Αρχείο συντάκτη gkarakats

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ

ΣΤΟ 1ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ)

ΘΕΜΑ Α

2000 ΗΜΕΡΗΣΙΟ

  1. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

α.γραμμικό δίκλωνο DNA

β.γραμμικό μονόκλωνο DNA

γ.κυκλικό δίκλωνο DNA

δ.κυκλικό μονόκλωνο DNA

Μονάδες 5

2000 ΕΣΠΕΡΙΝΟ

  1. Μέσα σ’ ένα φυτικό ευκαρυωτικό κύτταρο, DNAυπάρχει μόνο:

α) στον πυρήνα

β) στον πυρήνα και στα μιτοχόνδρια

γ) στα μιτοχόνδρια και στους χλωροπλάστες

δ) στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες

Μονάδες 3

  1. Στη φύση τα πλασμίδια βρίσκονται:

α) στα φυτικά κύτταρα

β) στους ιούς

γ) στα βακτήρια

δ) στα ζωικά κύτταρα

Μονάδες 3 

2001 ΗΜΕΡΗΣΙΟ

1.Το DNAαποτελεί το γενετικό υλικό όλων των κυττάρων και των περισσότερων ιών. Να περιγράψετε συνοπτικά τις λειτουργίες του γενετικού υλικού.

Μονάδες 5

2001 ΕΣΠΕΡΙΝΟ

3.Οι ιοί περιέχουν γενετικό υλικό; Τι είδους μπορεί να είναι αυτό;

Μονάδες 15

2001 ΟΜΟΓΕΝΕΙΣ

Β. 1. Πότε ένα κύτταρο χαρακτηρίζεται απλοειδές και πότε διπλοειδές;

Μονάδες 5

  1. Τι ονομάζεται καρυότυπος;

Μονάδες 5 

2002 ΗΜΕΡΗΣΙΟ

1.Δίκλωνο κυκλικό μόριο DNAπεριέχεται σε:

α.γαμέτη

β.ευκαρυωτικό πυρήνα

γ.βακτήριο

δ.νουκλεόσωμα.

Μονάδες 5

2002 ΕΣΠΕΡΙΝΟ

2.Οι δύο αδερφές χρωματίδες συγκροτούν ένα

α.μεταφασικό χρωμόσωμα.

β.υβρίδωμα.

γ.νουκλεόσωμα.

δ.κύτταρο.

Μονάδες 5

3.Το πλασμίδιο είναι

α.δίκλωνο RNA.

β.κυκλικό δίκλωνο DNA.

γ.μονόκλωνο DNA.

δ.μονόκλωνο RNA.

Μονάδες 5

2003 ΗΜΕΡΗΣΙΟ

2.Τα φυλετικά χρωμοσώματα του ανθρώπου βρίσκονται:

α.μόνο στα μυϊκά κύτταρα

β.μόνο στα γεννητικά κύτταρα

γ.σε όλα τα κύτταρα

δ.μόνο στα ηπατικά κύτταρα.

Μονάδες 5

2003 ΕΣΠΕΡΙΝΟ

2.Τα φυλετικά χρωμοσώματα του ανθρώπου

α.δεν περιέχουν γονίδια.

β.είναι όμοια μορφολογικά στους άνδρες και στις γυναίκες.

γ.καθορίζουν το φύλο.

δ.δεν μεταβιβάζονται στους απογόνους.

Μονάδες 5

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Πολλά νουκλεοτίδια ενώνονται μεταξύ τους με ετεροπολικούς δεσμούς και δημιουργούν μία πολυνουκλεοτιδική αλυσίδα.

Μονάδες 2

2003 ΟΜΟΓΕΝΕΙΣ 

3.Το υλικό των προκαρυωτικών κυττάρων είναι

α.γραμμικό μονόκλωνο DNA.

β.δίκλωνο RNA.

γ.κυκλικό δίκλωνο DNA.

δ.γραμμικό δίκλωνο DNA.

Μονάδες 5

2004 ΕΣΠΕΡΙΝΟ

  1. Στα ευκαρυωτικά κύτταρα, το γενετικό υλικό κατανέμεται

α.στον πυρήνα.

β.στα μιτοχόνδρια και στο πλασμίδιο.

γ.στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες.

δ.στον πυρήνα και στα ριβοσώματα.

Μονάδες 5

  1. Η ποσότητα του DNAείναι

α.ίδια σε όλα τα είδη των σωματικών κυττάρων ενός οργανισμού.

β.διπλάσια στα ηπατικά κύτταρα των οργανισμών.

γ.μικρότερη στους περισσότερο εξελιγμένους οργανισμούς.

δ.η μισή στα διπλοειδή κύτταρα σε σχέση με τα απλοειδή.

Μονάδες 5

  1. Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση των νουκλεοτιδίων με

α.δεσμούς υδρογόνου.

β.φωσφοδιεστερικούς δεσμούς.

γ.πεπτιδικούς δεσμούς.

δ.ετεροπολικούς δεσμούς.

Μονάδες 5

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα …

α.δίκλωνο γραμμικό μόριο DNA.

β.δίκλωνο κυκλικό μόριο DNA.

γ.δίκλωνο κυκλικό μόριο RNA.

δ.μονόκλωνο κυκλικό μόριο RNA.

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

1.Τα φυλετικά χρωμοσώματα …

α.υπάρχουν μόνο στα γεννητικά κύτταρα.

β.εντοπίζονται μόνο στα σωματικά κύτταρα.

γ.υπάρχουν στα σωματικά και στα γεννητικά κύτταρα.

δ.εντοπίζονται στα φυτικά και στα βακτηριακά κύτταρα.

Μονάδες 5

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Στα πειράματά τους οι Avery, Mac-Leodκαι McCartyδιαπίστωσαν ότι ο μετασχηματισμός των αδρών βακτηρίων σε λεία οφείλεται …

α.στο DNA.

β.στο RNA.

γ.στους υδατάνθρακες.

δ.στις πρωτεΐνες.

Μονάδες 5

2005 ΕΣΠΕΡΙΝΟ

  1. Τα πλασμίδια

α.είναι δίκλωνα, κυκλικά μόρια DNAμε διάφορα μεγέθη.

β.απαντούν σε όλους τους ευκαρυωτικούς οργανισμούς.

γ.φέρουν πληροφορίες για πρωτεΐνες με αντιγονική δράση.

δ.αποτελούν βασικό συστατικό του νουκλεοσώματος.

Μονάδες 3

  1. Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται

α.τα μιτοχόνδρια και τα ριβοσώματα.

β.οι χλωροπλάστες και ο πυρήνας.

γ.οι χλωροπλάστες και τα μιτοχόνδρια.

δ.τα ζεύγη των φυλετικών χρωμοσωμάτων.

Μονάδες 3

Β. Ποιες είναι, συνοπτικά, οι λειτουργίες του γενετικού υλικού;

Μονάδες 10 

2006 ΗΜΕΡΗΣΙΟ

  1. Ο καρυότυπος

α.απεικονίζει την ταξινόμηση των χρωμοσωμάτων κατά ελαττούμενο μέγεθος.

β.χρησιμοποιείται για τον εντοπισμό γονιδιακών μεταλλάξεων.

γ.απεικονίζει το γενετικό υλικό κατά το στάδιο της μετάφασης.

δ.χρησιμοποιείται μόνο για τη μελέτη φυλετικών χρωμοσωμάτων.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

  1. Ένα νουκλεοτίδιο DNAμπορεί να αποτελείται από

α.δεοξυριβόζη, φωσφορική ομάδα, ουρακίλη.

β.ριβόζη, φωσφορική ομάδα, θυμίνη.

γ.DNAδεσμάση, φωσφορική ομάδα, αδενίνη.

δ.δεοξυριβόζη, φωσφορική ομάδα, αδενίνη.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ

4.Το πλασμίδιο είναι

α.δίκλωνο γραμμικό μόριο DNA.

β.δίκλωνο κυκλικό μόριο DNA.

γ.δίκλωνο κυκλικό μόριο RNA.

δ.δίκλωνο γραμμικό μόριο RNA.

Μονάδες 5 

2008 ΗΜΕΡΗΣΙΟ

1.Ο πνευμονιόκοκκος, τα δύο στελέχη του οποίου χρησιμοποίησε ο Griffithστο γνωστό πείραμα, είναι:

α.μύκητας.

β.βακτήριο.

γ.ιός.

δ.πρωτόζωο.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

2.Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται

α.τα ριβοσώματα και οι χλωροπλάστες.

β.οι χλωροπλάστες και τα μιτοχόνδρια.

γ.τα χρωμοσώματα και τα ριβοσώματα.

δ.ο πυρήνας και οι χλωροπλάστες.

Μονάδες 5

2008 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Στους περισσότερους οργανισμούς ένα μιτοχόνδριο περιέχει

α.ένα μόριο κυκλικού DNA.

β.δύο έως δέκα μόρια κυκλικού DNA.

γ.ένα μόριο γραμμικού RNA.

δ.πολλά μόρια γραμμικού RNA.

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

1.Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι

α.κυκλικό μονόκλωνο DNA.

β.κυκλικό δίκλωνο DNA.

γ.γραμμικό δίκλωνο DNA.

δ.γραμμικό μονόκλωνο DNA.

Μονάδες 5 

2009 ΗΜΕΡΗΣΙΟ

  1. Τα νουκλεοσώματα

α.αποτελούνται αποκλειστικά από DNA.

β.δεν σχηματίζονται κατά τη μεσόφαση.

γ.αποτελούνται από DNAπου τυλίγεται γύρω από πρωτεΐνες.

δ.είναι ορατά μόνο με το οπτικό μικροσκόπιο.

Μονάδες 5

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

  1. Δύο αδελφές χρωματίδες συγκροτούν

α.τον καρυότυπο.

β.το νουκλεόσωμα.

γ.κάθε μεταφασικό χρωμόσωμα.

δ.το μόριο DNA.

Μονάδες 5

2009 ΕΣΠΕΡΙΝΟ

  1. Στον ανθρώπινο φυσιολογικό καρυότυπο απεικονίζονται

α.23 χρωμοσώματα.

β.22 ζεύγη χρωμοσωμάτων.

γ.23 ζεύγη χρωμοσωμάτων.

δ.46 ζεύγη χρωμοσωμάτων.

Μονάδες 5

2009 ΟΜΟΓΕΝΕΙΣ

  1. Τα πλασμίδια είναι

α.δίκλωνα κυκλικά μόρια RNA.

β.δίκλωνα γραμμικά μόρια RNA.

γ.δίκλωνα κυκλικά μόρια DNA.

δ.μονόκλωνα κυκλικά μόρια DNA.

Μονάδες 5

2010 ΗΜΕΡΗΣΙΟ

Α2. Η διπλή έλικα του DNA

α.έχει μεταβαλλόμενο σκελετό

β.έχει υδρόφιλο σκελετό

γ.έχει πεπτιδικούς δεσμούς

δ.είναι αριστερόστροφη

Μονάδες 5

2010 ΕΣΠΕΡΙΝΟ

Α1. Η ποσότητα του DNAείναι

α.διπλάσια στα νευρικά κύτταρα σε σχέση με τα ηπατικά του ίδιου οργανισμού.

β.η μισή στα διπλοειδή κύτταρα σε σχέση με τα απλοειδή.

γ.ίδια σε όλα τα είδη των σωματικών κυττάρων ενός οργανισμού.

δ.συνήθως μικρότερη στους περισσότερο εξελιγμένους οργανισμούς.

Μονάδες 5

2010 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α3. Η έκφραση invitroχρησιμοποιείται για την περιγραφή μιας βιολογικής διαδικασίας που πραγματοποιείται

α.στο ύπαιθρο

β.σε έναν οργανισμό

γ.στον πυθμένα μιας λίμνης

δ.σε δοκιμαστικό σωλήνα

Μονάδες 5

2011 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ – ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

Α4. Η ποσότητα του DNA

α.είναι ίδια σε όλους τους απλοειδείς οργανισμούς.

β.είναι σταθερή σε όλους τους διπλοειδείς οργανισμούς.

γ.μεταβάλλεται στα κύτταρα των διαφόρων ιστών ενός οργανισμού.

δ.διαφέρει στα κύτταρα των οργανισμών που ανήκουν σε διαφορετικά είδη.

Μονάδες 5

2011 ΟΜΟΓΕΝΕΙΣ 

Α1. Μέσα σ’ ένα φυτικό ευκαρυωτικό κύτταρο, DNAυπάρχει μόνο

α.στα ριβοσώματα και στους χλωροπλάστες.

