμενος, κάθε νουκλεοτίδιο του mRNA που μεταφράζεται ανήκει μόνο σ ένα κωδικόνιο.

δ) Έχει κωδικόνιο έναρξης της μετάφρασης (ΑUG) και κωδικόνιο λήξης της μετάφρασης ένα εκ των (5΄’UAG3 , 5’UAA3, , UGA). Η μετάφραση σταματάει στα κωδικόνια λήξης καθώς δεν υπάρχουν μόρια tRNA με συμπληρωματικά αντικωδικόνια για αυτά τα κωδικόνια.

Σύμφωνα με την διαδικασία της μεταγραφής, το παραγόμενο μονόκλωνο μόριο mRNA, είναι όμοιο σε αλληλουχία και προσανατολισμό, αποτελούμενο βεβαίως από ριβονουκλεοτίδια, με τον ένα από τους δυο κλώνους του γονιδίου. Ο κλώνος αυτός του γονιδίου, ονομάζεται κωδικός και είναι αυτός που φέρει την γενετική πληροφορία όπως και το κινητό αντίγραφο του, το μόριο mRNA. Το μεταγράφημα (mRNA) προέκυψε από την μεταγραφή της συμπληρωματικής προς τον κωδικό κλώνο αλυσίδας του γονιδίου του κυττάρου, η αλυσίδα αυτή ονομάζεται μη κωδική και είναι αυτός ο κλώνος του γονιδίου που χρησιμοποιήθηκε από το ένζυμο της μεταγραφής δηλαδή, την RNA πολυμεράση ως καλούπι για την σύνθεση του mRNA. O κλώνος αυτός δεν φέρει κωδικόνια.

Η RNA πολυμεράση, κατά την μεταγραφή, συνδέεται στον υποκινητή του γονιδίου με την βοήθεια των κατάλληλων μεταγραφικών παραγόντων και ξετυλίγοντας την διπλή έλικα συνθέτει το μόριο RNA με καλούπι της, τη μη κωδική αλυσίδα του γονιδίου. Δημιουργείται έτσι ένα μόριο RNA με προσανατολισμό 5’→3’ , αφού το ένζυμο συνδέει τα ριβονουκλεοτίδια στο αναπτυσσόμενο RNA, με 3’→5’ φωσφοδιεστερικό δεσμό. Επομένως το mRNA που παράγεται κατά την μεταγραφή, έχει προσανατολισμό 5’→3’ με το 5’ άκρο του προς τον υποκινητή του γονιδίου, που μεταγράφεται. Όμοιο προσανατολισμό, έχει και η κωδική αλυσίδα του γονιδίου. Η μη-κωδική αλυσίδα του γονιδίου έχει αντιπαράλληλο προσανατολισμό.

Το αμινοξυ. γλουταμινικο οξύ, κωδικοποιείται απο το κωδικονιο 5’GAG3’ ενώ η βαλινη κωδικοποιείται από το κωδικόνιο 5’GTG3’.

Επομένως στις δοθείσες αλληλουχίες Ι , ΙΙ ,ΙΙΙ της εικόνας 4, προκειμένου να βρούμε την αλληλουχία του φυσιολογικού αλληλόμορφου β και του μεταλλαγμένου αλληλόμορφου βς θα αναζητήσουμε το κωδικόνιο έναρξης 5’ΑΤG3’ σ’ έναν από τους δύο κλώνους, της κάθε αλληλουχίας και για το γονίδιο β θα αναζητήσουμε και ως έβδομο κωδικόνιο το 5’GΑG3’ , ενώ για το παθολογικό αλληλομορφο βς ως έβδομο κωδικόνιο το 5’GTG3’. Γνωρίζουμε ότι κατά την μετα-μεταφραστική τροποποίηση που υφίσταται το παραγόμενο από τη μετάφραση πολυπεπτίδιο του συγκεκριμένου γονιδίου, αφαιρείται η αρχική μεθειονίνη από το αρχικό αμινικό άκρο, δηλαδή το έκτο αμινοξύ, τόσο στο λειτουργικό πολυπεπτίδιο β όσο και στο παθολογικό βς κωδικοποιήθηκε από το έβδομο κωδικόνιο στo mRNA.