β.στον πυρήνα και στα μιτοχόνδρια.

γ.στον πυρήνα.

δ.στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες.

Μονάδες 5

2012 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α2. Οι ιστόνες είναι

α.DNA

β.RNA

γ.πρωτεΐνες

δ.υδατάνθρακες.

Μονάδες 5

2012 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α1. Τα φυλετικά χρωμοσώματα υπάρχουν

α.μόνο στα ωάρια

β.μόνο στα σπερματοζωάρια

γ.μόνο στα σωματικά κύτταρα

δ.στα σωματικά κύτταρα και στους γαμέτες.

Μονάδες 5 

2012 ΟΜΟΓΕΝΕΙΣ

Α3. Τα πλασμίδια είναι μόρια DNAπου φυσιολογικά βρίσκονται σε

α.φυτά.

β.ζώα.

γ.ιούς.

δ.βακτήρια.

Μονάδες 5

2013 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Βασική μονάδα οργάνωσης της χρωματίνης αποτελεί το

α.νουκλεοτίδιο

β.πολύσωμα

γ.νουκλεόσωμα

δ.κεντρομερίδιο

Μονάδες 5

2013 ΟΜΟΓΕΝΕΙΣ

Α1. Στον άνθρωπο το αρσενικό άτομο καθορίζεται από την

α.παρουσία του Χ χρωμοσώματος.

β.απουσία του Χ χρωμοσώματος.

γ.παρουσία του Υ χρωμοσώματος.

δ.απουσία του Υ χρωμοσώματος.

Μονάδες 5 

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Τα πλασμίδια είναι

α.κυκλικά δίκλωνα μόρια RNA

β.γραμμικά μόρια DNA

γ.μονόκλωνα μόρια DNA

δ.κυκλικά δίκλωνα μόρια DNA.

Μονάδες 5 

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

 Α1. Τα κύτταρα στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο ονομάζονται

α.διπλοειδή

β.διαφοροποιημένα

γ.απλοειδή

δ.μετασχηματισμένα.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ 

Α2. Το νουκλεόσωμα αποτελείται

α.από RNAκαι ιστόνες

β.μόνο από RNA

γ.από DNAκαι ιστόνες

δ.μόνο από DNA.

Μονάδες 5 

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α1. Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι

α.γραμμικό δίκλωνο μόριο DNA

β.κυκλικό δίκλωνο μόριο DNA

γ.γραμμικό μονόκλωνο μόριο DNA

δ.κυκλικό μονόκλωνο μόριο DNA.

Μονάδες 5 

2015 ΟΜΟΓΕΝΕΙΣ 

Α1. Δύο διαδοχικά νουκλεοτίδια μιας πολυνουκλεοτιδικής αλυσίδας συνδέονται μεταξύ τους με δεσμό που ονομάζεται

α.5΄- 3΄ φωσφοδιεστερικός δεσμός

β.δεσμός υδρογόνου

γ.πεπτιδικός δεσμός

δ.3΄- 5΄ φωσφοδιεστερικός δεσμός.

Μονάδες 5 

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Το γενετικό υλικό των χλωροπλαστών

α.είναι γραμμικό δίκλωνο DNA

β.είναι κυκλικό μόριο DNA

γ.έχει μικρότερο μήκος από το μιτοχονδριακό DNA

δ.είναι γραμμικό RNA.

Μονάδες 5

Α2. Ένας φυσιολογικός γαμέτης ανθρώπου μπορεί να περιέχει

α.46 χρωμοσώματα

β.ένα Χ χρωμόσωμα

γ.πλασμίδια

δ.DNAμήκους 1,5 x109ζεύγη βάσεων.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

Α3. Το μιτοχονδριακό DNA

α.στα ανθρώπινα κύτταρα είναι δίκλωνο και γραμμικό

β.έχει πληροφορίες για όλες τις λειτουργίες των μιτοχονδρίων

γ.είναι γραμμικό σε ορισμένα κατώτερα πρωτόζωα

δ.υπάρχει πάντα σε ένα μόνο αντίγραφο σε κάθε μιτοχόνδριο.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ 

Α3. Νουκλεοσώματα εντοπίζονται

α.σε μιτοχόνδρια ανθρώπινου μυϊκού κυττάρου

β.σε πυρήνα φυτικού κυττάρου

γ.στο κυτταρόπλασμα του βακτηρίου Escherichiacoli(E. coli)

δ.σε πυρήνα, μιτοχόνδριο και χλωροπλάστη φυτικού κυττάρου.

Μονάδες 5

Α4. Σταθερότερη δευτερογενή δομή μεταξύ μορίων DNAίσου μήκους έχει το μόριο με

α.30% Α

β.20% Α

γ.10% Α

δ.40% Α.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Α1. Το μιτοχονδριακό DNAείναι γραμμικό

α.σε ορισμένα κατώτερα πρωτόζωα

β.στα περισσότερα κύτταρα των ευκαρυωτικών οργανισμών

γ.στα βακτήρια

δ.στα φυτικά κύτταρα.

Μονάδες 5

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ 

Α4. Ερευνητές μελετούν τη δομή του DNA σε ηπατικά, γαμετικά και βακτηριακά κύτταρα και παρατηρούν ότι δίκλωνα κυκλικά μόρια DNA

α.εντοπίζονται μόνο στα βακτηριακά κύτταρα.

β.εντοπίζονται μόνο στα ηπατικά και γαμετικά κύτταρα.

γ.δεν εντοπίζονται σε κανένα από τα τρία είδη κυττάρων.

δ.εντοπίζονται και στα τρία είδη κυττάρων.

Μονάδες 5

Α5. Στις δύο παρακάτω υποθετικές διατάξεις, που αναφέρονται σε μερικώς αναδιπλούμενα μονόκλωνα μόρια DNA,

2019-02-19, 23.01.56

ο κανόνας της συμπληρωματικότητας και αντιπαραλληλότητας

α.ικανοποιείται μόνο στηνΙ.

β.ικανοποιείται μόνο στη ΙΙ.

γ.ικανοποιείται τόσο στηνΙ όσο και στη ΙΙ.

δ.δεν ικανοποιείται σε καμία από τις δύο διατάξεις.

Μονάδες 5

ΘΕΜΑ Β

2000 ΕΣΠΕΡΙΝΟ 

  1. Η σύνδεση με δεσμούς υδρογόνου της Α (αδενίνης) με τη Τ (θυμίνη) είναι τόσο ισχυρή όσο και η σύνδεση της C(κυτοσίνης) με τη G(γουανίνη). (Σ-Λ)

2.Το DNA, όπως και το RNA, είναι ένα μακρομόριο που αποτελείται από …………

2001 ΗΜΕΡΗΣΙΟ

3.Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα και γιατί;

Μονάδες 5

2001 ΕΣΠΕΡΙΝΟ 

  1. Η σύνδεση με δεσμούς υδρογόνου της Α (αδενίνης) με την C(κυτοσίνη) είναι τόσο ισχυρή όσο και η σύνδεση της Τ (θυμίνης) με τη G(γουανίνη). (Σ-Λ)

4.Τα χρωμοσώματα του ανθρώπου που καθορίζουν αν ένα άτομο θα είναι αρσενικό ή θηλυκό λέγονται _______________ .

2002 ΕΣΠΕΡΙΝΟ

1.Ποια οργανίδια του ευκαρυωτικού κυττάρου χαρακτηρίζονται ως ημιαυτόνομα και γιατί;

Μονάδες 8

2.Τι είναι το νουκλεόσωμα;

Μονάδες 4

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ 

2.Από τι αποτελείται το νουκλεόσωμα και ποιος είναι ο ρόλος του;

Μονάδες 10

2004 ΕΣΠΕΡΙΝΟ

Α. Ποιες είναι συνοπτικά οι λειτουργίες του γενετικού υλικού;

Μονάδες 15

Β. Να μεταφέρετε στο τετράδιό σας τις παρακάτω προτάσεις, συμπληρώνοντας τα κενά με τις σωστές λέξεις.

1.Οι αδελφές χρωματίδες είναι συνδεδεμένες στο _______________ .

Μονάδες 2

  1. Κάθε νουκλεοτίδιο του DNAαποτελείται από μια πεντόζη, τη _____________, ενωμένη με μία φωσφορική ομάδα και μια ________________________ .

Μονάδες 4

  1. Τα κύτταρα, στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο, ονομάζονται ______________ .

Μονάδες 2

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

  1. Γιατί τα μιτοχόνδρια χαρακτηρίζονται ως ημιαυτόνομα οργανίδια;

Μονάδες 4

2005 ΗΜΕΡΗΣΙΟ

  1. Ποια είναι η δομή του DNAστο χώρο σύμφωνα με το μοντέλο της διπλής έλικας των Watsonκαι Crick;

Μονάδες 9

2005 ΕΣΠΕΡΙΝΟ

  1. Η ποσότητα του DNAσε κάθε οργανισμό είναι σταθερή και δεν μεταβάλλεται από τις αλλαγές στο περιβάλλον. (Σ-Λ) 

2006 ΗΜΕΡΗΣΙΟ

  1. Πώς επιβεβαιώθηκε οριστικά από τους Hersheyκαι Chaseότι το DNAείναι το γενετικό υλικό των κυττάρων;

Μονάδες 6 

2006 ΕΣΠΕΡΙΝΟ

  1. 1. Τα μιτοχόνδρια περιέχουν ως γενετικό υλικό (DNA-RNA), το οποίο κωδικοποιεί μικρό αριθμό πρωτεϊνών που ελέγχουν τη λειτουργία της (φωτοσύνθεσης-οξειδωτικής φωσφορυλίωσης). Τα μιτοχόνδρια χαρακτηρίζονται ως (αυτόνομα-ημιαυτόνομα) οργανίδια και στους ανώτερους οργανισμούς έχουν (μητρική-πατρική) προέλευση.

Μονάδες 4

5.Σε πολλά βακτήρια, εκτός από το κύριο κυκλικό DNA, υπάρχουν και τα πλασμίδια. (Σ-Λ)

2006 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

 1.Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα;

Μονάδες 4

2006 ΟΜΟΓΕΝΕΙΣ

1.Τι εννοούμε με τον όρο γονιδίωμα; Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή;

Μονάδες 8

2007 ΗΜΕΡΗΣΙΟ

1.Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα (μονάδες 2)και για ποιο λόγο; (μονάδες 5)

Μονάδες 7

2007 ΕΣΠΕΡΙΝΟ

Γ.Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή;

Μονάδες 5

2007 ΟΜΟΓΕΝΕΙΣ

1.Ποιες είναι, συνοπτικά, οι λειτουργίες του γενετικού υλικού;

Μονάδες 6

2008 ΗΜΕΡΗΣΙΟ

4.Πώς χρησιμοποιείται ο όρος αδελφές χρωματίδες, σε ποιο στάδιο της κυτταρικής διαίρεσης εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και πώς μοιράζονται στα δύο νέα κύτταρα;

Μονάδες 5 

2008 ΕΣΠΕΡΙΝΟ

1.Ποια χρωμοσώματα χαρακτηρίζονται ως αυτοσωμικά, ποια ως φυλετικά και πώς καθορίζεται το φύλο στον άνθρωπο;

Μονάδες 9

2008 ΟΜΟΓΕΝΕΙΣ

1.Ποια χρωμοσώματα στον άνθρωπο ονομάζονται αυτοσωμικά και ποια φυλετικά; (μονάδες 4). Πώς καθορίζεται το φύλο στον άνθρωπο; (μονάδες 4).

Μονάδες 8

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Να περιγράψετε το πείραμα με το οποίο επιβεβαιώθηκε οριστικά ότι το DNAείναι το γενετικό υλικό.

Μονάδες 5 

2009 ΟΜΟΓΕΝΕΙΣ

  1. Γιατί τα μιτοχόνδρια και οι χλωροπλάστες χαρακτηρίζονται ημιαυτόνομα οργανίδια;

Μονάδες 4 

2010 ΗΜΕΡΗΣΙΟ

Β1. Ποια κύτταρα ονομάζονται απλοειδή και ποια κύτταρα ονομάζονται διπλοειδή;

Μονάδες 6

Β2. Να περιγράψετε τον σχηματισμό του 3΄-5΄ φωσφοδιεστερικού δεσμού.

Μονάδες 8

2010 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε τη διαδικασία με την οποία μπορεί να κατασκευαστεί ο καρυότυπος ενός ανθρώπου.

Μονάδες 7

2011 ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε το πείραμα του Griffithκαι να αναφέρετε το συμπέρασμα στο οποίο κατέληξε.

Μονάδες 8

Β4. Η ανάλυση δειγμάτων DNAαπό δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη βρέθηκε ποσοστό γουανίνης (G) 28%. Να εξηγήσετε αν τα βακτήρια των δύο καλλιεργειών ανήκουν στο ίδιο ή σε διαφορετικό είδος.

Μονάδες 4

2011 ΕΣΠΕΡΙΝΟ

Β2. Να ταξινομήσετε τις παρακάτω μορφολογικές δομές του γενετικού υλικού ενός ευκαρυωτικού κυττάρου αρχίζοντας από το μικρότερο προς το μεγαλύτερο βαθμό συσπείρωσης:

1.ινίδια χρωματίνης

2.μεταφασικά χρωμοσώματα

3.«χάντρες» νουκλεοσωμάτων

4.διπλή έλικα DNA

5.αδελφές χρωματίδες

Μονάδες 5 

2011 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β2. Ποια είναι η μορφή των μεταφασικών χρωμοσωμάτων ενός κυττάρου (μονάδες 3), σε τι διαφέρουν μεταξύ τους (μονάδες 3) και με ποια κριτήρια ταξινομούνται κατά τη δημιουργία καρυοτύπου; (μονάδες 3)

Μονάδες 9

2011 ΟΜΟΓΕΝΕΙΣ

Β2. Να εξηγήσετε πώς συνδέονται μεταξύ τους οι δύο αλυσίδες ενός δίκλωνου μορίου DNA.

Μονάδες 6 

2012 ΟΜΟΓΕΝΕΙΣ

Β3. Τι ονομάζεται καρυότυπος;

Μονάδες 6 

2013 ΕΣΠΕΡΙΝΟ

Β3. Ποιες πληροφορίες περιέχει το μιτοχονδριακό DNAκαι γιατί τα μιτοχόνδρια χαρακτηρίζονται ως ημιαυτόνομα οργανίδια;

Μονάδες 6

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β3. Ποια βιοχημικά δεδομένα υποστήριζαν ότι το DNAείναι το γενετικό υλικό, την εποχή που οι Avery, Mac-Leodκαι McCartyεπανέλαβαν invitroτα πειράματα του Griffith;

Μονάδες 9 

2013 ΟΜΟΓΕΝΕΙΣ

Β2. Να ορίσετε τις εκφράσεις: invivo, invitro, ιχνηθέτηση. (μονάδες 6) Να αναφέρετε από ένα παράδειγμα. (μονάδες 3)

Μονάδες 9

2014 ΕΣΠΕΡΙΝΟ

Β1. Να τοποθετήσετε στη σωστή σειρά τα παρακάτω βήματα τα οποία οδηγούν στην κατασκευή καρυότυπου, γράφοντας μόνο τους αριθμούς

1.Τα κύτταρα επωάζονται σε υποτονικό διάλυμα.

2.Αναστέλλεται ο κυτταρικός κύκλος στο στάδιο της μετάφασης.

3.Τα χρωμοσώματα παρατηρούνται στο μικροσκόπιο.

4.Γίνεται επαγωγή κυτταρικών διαιρέσεων με ουσίες που έχουν μιτογόνο δράση.

5.Τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος.

6.Τα χρωμοσώματα απλώνονται σε αντικειμενοφόρο πλάκα και χρωματίζονται με ειδικές χρωστικές ουσίες.

Μονάδες 6

2014 ΟΜΟΓΕΝΕΙΣ

Β4. Η βασική μονάδα οργάνωσης της χρωματίνης είναι το νουκλεόσωμα. Να περιγράψετε τη δομή του.

Μονάδες 6

2015 ΗΜΕΡΗΣΙΟ

Β1. Να αντιστοιχίσετε τον αριθμό της στήλης Ι με ένα μόνο γράμμα, Α ή Β, της στήληςΙΙ.

Στήλη Ι Στήλη ΙΙ
1. Στην πλειονότητά τους έχουν την ικανότητα κυτταρικής διαίρεσης Α: Σωματικά κύτταρα στην αρχή της μεσόφασης
2. Παράγονται με μείωση
3. Δεν έχουν την ικανότητα κυτταρικής διαίρεσης
4. Στον άνθρωπο έχουν DNA συνολικού μήκους δύο μέτρων
5. Παράγονται με μίτωση Β: Γαμέτες
6. Οι μεταλλάξεις στο DNA τους δεν κληρονομούνται στην επόμενη γενιά
7. Στον άνθρωπο έχουν DNA συνολικού μήκους 3Χ109ζεύγη βάσεων
8. Οι μεταλλάξεις στο DNA τους κληρονομούνται στην επόμενη γενιά

Μονάδες 8

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Σωστό ή Λάθος

ε. Η μελέτη των χρωμοσωμάτων με καρυότυπο είναι δυνατή μόνο σε κύτταρα που διαιρούνται. 

2015 ΟΜΟΓΕΝΕΙΣ

Β2. Πώς καθορίζεται το φύλο στον άνθρωπο;

Μονάδες 4 

2016 ΗΜΕΡΗΣΙΟ

Β2. Τι είναι ο καρυότυπος; (μονάδες 4). Να αναφέρετε δύο (2) συμπεράσματα που μπορούν να εξαχθούν από τη μελέτη του καρυότυπου ενός ανθρώπου (μονάδες 4).

Μονάδες 8

2016 ΕΣΠΕΡΙΝΟ

Β3. Η ανάλυση της αλληλουχίας των βάσεων ενός μορίου DNAέδειξε ότι αυτό αποτελείται από 4800 νουκλεοτίδια με Αδενίνη, 4280 με Κυτοσίνη, 4530 με Θυμίνη και 4610 με Γουανίνη. Να εξηγήσετε αν αυτό το μόριο DNAμπορεί να αποτελεί γενετικό υλικό.

Μονάδες 3

2016 ΟΜΟΓΕΝΕΙΣ

Β2. Σε τι αναφέρεται ο όρος γονιδίωμα (μονάδες 2); Σε σχέση με το γονιδίωμα, ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή (μονάδες 4);

Μονάδες 6 

2017 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ-ΟΜΟΓΕΝΕΙΣ

Β2. Ποια από τα παρακάτω είναι δυνατόν να παρατηρηθούν με οπτικό μικροσκόπιο και ποια μόνο με ηλεκτρονικό;

α.νουκλεοσώματα

β.μεταφασικό χρωμόσωμα

γ.πολύσωμα

δ.θηλιά έναρξης αντιγραφής

ε.δρεπανοκύτταρα.

Μονάδες 5

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ 

Β4.Να αντιστοιχίσετε σωστά τον κάθε αριθμό της στήλης Ιμε ένα μόνο γράμμα Α ή Β της στήλης ΙΙ, με βάση την ομοιότητα του μιτοχονδριακού DNAτων ατόμων της στήλης Ι.

Στήλη Ι Στήλη ΙΙ
1. Πατέρας και κόρη του Α. Ίδιο μιτοχονδριακό DNA
2. Παππούς και εγγονή του
3. Μητέρα και κόρη της
4. Αδελφός και αδελφή του Β. Διαφορετικό μιτοχονδριακό DNA
5. Πατέρας και γιος του
6. Μητέρα και γιος της
7. Αγόρι και αδελφός της μητέρας του

 

Μονάδες 7

ΘΕΜΑ Γ

2000 ΕΣΠΕΡΙΝΟ

Α.Ο αριθμός και η μορφολογία των χρωμοσωμάτων είναι ιδιαίτερο χαρακτηριστικό των κυττάρων κάθε ζωντανού οργανισμού.

α) Ποια είναι τα μορφολογικά χαρακτηριστικά των χρωμοσωμάτων που παρατηρούνται σ’ ένα καρυότυπο;

Μονάδες 7

β) Πώς μπορεί να διαπιστωθεί το φύλο ενός ανθρώπου από τον καρυότυπο των σωματικών κυττάρων του;

Μονάδες 8

Β. Σ’ ένα ανθρώπινο σωματικό κύτταρο και σ’ ένα ανθρώπινο γαμέτη, ποια διαφορά υπάρχει στο γονιδίωμά τους και πώς ονομάζονται τα κύτταρα αυτά λόγω της συγκεκριμένης διαφοράς;

Μονάδες 10

2001 ΗΜΕΡΗΣΙΟ

1.Σε δύο κύτταρα έγινε ανάλυση του γενετικού τους υλικού και βρέθηκε η παρακάτω επί τοις % σύσταση σε αζωτούχες βάσεις.

Α Τ C G
Κύτταρο 1: 28 28 22 22
Κύτταρο 2: 31 31 19 19

Τα κύτταρα 1, 2 ανήκουν στο ίδιο ή σε διαφορετικά είδη οργανισμών

Μονάδες 2

Να αιτιολογήσετε την απάντησή σας.

Μονάδες 3

2002 ΟΜΟΓΕΝΕΙΣ

1.Ποια είναι η δομή του DNAστο χώρο, σύμφωνα με το μοντέλο της διπλής έλικας;

Μονάδες 12

2005 ΟΜΟΓΕΝΕΙΣ

Α. Στα σωματικά κύτταρα του ανθρώπου υπάρχουν σαράντα έξι (46) χρωμοσώματα.

1.Πόσα χρωμοσώματα κληρονομεί ένα παιδί από τον πατέρα του;

Μονάδες 2

Να δικαιολογήσετε την απάντησή σας.

Μονάδες 3

2.Πόσα αυτοσωμικά χρωμοσώματα υπάρχουν στα σωματικά κύτταρα μιας γυναίκας;

Μονάδες 2

Να δικαιολογήσετε την απάντησή σας.

Μονάδες 3

2010 ΟΜΟΓΕΝΕΙΣ 

Γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που έγινε σε κύτταρα του εμβρύου διαπιστώθηκε τρισωμία 18 και σύνδρομο Turner.

Γ1.Να περιγράψετε τη διαδικασία κατασκευής του καρυότυπου.

Μονάδες 10

2014 ΕΣΠΕΡΙΝΟ

Γ1. Να τοποθετήσετε κατά μέγεθος από το μικρότερο στο μεγαλύτερο, ανάλογα με την ποσότητα του γενετικού υλικού, τα παρακάτω: νουκλεόσωμα, μεταφασικό χρωμόσωμα, γονίδιο, αδελφή χρωματίδα (Το μέσο γονίδιο αποτελείται περίπου από 1000 ζεύγη βάσεων.)

Μονάδες 4

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ – ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

 Γ1. Το φύλο στα κουνέλια καθορίζεται όπως και στον άνθρωπο. Όταν ένα φυσιολογικό σωματικό κύτταρο θηλυκού κουνελιού βρίσκεται στη μετάφαση, το μήκος του DNAτου πυρήνα του είναι 1,6m. Με βάση αυτά τα δεδομένα, το μήκος του συνολικού DNAτου κάθε φυσιολογικού γαμέτη αυτού του κουνελιού είναι:

α)1,6m, β)0,4m,γ) 0,8m, δ)λίγο μεγαλύτερο από 0,4m.

Να γράψετε στο τετράδιό σας τη σωστή απάντηση (μονάδες 2) και να αιτιολογήσετε την επιλογή σας. (μονάδες 3)

Μονάδες 5

Γ2. Σύμφωνα με τα δεδομένα του ερωτήματος Γ1, θα είναι το ίδιο ή όχι το συνολικό μήκος του DNAόλων των φυσιολογικών γαμετών ενός αρσενικού κουνελιού, με το μήκος του συνολικού DNAτων φυσιολογικών γαμετών ενός θηλυκού κουνελιού;

Μονάδες 3

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ3. Ένα φυσιολογικό ωάριο ενός πιθήκου περιέχει 24 χρωμοσώματα. Πόσες αλυσίδες DNAυπάρχουν στον καρυότυπο του συγκεκριμένου οργανισμού; (μονάδες 3) Να αιτιολογήσετε την απάντησή σας. (μονάδες 6)

Μονάδες 9

2018 ΕΣΠΕΡΙΝΟ

Γ1. Στα κύτταρα ενός οργανισμού που βρίσκονται στη μετάφαση υπάρχουν 96 μόρια DNA. Να βρείτε:

α. τον αριθμό των χρωμοσωμάτων και των χρωματίδων που υπάρχουν στη μετάφαση.

β. τον αριθμό των ινιδίων χρωματίνης που υπάρχουν στην αρχή της μεσόφασης και στο τέλος της.