Σύμφωνα λοιπόν με τα παραπάνω και τις δοθείσες αλληλουχίες I,II,III της εικόνας 4 παρατηρούμε ότι κωδικονιο έναρξης 5’ΑTG3’ υπάρχει μόνο στην πάνω αλυσίδα, στις αλληλουχίες Ι και ΙΙΙ και στην Ι αλληλουχία το 70 κωδικόνιο είναι το 5’GTG3’ άρα πρόκειται για το γονίδιο βς ενώ στην αλληλουχία ΙΙΙ το 70 κωδικόνιο είναι το GAG3’. Επομένως πρόκειται για το φυσιολογικό γονίδιο β.

Δ2

Η αλληλουχία της εικόνας 4 που απομένει είναι η αλληλουχία ΙΙ και θα μπορούσε να αντιστοιχεί σε γονίδιο που προκαλεί την β-θαλασσαιμία.

Αιτιολόγηση:

Γνωρίζουμε ότι ο γενετικός τόπος του γονιδίου β εμφανίζει περισσότερα από 300 πολλαπλά αλληλόμορφα. Εκείνα τα αλληλόμορφα που φέρουν τέτοια μετάλλαξη, η οποία έχει ως συνέπεια την παντελή έλλειψη της πολυπεπτιδικής αλυσίδας β, είτε έχει ως συνέπεια την μειωμένη παραγωγή της, τα αλληλόμορφα αυτά του γονιδίου β ευθύνονται για την β-θαλασσαιμία μια ασθένεια που εμφανίζει ετερογένεια συμπτωμάτων και προκαλείται από την απουσία ή την μειωμένη παρουσία της ΗbA στα ερυθροκυτταρα του ανθρωπου.

Ένα γονίδιο δεν εκφράζεται όταν δεν είναι δυνατή είτε η μεταγραφή είτε η μετάφραση του. Όταν ένα γονίδιο έχει υποστεί τέτοια μετάλλαξη (μόνιμη αλλαγή στην αλληλουχία του DNA του) που δεν φέρει κωδικόνιο έναρξης 5’ΑΤG3’ , τότε δεν μεταφράζεται το μόριο mRNA που προκύπτει από το γονίδιο αυτό, το οποίο μόριο mRNA αντιστοιχεί στην κωδική αλυσίδα του γονιδίου, όπως αποδείχθηκε στο προηγούμενο ερώτημα.

Παρατηρούμε ότι η αλληλουχία ΙΙ δεν φέρει τριπλέτα 5’ΑΤG3 στον πάνω κλώνο παρά μόνο στον κάτω. Ωστόσο, ο κάτω κλώνος δεν είναι η κωδική αλυσίδα του γονιδίου β, όπως αποδείχθηκε στο προηγούμενο ερώτημα. Συνεπώς, το παραγόμενο κατά την μεταγραφή μόριο mRNA αδυνατεί, να μεταφρασθεί για να παραχθεί το πολυπεπτίδιο β. Συνεπώς, η αλληλουχία β μπορεί να αντιστοιχεί σε ένα παθολογικό αλληλόμορφο γονίδιο β΄ του γονιδίου β, το οποίο παθολογικό β΄ ευθύνεται για την β-θαλασσαιμία.

Παρατηρούμε ότι οι τρεις αλληλουχίες Ι,ΙΙ,ΙΙΙ που μας δίνονται στην εικόνα 4 είναι πολλαπλά αλληλόμορφα του ίδιου γενετικού τόπου. Το αλληλόμορφο β΄( αλληλουχία ΙΙ) εμφανίζει σημειακή μετάλλαξη προσθήκης ενός ζεύγους βάσης ανάμεσα στο 8ο φυσιολογικό ζεύγος βάσεων και στο 90 ζεύγος βάσεων από αριστερά προς τα δεξιά, όπου το ζεύγος C-G έχει προστεθεί στην αλληλουχία ΙΙ .

C

III

G

Η μετάλλαξη αυτή οδηγεί στην κατάργηση του κωδικόνιου έναρξης, που υπάρχει φυσιολογικά στο γονίδιο β, μετά από έξι συνεχόμενες αδενινες, διαβάζοντας από τα αριστερά προς τα δεξιά τον πάνω κλώνο (κωδικό) στις αλληλουχίες Ι και ΙΙΙ που μας έχουν δοθεί και αντιστοιχούν σε τμήμα του 1ου εξωνίου του γονιδίου β της HbA. Αρα το mRNA μόριο που θα προκύψει από την μεταγραφή του γονιδίου β΄(αλληλουχία ΙΙ) δεν θα είναι δυνατόν να μεταφραστεί.