γ. τον αριθμό των μορίων DNA στην αρχή της μεσόφασης και στο τέλος της.

δ. τον αριθμό των χρωμοσωμάτων και των μορίων DNA στους γαμέτες.

ε. τον αριθμό των χρωμοσωμάτων και των μορίων DNA στο φυσιολογικό ζυγωτό.

Μονάδες 10

ΘΕΜΑ Δ

2000 ΗΜΕΡΗΣΙΟ

Ένα ανθρώπινο σωματικό κύτταρο έχει 46 χρωμοσώματα.

Α.1. Πόσα μόρια DNAσυνολικά υπάρχουν στα χρωμοσώματα του συγκεκριμένου κυττάρου, στο στάδιο της μετάφασης της μίτωσης;

          Μονάδες 2

  1. Να δικαιολογήσετε την απάντησή σας.

Μονάδες 4

Β. Να περιγράψετε τις χαρακτηριστικές μορφές, με τις οποίες εμφανίζεται το γενετικό υλικό ενός ευκαρυωτικού κυττάρου, ανάλογα με το στάδιο του κυτταρικού κύκλου που βρίσκεται.

Μονάδες 9

2012 ΗΜΕΡΗΣΙΟ

Δ4. Από τη μύγα Drosophilaαπομονώθηκαν τρία διαφορετικά φυσιολογικά κύτταρα στα οποία προσδιορίστηκε το μέγεθος του γονιδιώματος σε ζεύγη βάσεων. Στο πρώτο κύτταρο το μέγεθος του γονιδιώματος υπολογίστηκε σε 3,2·108ζεύγη βάσεων, στο δεύτερο κύτταρο σε 1,6·108ζεύγη βάσεων και στο τρίτο κύτταρο σε 6,4·108ζεύγη βάσεων. Να δικαιολογήσετε γιατί υπάρχουν οι διαφορές αυτές στο μέγεθος του γονιδιώματος των τριών κυττάρων.

Μονάδες 6

 

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 8ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ

ΘΕΜΑ Α

2003 ΕΣΠΕΡΙΝΟ

1.Οι ιντερφερόνες είναι

α.αντιικές πρωτεΐνες που παράγονται από κύτταρα που έχουν μολυνθεί από ιούς.

β.ένζυμα που ελέγχουν το μεταβολισμό των σακχάρων.

γ.πρωτεΐνες που προκαλούν σύντηξη των καρκινικών κυττάρων.

δ.χημικές ενώσεις που προκαλούν αλλαγές στα γονίδια.

Μονάδες 5

2003 ΟΜΟΓΕΝΕΙΣ

5.Τα μονοκλωνικά αντισώματα παράγονται από

α.καρκινικά κύτταρα.

β.έναν κλώνο Β-λεμφοκυττάρων.

γ.βακτήρια.

δ.ερυθρά αιμοσφαίρια.

Μονάδες 5

2004 ΗΜΕΡΗΣΙΟ

  1. Οι ιντερφερόνες που χρησιμοποιεί σήμερα ο άνθρωπος είναι δυνατόν να παράγονται σε μεγάλες ποσότητες από …

α.κύτταρα ανθρώπου.

β.κύτταρα ζώων.

γ.γενετικά τροποποιημένα βακτήρια.

δ.φυτικά κύτταρα.

Μονάδες 5

2004 ΕΣΠΕΡΙΝΟ

  1. Η ινσουλίνη είναι μια ορμόνη που ρυθμίζει

α.το μεταβολισμό των υδατανθράκων στο αίμα.

β.τη συγκέντρωση των πρωτεϊνών στο αίμα.

γ.τη συγκέντρωση των αλάτων στο αίμα.

δ.το μεταβολισμό της χοληστερόλης.

Μονάδες 5

2004 ΟΜΟΓΕΝΕΙΣ

  1. Οι ιντερφερόνες είναι πρωτεΐνες που παράγονται από κύτταρα

α.που μολύνθηκαν από ιούς.

β.που μολύνθηκαν από μύκητες.

γ.ατόμων με χρωμοσωμικές ανωμαλίες.

δ.μόνο φυτικών οργανισμών.

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

3.Exvivoονομάζεται η γονιδιακή θεραπεία κατά την οποία …

α. τα κύτταρα τροποποιούνται έξω από τον οργανισμό και εισάγονται πάλι σ’ αυτόν.

β.τα κύτταρα τροποποιούνται μέσα στον οργανισμό του ασθενούς.

γ.τα κύτταρα πολλαπλασιάζονται στο εργαστήριο.

δ.τα κύτταρα συντήκονται με αντισώματα.

Μονάδες 5 

2005 ΟΜΟΓΕΝΕΙΣ

  1. Κατά την invivoγονιδιακή θεραπεία

α.τα φυσιολογικά γονίδια εισάγονται κατ’ ευθείαν στον οργανισμό.

β.τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό.

γ.γίνεται πλήρης αντικατάσταση του μεταλλαγμένου γονιδίου.

δ.χρησιμοποιούνται ως φορείς βακτήρια ή πρωτόζωα.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

  1. Τα αντισώματα είναι

α.νουκλεϊκά οξέα.

β.πρωτεΐνες.

γ.υδατάνθρακες.

δ.λιπίδια.

Μονάδες 3

2006 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟΥ 

4.Στην exvivoγονιδιακή θεραπεία τα κύτταρα του ασθενούς

α.τροποποιούνται μέσα στον οργανισμό του.

β.τροποποιούνται έξω από τον οργανισμό του και εισάγονται πάλι σ’ αυτόν.

γ.συντήκονται με καρκινικά κύτταρα.

δ.ιχνηθετούνται με ραδιενεργό φώσφορο.

Μονάδες 5

2006 ΟΜΟΓΕΝΕΙΣ

5.Η γονιδιακή θεραπεία

α.εφαρμόζεται μόνο στα λεμφοκύτταρα.

β.έχει ως στόχο να διορθώσει μια γενετική βλάβη.

γ.αντικαθιστά πολλά μεταλλαγμένα γονίδια.

δ.μεταβιβάζεται πάντοτε στους απογόνους.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ

5.Η κυστική ίνωση κληρονομείται με

α.φυλοσύνδετο επικρατή τύπο κληρονομικότητας.

β.φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας.

γ.αυτοσωμικό επικρατή τύπο κληρονομικότητας.

δ.αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

5.Η ινσουλίνη είναι μια ορμόνη που

α.ρυθμίζει την παραγωγή αντιικών πρωτεϊνών.

β.ρυθμίζει το μεταβολισμό των υδατανθράκων.

γ.παράγεται από πρόδρομα ερυθροκύτταρα.

δ.παράγεται από Β-λεμφοκύτταρα.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

4.Κατά την invivoγονιδιακή θεραπεία

α.χρησιμοποιούνται μεταλλαγμένα βακτήρια ως φορείς.

β.τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό.

γ.γίνεται αντικατάσταση των μεταλλαγμένων γονιδίων.

δ.τα φυσιολογικά γονίδια εισάγονται κατευθείαν στον οργανισμό.

Μονάδες 5

2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

5.Οι ιντερφερόνες είναι πρωτεΐνες που

α.παράγονται από τα κύτταρα του παγκρέατος.

β.παράγονται από υβριδώματα.

γ.έχουν αντιιική δράση.

δ.φέρουν γενετικές πληροφορίες.

Μονάδες 5 

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

  1. Η γονιδιακή θεραπεία εφαρμόσθηκε για την αντιμετώπιση

α.της κυστικής ίνωσης.

β.του αλφισμού.

γ.της υπερχοληστερολαιμίας.

δ.του συνδρόμου Down.

Μονάδες 5

2009 ΟΜΟΓΕΝΕΙΣ

  1. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες

α.λιπιδίων.

β.DNA.

γ.RNA.

δ.μονοκλωνικών αντισωμάτων.

Μονάδες 5 

2010 ΕΣΠΕΡΙΝΟ

Α2. Η ινσουλίνη είναι μια ορμόνη που ρυθμίζει

α.τον μεταβολισμό των πρωτεϊνών.

β.τη συγκέντρωση των αλάτων στα ούρα.

γ.τον μεταβολισμό των υδατανθράκων στο αίμα.

δ.τη συγκέντρωση της χοληστερόλης στο αίμα.

Μονάδες 5

2011 ΗΜΕΡΗΣΙΟ

Α5. Τα υβριδώματα παράγονται ύστερα από

α.σύντηξη βακτηρίων με καρκινικά κύτταρα.

β.σύντηξη Β λεμφοκυττάρων με καρκινικά κύτταρα.

γ.σύντηξη Β λεμφοκυττάρων με ιούς.

δ.υβριδοποίηση δύο μονόκλωνων αλυσίδων DNA.

Μονάδες 5

2012 ΕΣΠΕΡΙΝΟ

Α3. Τα υβριδώματα παράγονται ύστερα από σύντηξη

α.β-λεμφοκυττάρων με ιούς

β.β-λεμφοκυττάρων με βακτήρια

γ.μονοκλωνικών αντισωμάτων με καρκινικά κύτταρα

δ.β-λεμφοκυττάρων με καρκινικά κύτταρα.

Μονάδες 5

2012 ΟΜΟΓΕΝΕΙΣ

Α1. Η ασθένεια που χαρακτηρίζεται από έλλειψη ή μείωση ινσουλίνης είναι

α.ο αλφισμός.

β.η φαινυλκετονουρία.

γ.ο διαβήτης.

δ.η αιμορροφιλία.

Μονάδες 5 

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α4. Τα υβριδώματα είναι

α.υβρίδια καλαμποκιού

β.καρκινικά κύτταρα

γ.υβριδικά μόρια DNA-RNA

δ.κύτταρα που προκύπτουν από σύντηξη Β-λεμφοκυττάρων με καρκινικά κύτταρα.

Μονάδες 5

2013 ΟΜΟΓΕΝΕΙΣ

Α4. Υβριδώματα ονομάζονται τα

α. κύτταρα που προκύπτουν από σύντηξη Β-λεμφοκυττάρων με καρκινικά κύτταρα.

β.κύτταρα που προκύπτουν μετά από βακτηριακή ζύμωση.

γ.υβρίδια καλαμποκιού.

δ.υβριδοποιημένα μόρια DNA.

Μονάδες 5

Α5. Τα αντισώματα είναι

α.νουκλεϊκά οξέα.

β.υδατάνθρακες.

γ.λιπίδια.

δ.πρωτεΐνες.

Μονάδες 5

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α5. Με τη γονιδιακή θεραπεία

α.παράγονται μονοκλωνικά αντισώματα

β.γίνεται εισαγωγή του φυσιολογικού αλληλόμορφου γονιδίου

γ.γίνεται αντικατάσταση του μεταλλαγμένου γονιδίου από το φυσιολογικό

δ.μεταβιβάζεται στους απογόνους το φυσιολογικό γονίδιο.

Μονάδες 5

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ 

Α5. Ο τύπος γονιδιακής θεραπείας κατά τον οποίο τα κύτταρα τροποποιούνται έξω από τον οργανισμό ονομάζεται

α.exvivo

β.ιχνηθέτηση

γ.invivo

δ.χαρτογράφηση.

Μονάδες 5

2014 ΟΜΟΓΕΝΕΙΣ

Α3. Η ινσουλίνη χρησιμοποιείται για τη θεραπεία

α.της αιμορροφιλίας

β.του εμφυσήματος

γ.της κυστικής ίνωσης

δ.του διαβήτη.

Μονάδες 5

Α4. Στόχος της γονιδιακής θεραπείας είναι η

α.παραγωγή μονοκλωνικών αντισωμάτων

β.αντικατάσταση του μεταλλαγμένου γονιδίου

γ.«διόρθωση» της γενετικής βλάβης

δ.παραγωγή φαρμακευτικών πρωτεϊνών.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ

Α4.Η κυστική ίνωση κληρονομείται ως

α.αυτοσωμικός επικρατής χαρακτήρας

β.φυλοσύνδετος υπολειπόμενος χαρακτήρας

γ.φυλοσύνδετος επικρατής χαρακτήρας

δ.αυτοσωμικός υπολειπόμενος χαρακτήρας.

Μονάδες 5

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α3. Οι ιντερφερόνες είναι

α.πρωτεΐνες

β.αντιβιοτικά

γ.εμβόλια

δ.αντισώματα.

Μονάδες 5

Α4. Για τη θεραπεία του διαβήτη χρησιμοποιούμε

α.α1-αντιθρυψίνη

β.ιντερφερόνες

γ.ινσουλίνη

δ.παράγοντα ΙΧ

Μονάδες 5

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α4. Η ανεπάρκεια του ανοσοποιητικού συστήματος λόγω έλλειψης του ενζύμου απαμινάση της αδενοσίνης (ADA)

α.οφείλεται στον ιό του AIDS

β.δεν μπορεί να αντιμετωπιστεί με γονιδιακή θεραπεία

γ.εμφανίζει αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας

δ.εμφανίζεται μόνο σε γενετικά τροποποιημένους οργανισμούς.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α2. Η ινσουλίνη

α.παράγεται από κύτταρα του ήπατος

β.ρυθμίζει τη συγκέντρωση των λιπιδίων στο αίμα

γ.αποτελείται από δύο μικρά πεπτίδια

δ.κωδικοποιείται από δυο γονίδια.

Μονάδες 5

2016 ΟΜΟΓΕΝΕΙΣ

Α3. Η πρώτη invivoγονιδιακή θεραπεία εφαρμόστηκε το 1993 για τη θεραπεία της

α.κυστικής ίνωσης

β.φαινυλκετονουρίας

γ.υπερχοληστερολαιμίας

δ.αιμορροφιλίας.

Μονάδες 5

Α4. Η ινσουλίνη

α.αποτελείται από μόρια γλυκόζης

β.παράγεται στο ήπαρ

γ.όταν απουσιάζει από τον οργανισμό προκαλείται διαβήτης

δ.αποτελείται από νουκλεοτίδια.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α5. Ο ανθρώπινος αντιαιμορροφιλικός παράγοντας ΙΧ παραλαμβάνεται από

α.διαγονιδιακά θηλυκά πρόβατα

β.διαγονιδιακά αρσενικά πρόβατα

γ.διαγονιδιακά αρσενικά και θηλυκά πρόβατα

δ.μικρής ηλικίας θηλυκά πρόβατα.

Μονάδες 5

2017 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ-ΟΜΟΓΕΝΕΙΣ

Α1. Η γονιδιακή θεραπεία είναι δυνατόν να εφαρμοστεί

α.στο σύνδρομο Down

β.στον καρκίνο του παχέος εντέρου

γ.στην αιμορροφιλία Α

δ.στην υπερχοληστερολαιμία.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Α5. Η γονιδιακή θεραπεία έχει ως στόχο τη «διόρθωση» της γενετικής βλάβης με

α. αντικατάσταση του φυσιολογικού επικρατούς αλληλόμορφου σε όλα τα κύτταρα του ασθενή

β.αντικατάσταση του φυσιολογικού επικρατούς αλληλόμορφου σε ορισμένα σωματικά κύτταρα του ασθενή

γ.την εισαγωγή του φυσιολογικού υπολειπόμενου αλληλόμορφου σε όλα τα κύτταρα του ασθενή

δ.την εισαγωγή του φυσιολογικού επικρατούς αλληλόμορφου σε ορισμένα σωματικά κύτταρα του ασθενή.

Μονάδες 5

2018 ΗΜΕΡΗΣΙΟ

Α3. Ραδιενεργός 32Ρ και ραδιενεργό 35S είναι δυνατόν να ενσωματωθούν αντίστοιχα:

α. σε έναν υποκινητή γονιδίου και ένα μονοκλωνικό αντίσωμα

β. στην DNA πολυμεράση και σε ένα πλασμίδιο

γ. στην RNA πολυμεράση και στην προϊνσουλίνη

δ. στον χειριστή του οπερονίου της λακτόζης και στην λακτόζη.

Μονάδες 5 

ΘΕΜΑ Β

2001 ΟΜΟΓΕΝΕΙΣ

  1. Να περιγράψετε την τεχνική παραγωγής μονοκλωνικών αντισωμάτων για ένα συγκεκριμένο αντιγόνο.

Μονάδες 10

ΕΣΠΕΡΙΝΟ 2002

Α.Να ξαναγράψετε στο τετράδιό σας τις προτάσεις, αφού συμπληρώσετε τα κενά με τις σωστές λέξεις.

1.Η ινσουλίνη είναι μία ορμόνη που αποτελείται από 51 ……… και παράγεται από ειδικά κύτταρα του ………….. Η ορμόνη αυτή ρυθμίζει το μεταβολισμό των ……….. και ειδικότερα το ποσοστό της γλυκόζης στο ………. .

Μονάδες 6

2002 ΟΜΟΓΕΝΕΙΣ

1.Τι είναι οι φαρμακευτικές πρωτεΐνες;

Μονάδες 5

  1. Να περιγράψετε πώς τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν ως θεραπευτικά μέσα.

Μονάδες 10

2004 ΗΜΕΡΗΣΙΟ

Να απαντήσετε στις παρακάτω ερωτήσεις:

  1. Ποιος είναι ο ρόλος των μονοκλωνικών αντισωμάτων ως ανοσοδιαγνωστικά;

Μονάδες 7

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

4.Με ποια διαδικασία παράγονται μονοκλωνικά αντισώματα στο εργαστήριο για ένα επιλεγμένο αντιγόνο;

Μονάδες 7

2005 ΗΜΕΡΗΣΙΟ

  1. Τι είναι οι ιντερφερόνες, τι προκαλούν και σε ποιες περιπτώσεις μπορούν να χρησιμοποιηθούν για την αντιμετώπιση ασθενειών;

Μονάδες 9

2005 ΕΣΠΕΡΙΝΟ

  1. Η γονιδιακή θεραπεία στηρίζεται στην εφαρμογή της τεχνολογίας του ανασυνδυασμένου DNA. (Σ-Λ)

Μονάδες 3

2006 ΕΣΠΕΡΙΝΟ

  1. Η ινσουλίνη είναι μία (ορμόνη – βιταμίνη) που αποτελείται από 51 (αμινοξέα – νουκλεοτίδια) και παράγεται από ειδικά κύτταρα του (ήπατος – παγκρέατος). Ρυθμίζει το μεταβολισμό των (υδατανθράκων – πρωτεϊνών) και ειδικότερα το ποσοστό τους (στο αίμα – στα ούρα). Η ασθένεια που οφείλεται στην έλλειψη ή μείωση της ινσουλίνης ονομάζεται (διαβήτης – αναιμία).

Μονάδες 6

  1. Η γονιδιακή θεραπεία στοχεύει να “διορθώσει” τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου.

Μονάδες 3

2006 ΟΜΟΓΕΝΕΙΣ

3.Τι είναι μονοκλωνικά αντισώματα και ως τι χρησιμοποιούνται;

Μονάδες 8

2007 ΕΣΠΕΡΙΝΟ

Β.Να γράψετε στο τετράδιό σας το γράμμα κάθε στοιχείου της Στήλης Ι και δίπλα στο γράμμα αυτό τον αριθμό ενός στοιχείου της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                   Στήλη Ι                                                      Στήλη ΙΙ

(ασθένεια)                                   (φαρμακευτική ουσία που ενδείκνυται)

α. διαβήτης                                                1.α1-αντιθρυψίνη

                   β.καρκίνος                                               2. απαμινάση της αδενοσίνης

                   γ.εμφύσημα                                              3. ιντερφερόνες

                   δ.κληρονομική ανεπάρκεια                      4. παράγοντας ΙΧ

                   ανοσοποιητικού συστήματος

                   ε.αιμορροφιλία Β                                      5. φαινυλαλανίνη

                                                                                     6.αυξητική ορμόνη

                                                                                     7.ινσουλίνη

Μονάδες 10

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

3.Τι είναι και πού οφείλεται η κυστική ίνωση; (μονάδες 2) Ποια είναι η διαδικασία που εφαρμόστηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993; (μονάδες 6)

Μονάδες 8

2008 ΗΜΕΡΗΣΙΟ

3.Πώς συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος στη μελέτη της εξέλιξής του και στη μαζική παραγωγή προϊόντων;

Μονάδες 7

2008 ΕΣΠΕΡΙΝΟ

2.Γιατί η “διόρθωση” μιας γενετικής βλάβης που επιτυγχάνεται με τη γονιδιακή θεραπεία δεν μεταβιβάζεται στους απογόνους;

Μονάδες 8

2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

4.Τι είναι γονιδιακή θεραπεία και ποιος ο στόχος της;

Μονάδες 4

2009 ΗΜΕΡΗΣΙΟ

  1. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου; (μονάδες 5) Ποια τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας; (μονάδες 2)

Μονάδες 7

2009 ΕΣΠΕΡΙΝΟ

Β. Ένας νέος τομέας της βιοτεχνολογίας που αναπτύσσεται ταχύτατα είναι η γονιδιακή θεραπεία.

1.Ποιος είναι ο στόχος της γονιδιακής θεραπείας;

Μονάδες 5

  1. Ποιες είναι οι προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας;

Μονάδες 6

  1. Να αναφέρετε ονομαστικά τους τύπους γονιδιακής θεραπείας.

Μονάδες 4

2010 ΕΣΠΕΡΙΝΟ

  1. Οι ιντερφερόνες παράγονται από κύτταρα που έχουν μολυνθεί από ………… .
  2. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες ενός …………… αντισώματος.

Μονάδες 4

2011 ΕΣΠΕΡΙΝΟ

Β1.Να γράψετε στο τετράδιό σας τα γράμματα της Στήλης Ι και δίπλα σε κάθε γράμμα, τον αριθμό της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία τηςΣτήλης ΙΙ περισσεύουν.

                       Στήλη Ι                                                            Στήλη ΙΙ

α.invivoγονιδιακή θεραπεία                               1.μικροέγχυση

       β.γενετική τροποποίηση ζώων                           2. περιοριστική ενδονουκλεάση

       γ.ημιαυτόνομα οργανίδια                                     3. ριβοσώματα

       δ.ένζυμο που συνδέει τμήματα DNA                   4. RNAπολυμεράση

       ε.πλασμίδιο Ti                                                      5. DNAδεσμάση

       στ.σύνθεση κυτταροπλασματικών πρωτεϊνών   6.μιτοχόνδρια

                                                                                     7.Agrobacteriumtumefaciens

                                                                                     8.κυστική ίνωση

Μονάδες 12

2011 ΟΜΟΓΕΝΕΙΣ

Β1. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 8 

2012 ΗΜΕΡΗΣΙΟ

Β1. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα για την επιλογή οργάνων συμβατών στις μεταμοσχεύσεις;

Μονάδες 6

2013 ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε τη διαδικασία που εφαρμόστηκε για πρώτη φορά το 1990  στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος, η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA).

Μονάδες 8

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β3. Μια από τις πιο ενδιαφέρουσες χρήσεις των μονοκλωνικών αντισωμάτων είναι η εφαρμογή τους στη θεραπεία του καρκίνου. Σε ποια ιδιότητα των μονοκλωνικών αντισωμάτων βασίζεται αυτή η εφαρμογή; (μονάδες 2) Να περιγράψετε τον τρόπο της θεραπευτικής τους δράσης. (μονάδες 4)

Μονάδες 6

2015 ΗΜΕΡΗΣΙΟ

Β4. Τι είναι η ινσουλίνη και ποιος είναι ο ρόλος της;

Μονάδες 6

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β2. β.Όλα τα αντιγόνα έχουν πάντα μία μόνο περιοχή που αναγνωρίζεται από μόνο ένα αντίσωμα. Σωστόή Λάθος

Μονάδα 1

2015 ΟΜΟΓΕΝΕΙΣ 

Β4. Τι ονομάζεται αντιγονικός καθοριστής (μονάδες 3) και ποια αντισώματα ονομάζονται μονοκλωνικά (μονάδες 3);

Μονάδες 6

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β4. Τα μονοκλωνικά αντισώματα μπορούν να συνεισφέρουν σημαντικά στην αύξηση της ευαισθησίας κλινικών δοκιμασιών όπως η ταυτοποίηση των ομάδων αίματος. Στην παρασκευή ενός τέτοιου τεστ προσδιορισμού των ομάδων αίματος, σύμφωνα με το σύστημα ΑΒ0, να εξηγήσετε πόσα και ποια μονοκλωνικά αντισώματα θα πρέπει να περιέχονται.