Δ3

α) Η θέση έναρξη της αντιγραφής βρίσκεται στην θέση Υ

β) Συνεχώς αντιγράφεται η αλυσίδα Α.

Ασυνεχώς Αντιγράφεται η αλυσίδα Β.

γ) Το πρωταρχικό τμήμα iii (5’ΑCGCCA3’) συντίθεται πρώτο.

Δ4

Γνωρίζουμε ότι τα άτομα που φέρουν ένα φυσιολογικό β αλληλόμορφο του γονιδίου β που κωδικοποιεί για την πολυπεπετιδικη αλυσίδα β της HbA και ένα παθολογικό υπολειπόμενο β’ ονομάζονται φορείς της ασθένειας της β θαλασσαιμιας και είναι φαινοτυπικά υγιείς σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Επίσης, ετερόζυγα άτομα με γονότυπο ββς , είναι φορείς της δρεπανοκυτταρικής αναιμίας και είναι φαινοτυπικα υγειή άτομα σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Η β-θαλασσαιμία, όπως και η δρεπανοκυτταρική αναιμία είναι δύο ασθένειες που ελέγχονται από το ίδιο γενετικό τόπο που εδράζεται σε αυτοσωμικό χρωμόσωμα. Η κάθε μία από τις παραπάνω ασθένειες είναι υπολειπόμενες (χαμηλά υψόμετρα) και ελέγχονται από διαφορετικά παθολογικά αλληλόμορφα του γονιδίου β που ευθύνεται για την σύνθεση των φυσιολογικών β-αλυσίδων της ΗbA.

Έστω λοιπόν ο γενετικός τόπος ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων όπου εδράζεται το γονίδιο β με πολλαπλά αλληλόμορφα (πάνω από 300). Το γονίδιο β είναι φυσιολογικό και επικρατεί έναντι των παθολογικών υπολειπόμενων αλληλόμορφων του β’ και του βς. Το αλληλόμορφο β ελέγχει την σύνθεση της φυσιολογικής β πολυπεπτιδικής αλυσίδας της ΗbA, το παθολογικό υπολειπόμενο αλληλόμορφο β’ ελέγχει για την παντελή έλλειψη παραγωγής της β αλυσίδας της ΗbA ή για την μειωμένη παραγωγή της, ενώ το παθολογικό υπολειπόμενο βς ελέγχει για την σύνθεση των βς αλυσίδων της ΗbS που προκαλεί την δρεπανοκυταρική αναιμία. Το αλληλόμορφο β’ ευθύνεται για την β-θαλασσαιμία.

Δηλαδή άτομα με γονότυπο ββ είναι υγιή, άτομα με γονότυπο ββς και ββ’ είναι υγιή και ετερόζυγα (φορείς) της δρεπανοκυτταρικής αναιμίας και την β-θαλασσαιμία αντίστοιχα. Τέλος άτομα με το γονότυπο β΄βς νοσούν από μικροδρεπανοκυτταρική αναιμία και άτομα με γονότυπο β’β’ νοσούν από β- θαλασσαιμία

Έχουμε λοιπόν την διασταυρώση :

P: ββ’ x ββς

Γαμέτες : β, β΄ / β, βς

Oι γαμέτες προκύπτουν σύμφωνα με τον 10 νόμο Mendel δηλαδή το νόμο του διαχωρισμού των αλληλόμορφων γονιδίων, σύμφωνα με τον οποίο τα αλληλόμορφα ενός γονιδίου διαχωρίζονται κατά την πρώτη μειωτική διαίρεση και κατανέμονται τυχαία αλλά ισοπίθανα στους γαμέτες. Η γονιμοποίηση είναι τυχαίο γεγονός.

F1 : Οι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών και του τρόπου συνδυασμού τους σε μία διασταύρωση.

F1 :

γαμέτες/ γαμέτες

β

β΄

β

ββ

ββ’

βς

ββς

βςβ’

Γονοτυπική αναλογία F1 : ββ : ββ’ : ββς : βςβ’

Δηλαδή από την διασταύρωση αυτή προκύπτουν είτε άτομα με γονότυπο ββ είτε με ββ’ είτε με ββς είτε άτομο που φέρει και τα δύο παθολογικά αλληλόμορφα.

Από τον ιστότοπο βιολογίας: www.nikimargariti.com.