Μονάδες 6

2016 ΟΜΟΓΕΝΕΙΣ

Β1. Να αντιστοιχίσετε σωστά τον αριθμό (1, 2, 3, 4και 5) καθεμιάς από τις πρωτεΐνες της στήλης Ιμε το γράμμα της εφαρμογής (Α, Β, Γ, Δκαι Ε) που αναφέρεται στη στήλη ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. α1αντιθρυψίνη Α: Αντιιικός παράγοντας
2. Παράγοντας VIII B:Αιμορροφιλία Α
3. Παράγοντας ΙΧ Γ: Εμφύσημα
4. Ιντερφερόνες Δ: Τεστ κύησης
5. Μονοκλωνικά αντισώματα Ε: Αιμορροφιλία Β

 

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ

Β3. Κατά την έναρξη της κύησης ο οργανισμός της εγκυμονούσας παράγει μια ειδική ορμόνη, τη χοριακή γοναδοτροπίνη. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων που θα μπορούσαν να χρησιμοποιηθούν σε διαγνωστικούς ελέγχους (τεστ) κύησης.

Μονάδες 7

2017 ΕΣΠΕΡΙΝΟ

Β3. Στο μαστικό αδένα ενός προβάτου υπάρχει συγκεκριμένος κυτταρικός τύπος στον οποίο εκφράζεται το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος. Θέλουμε να πάρουμε την πρωτεΐνη α1-αντιθρυψίνη από το γάλα ενός διαγονιδιακού προβάτου. Για το λόγο αυτό εισάγουμε μέσα στο γονίδιο της καζεΐνης με κατάλληλο προσανατολισμό το γονίδιο της α1-αντιθρυψίνης. Να εξηγήσετε γιατί θα εκφραστεί το γονίδιο της α1-αντιθρυψίνης στα κύτταρα του μαστικού αδένα.

Μονάδες 6

Β4. Κατά την έναρξη της κύησης ο οργανισμός της εγκυμονούσας παράγει μια ειδική ορμόνη, τη χοριακή γοναδοτροπίνη. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων που θα μπορούσαν να χρησιμοποιηθούν σε διαγνωστικούς ελέγχους (τεστ) κύησης.

Μονάδες 7 

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Β1. Να αντιστοιχίσετε σωστά τον κάθε αριθμό της Στήλης Ι (δομές/μόρια) με ένα μόνο γράμμα της Στήλης ΙΙ(διαδικασίες). Επισημαίνεται ότι μία από τις διαδικασίες της Στήλης ΙΙ δεν έχει αντιστοιχία με κάποια από τις δομές/μόρια της Στήλης Ι.

Στήλη Ι (δομές/μόρια) Στήλη ΙΙ (διαδικασίες)
1. νουκλεόσωμα Α. Αντιγραφή
2. πριμόσωμα Β. Μετάφραση
3. πολύσωμα Γ. Ανοσοδιάγνωση
4. ριβονουκλεοπρωτεϊνικά σωματίδια Δ. Αντίστροφη μεταγραφή
5. μονοκλωνικά αντισώματα Ε. Συσπείρωση γενετικού υλικού
ΣΤ. Ωρίμανση mRNA

Μονάδες 5

Β2. Να αναφέρετε τα βήματα που απαιτούνται για να παραχθεί μια φαρμακευτική πρωτεΐνη ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 6

2018 ΗΜΕΡΗΣΙΟ

Β1. Να αντιστοιχίσετε τον κάθε αριθμό της στήλης Ι με ένα μόνο γράμμα της στήλης ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. Περιοριστική ενδονουκλεάση α. Πολυσακχαρίτης
2. Πρωταρχικό τμήμα
3. Πριμόσωμα β. Νουκλεϊκό οξύ
4. Άγαρ
5. Αντίσωμα γ. Πρωτεΐνη
6. Απαμινάση της αδενοσίνης
7. Πλασμίδιο

 

Μονάδες 7

Β3. Σε ποιους βασικούς στόχους της Ιατρικής έχει συμβάλει αποτελεσματικά η βιοτεχνολογία;

Μονάδες 3

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ

Β3. Ποιες ιδιότητες των υβριδωμάτων επιτρέπουν την αποτελεσματική τους χρήση στην παραγωγή μεγάλων ποσοτήτων μονοκλωνικών αντισωμάτων;

Μονάδες 6

ΘΕΜΑ Γ

2000 ΗΜΕΡΗΣΙΟ 

Α. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 9

2001 ΗΜΕΡΗΣΙΟ

  1. Μία ανωμαλία του γονιδίου που ελέγχει τη σύνθεση του ενζύμου απαμινάση της αδενοσίνης (ADA) προκαλεί μία ασθένεια του ανοσοποιητικού συστήματος. Απομονώθηκε το mRNAτου ενζύμου ADAαπό υγιές άτομο και από άτομο που ασθενεί. Τμήματα των παραπάνω mRNAείναι:

                   Υγιές άτομο:               AUGGAAUUUUGGGGGCGCACGUCG……

Άτομο που ασθενεί:   AUGGAAUUUUAGGGGCGCACGUCG……

α.Ποια είναι η αιτία της ασθένειας;

Μονάδες 6

β.Με ποιο τρόπο κληρονομείται αυτή η ασθένεια;

Μονάδες 2 

ΕΣΠΕΡΙΝΟ 2002

Α. 1. Τι είναι τα μονοκλωνικά αντισώματα;

Μονάδες 5

2.Πώς λειτουργούν τα μονοκλωνικά αντισώματα ως θεραπευτικά μέσα;

Μονάδες 8

2003 ΗΜΕΡΗΣΙΟ

1.Πώς αντιμετωπίζεται η κυστική ίνωση με γονιδιακή θεραπεία;

Μονάδες 10

2.Άνδρας ο οποίος πάσχει από κυστική ίνωση και υποβλήθηκε σε γονιδιακή θεραπεία για τη νόσο αποκτά παιδιά με φυσιολογική γυναίκα. Τι πιθανότητες υπάρχουν να είναι τα παιδιά τους φυσιολογικά; Να δικαιολογήσετε την απάντησή σας.

Μονάδες 15

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Η ινσουλίνη είναι μία ορμόνη απαραίτητη για την καλή λειτουργία του ανθρώπινου οργανισμού.

1.Ποιος είναι ο ρόλος της ινσουλίνης στον οργανισμό μας;

Μονάδες 5

2.Από τι αποτελείται το μόριο της ινσουλίνης;

Μονάδες 5

3.Να γράψετε συνοπτικά τα στάδια παραγωγής της ανθρώπινης ινσουλίνης σε καλλιέργεια βακτηρίων.

Μονάδες 15

2003 ΟΜΟΓΕΝΕΙΣ

Α. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990, σ’ ένα τετράχρονο κορίτσι που έπασχε από έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA). Να περιγράψετε τη διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας.

Μονάδες 10

2005 ΕΣΠΕΡΙΝΟ

Ο οργανισμός μας είναι ικανός να παράγει αντισώματα εναντίον κάθε ξένου αντιγόνου.

  1. Πώς ο αντιγονικός καθοριστής σχετίζεται με την παραγωγή μονοκλωνικών αντισωμάτων από τον οργανισμό;

Μονάδες 10

  1. Πώς παράγονται στο εργαστήριο μεγάλες ποσότητες μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο;

Μονάδες 15

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Η Βιοτεχνολογία με την παραγωγή μονοκλωνικών αντισωμάτων και τη γονιδιακή θεραπεία έχει συμβάλει αποτελεσματικά στην υλοποίηση των βασικών στόχων της Ιατρικής, μεταξύ των οποίων είναι και η αποτελεσματική θεραπεία ασθενειών.

1.Γιατί τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν στη θεραπεία του καρκίνου (Μονάδες 6) και ποια είναι τα πλεονεκτήματα που παρουσιάζει η χρήση τους έναντι άλλων μεθόδων θεραπείας του (Μονάδες 2);

Μονάδες 8

2.Ποια διαδικασία ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (Μονάδες 8) και τι πιθανά προβλήματα αντιμετωπίζουν τα άτομα που πάσχουν από τη συγκεκριμένη ασθένεια (Μονάδες 3);

Μονάδες 11

  1. Γιατί η χρήση της γονιδιακής θεραπείας θα είναι περιορισμένη στο άμεσο μέλλον;

Μονάδες 6

2007 ΗΜΕΡΗΣΙΟ

Η Βιοτεχνολογία με την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA, τη χρήση της τεχνικής PCRκαι την παραγωγή μονοκλωνικών αντισωμάτων συνεισφέρει σε τομείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική.

1.Τι επιτρέπει η μέθοδος της αλυσιδωτής αντίδρασης της πολυμεράσης (PCR); (μονάδες 4) Να αναφέρετε τρεις πρακτικές εφαρμογές της (μονάδες 3).

Μονάδες 7

2.Να περιγράψετε τη διαδικασία παραγωγής στο εργαστήριο μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 8

2007 ΟΜΟΓΕΝΕΙΣ

Βιοτεχνολογία, με την ευρεία έννοια, είναι η χρήση ζωντανών οργανισμών προς όφελος του ανθρώπου και στηρίζεται κυρίως σε τεχνικές καλλιέργειας και ανάπτυξης των μικροοργανισμών και σε τεχνικές ανασυνδυασμένου DNA.

1.Με ποιο τρόπο καλλιεργούνται οι μικροοργανισμοί σε μεγάλη κλίμακα (βιομηχανική καλλιέργεια);

Μονάδες 10

2.Τι εννοούμε με τον όρο ζύμωση και ποια είναι τα προϊόντα της ζύμωσης;

Μονάδες 5

3.Η ανθρώπινη ινσουλίνη είναι μία από τις φαρμακευτικές πρωτεΐνες που παράγονται από βακτήρια. Μία από τις μεθόδους που χρησιμοποιούνται για την παραγωγή της είναι η παραγωγή του πρόδρομου μορίου της σε μία βακτηριακή καλλιέργεια και η μετατροπή του σε ινσουλίνη με ενζυμική κατεργασία. Να γράψετε, συνοπτικά, τα στάδια αυτής της μεθόδου.

Μονάδες 10

2008 ΕΣΠΕΡΙΝΟ 

Για την παραγωγή του προδρόμου μορίου της ινσουλίνης, δηλαδή της προϊνσουλίνης, κατάλληλα μετασχηματισμένα κύτταρα Escherichiacoliκαλλιεργήθηκαν σε βιοαντιδραστήρα. Η απεικόνιση της μεταβολής του πληθυσμού του βακτηρίου (Ν) σε σχέση με το χρόνο (t) έδωσε το παρακάτω διάγραμμα:

2019-02-19, 22.37.53

1.Με βάση το διάγραμμα αυτό, να χαρακτηρίσετε τον τύπο της καλλιέργειας και να περιγράψετε τις φάσεις της.

Μονάδες 10

2.Σε ποια συνήθως χρονικά διαστήματα της καλλιέργειας των βακτηρίων αναμένεται να παραχθεί η προϊνσουλίνη; Αφού παραλάβουμε την προϊνσουλίνη από τον βιοαντιδραστήρα, πώς θα την μετατρέψουμε σε ινσουλίνη;

Μονάδες 10

3.Ποιος είναι ο βιολογικός ρόλος της ινσουλίνης και ποια ασθένεια προκαλεί η μείωση ή η έλλειψή της;

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

Για πρώτη φορά η γονιδιακή θεραπεία εφαρμόστηκε σε ένα κορίτσι που είχε έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA).

1.Ποιος είναι ο ρόλος του ενζύμου αυτού (μονάδες 3) και ποια τα συμπτώματα που εμφανίζουν τα άτομα με έλλειψη του συγκεκριμένου ενζύμου (μονάδες 6).

Μονάδες 9

2.Πώς ονομάζεται ο τύπος της γονιδιακής θεραπείας που εφαρμόστηκε (μονάδες 2) και γιατί (μονάδες 4).

Μονάδες 6

3.Ποια είναι η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας.

Μονάδες 10 

2010 ΗΜΕΡΗΣΙΟ

Γ1. Να περιγράψετε τις διαδικασίες με τις οποίες μπορούν να παραχθούν μονοκλωνικά αντισώματα, τα οποία συνεισφέρουν στον προσδιορισμό των ομάδων αίματος του ανθρώπου.

Μονάδες 7

2017 ΗΜΕΡΗΣΙΟ

Γ1. Στο μαστικό αδένα ενός προβάτου υπάρχει συγκεκριμένος κυτταρικός τύπος στον οποίο εκφράζεται το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος. Θέλουμε να πάρουμε την πρωτεΐνη α1-αντιθρυψίνη από το γάλα ενός διαγονιδιακού προβάτου. Για το λόγο αυτό εισάγουμε μέσα στο γονίδιο της καζεΐνης με κατάλληλο προσανατολισμό το γονίδιο της α1-αντιθρυψίνης. Να εξηγήσετε γιατί θα εκφραστεί το γονίδιο της α1-αντιθρυψίνης στα κύτταρα του μαστικού αδένα.

Μονάδες 6

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ2. Μετά την κλωνοποίηση ορισμένων γονιδίων ιντερφερονών είναι σήμερα δυνατή η παραγωγή τους σε μεγάλες ποσότητες από γενετικά τροποποιημένα βακτήρια. Να εξηγήσετε πώς θα παραλάβουμε ιντερφερόνη από καλλιέργεια γενετικά τροποποιημένων βακτηρίων σε βιοαντιδραστήρα.

Μονάδες 8

ΘΕΜΑ Δ

2006 ΗΜΕΡΗΣΙΟ

Μια φυσιολογική γυναίκα παντρεύεται έναν άνδρα και αποκτούν δύο παιδιά, το Γιάννη και την Ελένη. Ο Γιάννης παρουσιάζει οικογενή υπερχοληστερολαιμία και β-θαλασσαιμία, ενώ η Ελένη δεν παρουσιάζει καμιά από τις δύο ασθένειες. Να γράψετε τους πιθανούς γονότυπους των γονέων και των παιδιών (Μονάδες 6) και να δικαιολογήσετε την απάντησή σας (Μονάδες 6). Εάν οι συγκεκριμένοι γονείς αποκτήσουν και τρίτο παιδί, να προσδιορίσετε την πιθανότητα να πάσχει μόνο από υπερχοληστερολαιμία, χωρίς να ληφθεί υπόψη η β-θαλασσαιμία (Μονάδες 6).

Πρόσφατα ανακοινώθηκε μελέτη για την εφαρμογή της γονιδιακής θεραπείας σε ασθενείς που πάσχουν από β-θαλασσαιμία. Λαμβάνοντας υπόψη ότι τα γονίδια των αιμοσφαιρινών εκφράζονται στα πρόδρομα ερυθροκύτταρα, ποιος τύπος γονιδιακής θεραπείας θα μπορούσε να εφαρμοστεί για την αντιμετώπιση της β-θαλασσαιμίας και γιατί (Μονάδες 7);

Μονάδες 25

 

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 9ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗ ΓΕΩΡΓΙΑ ΚΑΙ ΤΗΝ ΚΤΗΝΟΤΡΟΦΙΑ

ΘΕΜΑ Α

 2000 ΗΜΕΡΗΣΙΟ

  1. Το πλασμίδιο Tiχρησιμοποιείται στη διαδικασία:

α.δημιουργίας διαγονιδιακών ζώων

β.δημιουργίας διαγονιδιακών φυτών

γ.παραγωγής ιντερφερόνης

δ.παραγωγής ινσουλίνης

Μονάδες 5

2001 ΗΜΕΡΗΣΙΟ

  1. Για να δημιουργήσουμε διαγονιδιακά φυτά χρησιμοποιούμε:

α.τη μέθοδο της μικροέγχυσης

β.τη μέθοδο της διαμόλυνσης

γ.το πλασμίδιο Ti.

Μονάδες 2

Να αιτιολογήσετε την επιλογή σας.

Μονάδες 3

2002 ΟΜΟΓΕΝΕΙΣ

Β.1.Τι είναι τα διαγονιδιακά ζώα;

Μονάδες 5

2003 ΕΣΠΕΡΙΝΟ

4.Το πλασμίδιο Ti

α.υπάρχουν σε όλα τα βακτήρια.

β.χρησιμοποιείται στη μικροέγχυση.

γ.χρησιμοποιείται στη γενετική τροποποίηση φυτών.

δ.υπάρχειστοBacillus thuringiensis.

Μονάδες 5

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

3.Το πλασμίδιο Tiχρησιμοποιείται στη γονιδιακή θεραπεία της κυστικής ίνωσης. (Σ-Λ)

Μονάδες 2

2003 ΟΜΟΓΕΝΕΙΣ

1.Διαγονιδιακά φυτά ονομάζονται αυτά τα οποία

α.έχουν υποστεί την επίδραση φυτοφαρμάκων.

β.προέκυψαν μετά από χρήση αντιβιοτικών.

γ.δε δίνουν απογόνους.

δ.έχουν υποστεί γενετική αλλαγή με τη χρήση τεχνικών γενετικής μηχανικής.

Μονάδες 5

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

4.Το πλασμίδιο Tiαπομονώνεται από …

α.τα βακτήρια του γένους Lactobacillus.

β.τοβακτήριοBacillus thuringiensis.

γ.τοβακτήριοAgrobacterium tumefaciens.

δ.τα βακτήρια του γένους Clostridium.

Μονάδες 5

2006 ΗΜΕΡΗΣΙΟ

  1. Η μικροέγχυση είναι μέθοδος

α.παραγωγής διαγονιδιακών ζώων.

β.εισαγωγής ξένου DNAσε ιούς.

γ.παραγωγής διαγονιδιακών φυτών.

δ.παραγωγής μονοκλωνικών αντισωμάτων.

Μονάδες 5

2007 ΕΣΠΕΡΙΝΟ

5.Το βακτήριο Bacillusthuringiensis

α. προκαλεί καρκίνο στα φυτά.

               β.χρησιμοποιείται για τη δημιουργία διαγονιδιακών ζώων.

               γ.παράγει μια τοξίνη με εντομοκτόνο δράση.

               δ.προκαλεί το μετασχηματισμό των κυττάρων.

Μονάδες 3

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

  1. Το πλασμίδιο Ti

α.απομονώνεται από το βακτήριοBacillusthuringiensis.

β.απομονώνεται από το βακτήριο Escherichiacoli.

γ.ενσωματώνεται στο γενετικό υλικό των φυτικών κυττάρων.

δ.ενσωματώνεται στο γενετικό υλικό των ζωικών κυττάρων.

Μονάδες 5

2007 ΟΜΟΓΕΝΕΙΣ

5.Στη μέθοδο της μικροέγχυσης χρησιμοποιούνται

α.Β-λεμφοκύτταρα.

β.πλασμίδια.

γ.καρκινικά κύτταρα.

δ.γονιμοποιημένα ωάρια ζώων.

Μονάδες 5

2008 ΗΜΕΡΗΣΙΟ

5.Τα ζώα, που έχουν υποστεί γενετική τροποποίηση λέγονται:

α.πολυγενετικά.

β.διαγονιδιακά.

γ.πολυπλοειδικά.

δ.πολυγονικά.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

3.Το βακτήριο Bacillusthuringiensisπου ζει στο έδαφος

α.παράγει μια ισχυρή τοξίνη.

β.εκκρίνει μια χρήσιμη ορμόνη.

γ.επιβιώνει για πολύ χρόνο.

δ.μολύνει τα διαγονιδιακά ζώα.

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

5.Το πλασμίδιο Tiαπομονώνεται από τα βακτήρια

α. Agrobacterium tumefaciens.

β.Bacillus thuringiensis.

γ.τουγένουςClostridium.

δ.τουγένουςLactobacillus.

Μονάδες 5

2009 ΗΜΕΡΗΣΙΟ

  1. Σε άτομα που πάσχουν από μια μορφή εμφυσήματος χορηγείται

α.παράγοντας ΙΧ.

β.αυξητική ορμόνη.

γ.ινσουλίνη.

δ.α1-αντιθρυψίνη.

Μονάδες 5

  1. Διαγονιδιακά είναι φυτά

α.τα οποία έχουν υποστεί γενετική αλλαγή.

β.στα οποία έχουν εισαχθεί ορμόνες.

γ.τα οποία έχουν εμβολιαστεί με αντιγόνα invitro.

δ.στα οποία έχουν εισαχθεί αντιβιοτικά.

Μονάδες 5

2009 ΕΣΠΕΡΙΝΟ

1.Το πλασμίδιο Tiεντοπίζεται στο βακτήριο

α. πνευμονιόκοκκος(Diplococcus pneumoniae).

β.Escherichia coli.

γ.Bacillus thuringiensis.

δ.Agrobacterium tumefaciens.

Μονάδες5

2009 ΕΠΑΝΑΛΗΠΤΙΚΑΗΜΕΡΗΣΙΟΥ

  1. Το πλασμίδιο Ti

α.προέρχεται από το βακτήριο Escherichiacoli.

β.προκαλεί καθυστέρηση στην αύξηση του φυτού.

γ.εισάγεται με μικροέγχυση στα φυτικά κύτταρα.

δ.προκαλεί όγκους στα φυτά στα οποία εισέρχεται.

Μονάδες 5

2010 ΕΣΠΕΡΙΝΟ

Α3. Τα διαγονιδιακά ζώα χρησιμοποιούνται για την παραγωγή

α.αυξητικής ορμόνης.

β.μικροβιακής βιομάζας.

γ.νουκλεϊκών οξέων.

δ.σακχάρων.

Μονάδες 5

Α5. Το πλασμίδιο Ti

α.υπάρχει σε πολλά είδη βακτηρίων.

β.βρίσκεται στο βακτήριοAgrobacteriumtumefaciens.

γ.ενσωματώνεται στο γενετικό υλικό των ζωικών κυττάρων.

δ.απομονώνεται από τους ιούς.

Μονάδες 5

2011 ΗΜΕΡΗΣΙΟ

Α3. Το πλασμίδιο Tiχρησιμοποιείται στη διαδικασία

α.της μικροέγχυσης.

β.δημιουργίας διαγονιδιακών ζώων.

γ.δημιουργίας διαγονιδιακών φυτών.

δ.παραγωγής υβριδωμάτων.

Μονάδες 5

2011 ΟΜΟΓΕΝΕΙΣ

Α3. Το πλασμίδιο Ti

α. υπάρχειστοBacillus thuringiensis.

β.χρησιμοποιείται στη μικροέγχυση.

γ.χρησιμοποιείται για τη γενετική τροποποίηση φυτών.

δ.χρησιμοποιείται για τη γενετική τροποποίηση ζώων.

Μονάδες 5

2012 ΕΣΠΕΡΙΝΟ

Α5. Στα άτομα που πάσχουν από σακχαρώδη διαβήτη χορηγείται

α.α1-αντιθρυψίνη

β.παράγοντας ΙΧ

γ.ινσουλίνη

δ.αυξητική ορμόνη.

Μονάδες 5

2012 ΟΜΟΓΕΝΕΙΣ

Α5. Γενετικά τροποποιημένα ονομάζονται τα φυτά, τα οποία έχουν

α.υποστεί γενετική αλλαγή με τη χρήση των τεχνικών της Γενετικής Μηχανικής.

β.προσλάβει αντιβιοτικά.

γ.προσλάβει ορμόνες.

δ.προκύψει από επιλεγμένες διασταυρώσεις.

Μονάδες 5

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α5. Το Agrobacteriumtumefaciens

α.παράγει μια ισχυρή τοξίνη δραστική στα έντομα

β.χρησιμοποιείται για τη δημιουργία διαγονιδιακών φυτών

γ.χρησιμοποιείται στη μέθοδο της μικροέγχυσης

δ.χρησιμοποιείται στη γονιδιακή θεραπεία.

Μονάδες 5

2014 ΟΜΟΓΕΝΕΙΣ

Α5. Το πλασμίδιο Tiπροέρχεται από

α. τοBacillus thuringiensis

β.τοAgrobacterium tumefaciens

γ.τοEscherichia coli

δ.βακτήριατουγένουςClostridium.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ

Α3.Για τη θεραπεία του εμφυσήματος χρησιμοποιείται

α.η α1-αντιθρυψίνη

β.η ινσουλίνη

γ.ο παράγοντας VIII

δ.η αυξητική ορμόνη.

Μονάδες 5 

2015 ΕΣΠΕΡΙΝΟ

Α4. Το πλασμίδιο Tiβρίσκεται στο βακτήριο

α. E. coli

β.Bacillus thuringiensis

γ. Lactobacillus

δ. Agrobacterium tumefaciens.

Μονάδες5

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α4. Για τη θεραπεία του διαβήτη χρησιμοποιούμε

α.α1-αντιθρυψίνη

β.ιντερφερόνες

γ.ινσουλίνη

δ.παράγοντα ΙΧ.

Μονάδες 5

Α5.Τα γενετικά τροποποιημένα φυτά ποικιλίας Btείναι ανθεκτικά σε

α.εντομοκτόνα

β.ζιζανιοκτόνα

γ.παγετό

δ.έντομα και σκώληκες.

Μονάδες 5

2015 ΟΜΟΓΕΝΕΙΣ

Α5. Η μικροέγχυση χρησιμοποιείται για τη δημιουργία

α.διαγονιδιακών φυτών

β.διαγονιδιακών ζώων

γ.γονιδιωματικής βιβλιοθήκης

δ.cDNAβιβλιοθήκης.

Μονάδες 5

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α3. Τα σωματικά κύτταρα του προβάτου Dollyπεριείχαν

α.ανασυνδυασμένο DNA

β.το σύνολο του γενετικού υλικού του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου που χρησιμοποιήθηκε στη διαδικασία της κλωνοποίησης

γ.το γονίδιο που είναι υπεύθυνο για τη σύνθεση της ανθρώπινης α1-αντιθρυψίνης

δ.το μιτοχονδριακό DNAτου ωαρίου στο οποίο τοποθετήθηκε ο πυρήνας του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου.

Μονάδες 5

Α5. Το πλασμίδιο Ti

α.δημιουργεί εξογκώματα στο βακτήριο Agrobacteriumtumefaciens

β.απομονώθηκε από τον βακτηριοφάγο Τ2

γ.είναι κυκλικό δίκλωνο μόριο DNA

δ.χρησιμοποιείται στη γονιδιακή θεραπεία της κυστικής ίνωσης.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α5. Η κλωνοποίηση είναι τεχνική που

α.δεν μπορεί να εφαρμοστεί σε μια καλλιέργεια μικροοργανισμών

β.εφαρμόζεται μόνο στους μικροοργανισμούς

γ.οδηγείται σε ένα σύνολο από διαφορετικούς οργανισμούς

δ.μπορεί να συνεισφέρει στην προστασία από την εξαφάνιση διαφόρων ζώων του πλανήτη μας.

Μονάδες 5

2016 ΟΜΟΓΕΝΕΙΣ

Α5. Τα γενετικά τροποποιημένα φυτά ποικιλίας Btείναι ανθεκτικά

α.στον παγετό

β.στα έντομα

γ.στην ξηρασία

δ.στα ζιζανιοκτόνα.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ) 

Α2. Το πλασμίδιο Ti

α.απομονώνεται από τους χλωροπλάστες φυτικών κυττάρων

β.απομονώνεται από τα μιτοχόνδρια φυτικών κυττάρων

γ.περιέχει γονίδια που δημιουργούν όγκους

δ.είναι γραμμικό δίκλωνο μόριο DNAπου απομονώνεται από βακτήρια.

Μονάδες 5 

2018 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α2. Σε άτομα που πάσχουν από αιμορροφιλία Β χορηγείται:

α. αυξητική ορμόνη

β. παράγοντας ΙΧ

γ. α1-αντιθρυψίνη

δ. παράγοντας VIII.

Μονάδες 5

2018 ΗΜΕΡΗΣΙΟ

Α5. Την πρωτεΐνη α1-αντιθρυψίνη θα την εντοπίσουμε σε βακτηριακό κλώνο cDNA βιβλιοθήκης που έχει κατασκευαστεί από ώριμο mRNA κυττάρων

α. παγκρέατος

β. ήπατος

γ. στομάχου

δ. μυελού των οστών.

Μονάδες 5

2018 ΕΣΠΕΡΙΝΟ

Α4. Η γενετική τροποποίηση αγελάδων γίνεται με την εισαγωγή ξένου DNA στον πυρήνα:

α.ενός ωαρίου

β.ενός σπερματοζωαρίου

γ.ενός ζυγωτού

δ.ενός μαστικού κυττάρου.

Μονάδες 5

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ

Α1. Η πρωτεΐνη παράγοντας ΙΧχρησιμοποιείται

α. στη θεραπεία του εμφυσήματος.

β. στον μεταβολισμό των υδατανθράκων.

γ. στη θεραπεία της κυστικής ίνωσης.

δ. στον μηχανισμό πήξης του αίματος.

Μονάδες 5

Α2. Από την αυτογονιμοποίηση ενός διαγονιδιακού φυτού Bt που δημιουργήθηκε μετά από τον μετασχηματισμό του με Agrobacterium, το ποσοστό των ομόζυγων ανθεκτικών απογόνων είναι

α. 0%

β. 25%

γ. 50%

δ. 75%

Μονάδες 5

ΘΕΜΑ Β

2001 ΕΣΠΕΡΙΝΟ

  1. Με τη Βιοτεχνολογία, η παραγωγή φαρμακευτικών πρωτεϊνών μπορεί να γίνει από ____________ ζώα.

Μονάδες 2

ΗΜΕΡΗΣΙΟ 2002

1.Να περιγράψετε τη διαδικασία για την παραγωγή στελέχους καλαμποκιού, ποικιλίας Bt.

Μονάδες 10 

2003 ΗΜΕΡΗΣΙΟ

2.Το 1997 οι ερευνητές του Ινστιτούτου Roselinτης Σκωτίας ανακοίνωσαν ότι κλωνοποίησαν ένα πρόβατο (Dolly). Ποια διαδικασία ακολούθησαν;

Μονάδες 10

2004 ΗΜΕΡΗΣΙΟ

Να απαντήσετε στις παρακάτω ερωτήσεις:

  1. Ποια βήματα απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο;

Μονάδες 9

2004 ΟΜΟΓΕΝΕΙΣ

Αα. Να αναφέρετε τα βήματα που απαιτούνται για την παραγωγή φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 12

β.Τι είναι η μικροέγχυση;

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

Να απαντήσετε στις παρακάτω ερωτήσεις:

1.Ποια είναι τα πλεονεκτήματα της χρησιμοποίησης διαγονιδιακών ζώων και φυτών για την αύξηση της ζωικής και φυτικής παραγωγής έναντι της κλασικής μεθόδου των διασταυρώσεων;

Μονάδες 7

2005 ΕΣΠΕΡΙΝΟ

Α.Να γράψετε στο τετράδιό σας τον αριθμό κάθε στοιχείου της Στήλης Ι και δίπλα στον αριθμό αυτό το γράμμα από στοιχείο της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                         Στήλη Ι                                                      Στήλη ΙΙ

  1. αντικωδικόνιο                                             α.αδελφές χρωματίδες

                   2.κεντρομερίδιο                                        β. ορμόνη

                   3.βιοαντιδραστήρας                                  γ. υβρίδωμα

                   4.διαγονιδιακά ζώα                                  δ. tRNA

                   5.ινσουλίνη                                              ε. μικροέγχυση

                                                                                     ζ. ιντερφερόνη

                                                                                     η.ζύμωση

Μονάδες 10

  1. Το πλασμίδιο Tiυπάρχει σε όλα τα διαγονιδιακά ζώα.(Σ-Λ)

Μονάδες 3 

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Να απαντήσετε στις παρακάτω ερωτήσεις:

1.Τι δυνατότητες δίνουν στους αγρότες τα γενετικά τροποποιημένα φυτά  (Μονάδες 4) και ποια είναι τα κυριότερα φυτά που έχουν τροποποιηθεί γενετικά (Μονάδες 5);

Μονάδες 9

2005 ΟΜΟΓΕΝΕΙΣ

  1. Τι είναι το πλασμίδιο Tiκαι πώς χρησιμοποιείται για τη δημιουργία των διαγονιδιακών φυτών;

Μονάδες 9 

2006 ΕΣΠΕΡΙΝΟ

  1. Οι γενετικά τροποποιημένες τομάτες δημιουργούνται με ελεγχόμενες διασταυρώσεις. (Σ-Λ)

Μονάδες 3

2006 ΟΜΟΓΕΝΕΙΣ

2.Ποια ονομάζουμε διαγονιδιακά ζώα και με ποιο τρόπο δημιουργούνται;

Μονάδες 9

2007 ΕΣΠΕΡΙΝΟ

Β.Να γράψετε στο τετράδιό σας το γράμμα κάθε στοιχείου της Στήλης Ι και δίπλα στο γράμμα αυτό τον αριθμό ενός στοιχείου της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                   Στήλη Ι                                                      Στήλη ΙΙ

(ασθένεια)                                   (φαρμακευτική ουσία που ενδείκνυται)

α. διαβήτης                                                1.α1-αντιθρυψίνη

                   β.καρκίνος                                               2. απαμινάση της αδενοσίνης

                   γ.εμφύσημα                                              3. ιντερφερόνες

                   δ.κληρονομική ανεπάρκεια                      4. παράγοντας ΙΧ

                   ανοσοποιητικού συστήματος                    5. φαινυλαλανίνη

                   ε.αιμορροφιλία Β                                      6.αυξητική ορμόνη

                                                                                     7.ινσουλίνη

Μονάδες 10

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

4.Ποια διαδικασία ακολούθησαν οι ερευνητές του Ινστιτούτου Roselinτης Σκωτίας για τη δημιουργία ενός κλωνοποιημένου προβάτου;

Μονάδες 6

2008 ΟΜΟΓΕΝΕΙΣ

3.Ποια ζώα ονομάζονται διαγονιδιακά και πού χρησιμοποιούνται;

Μονάδες 6

2009 ΕΣΠΕΡΙΝΟ

Α.Να γράψετε στο τετράδιό σας τον αριθμό κάθε στοιχείου της Στήλης Ικαι, δίπλα σε κάθε αριθμό, το γράμμα από στοιχείο της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν:

                         Στήλη Ι                                                      Στήλη ΙΙ

  1. διαβήτης                                                    α.αδελφές χρωματίδες

                   2.διαγονιδιακά ζώα                        β. ριβονουκλεοπρωτεϊνικά “σωματίδια”

                   3.κεντρομερίδιο                               γ. ινσουλίνη

                   4.ωρίμανση mRNA                         δ. μικροέγχυση

                   5.βιοαντιδραστήρας                         ε. ιντερφερόνη

                                                                            ζ.ζύμωση

                                                                            η.περιοριστικές ενδονουκλεάσες

Μονάδες 10

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

  1. Να περιγράψετε τη διαδικασία της κλωνοποίησης με την οποία δημιουργήθηκε το πρόβατο «Dolly».

Μονάδες 6

2009 ΟΜΟΓΕΝΕΙΣ

  1. Να αναφέρετε τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 9

2010 ΕΣΠΕΡΙΝΟ

Β1.Να γράψετε στο τετράδιό σας τα γράμματα της Στήλης Ι και δίπλα σε κάθε γράμμα, τον αριθμό της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                       Στήλη Ι                                                            Στήλη ΙΙ

α.πριμόσωμα                                                       1.ημιαυτόνομο οργανίδιο

       β.πολύσωμα                                                        2. πλασμίδιο

       γ.χλωροπλάστης                                                 3. μεταγραφή

       δ.φορέας κλωνοποίησης                                    4. ζύμωση

       ε.καρυότυπος                                                       5. μετάφραση

                                                                                     6.αντιγραφή

                                                                                     7.μεταφασικά χρωμοσώματα

Μονάδες 10

  1. Η εισαγωγή ξένου DNAσε γονιμοποιημένο ωάριο γίνεται με τη μέθοδο της ……. .

Μονάδες 2

2011 ΕΣΠΕΡΙΝΟ

Β1.Να γράψετε στο τετράδιό σας τα γράμματα της Στήλης Ι και δίπλα σε κάθε γράμμα, τον αριθμό της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία τηςΣτήλης ΙΙ περισσεύουν.

                       Στήλη Ι                                                            Στήλη ΙΙ

α.invivoγονιδιακή θεραπεία                               1.μικροέγχυση

       β.γενετική τροποποίηση ζώων                           2. περιοριστική ενδονουκλεάση

       γ.ημιαυτόνομα οργανίδια                                     3. ριβοσώματα

       δ.ένζυμο που συνδέει τμήματα DNA                   4. RNAπολυμεράση

       ε.πλασμίδιο Ti                                                      5. DNAδεσμάση

       στ. σύνθεση κυτταροπλασματικών πρωτεϊνών   6.μιτοχόνδρια

                                                                                     7.Agrobacteriumtumefaciens

                                                                                     8.κυστική ίνωση

Μονάδες 12

2012 ΗΜΕΡΗΣΙΟ

Β2. Να περιγράψετε τη διαδικασία κλωνοποίησης με την οποία δημιουργήθηκε το πρόβατο Dolly.

Μονάδες 7

2013 ΗΜΕΡΗΣΙΟ 

Β2. Να περιγράψετε τη μέθοδο της μικροέγχυσης.

Μονάδες 6

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ 

Β1. Ποια μειονεκτήματα παρουσιάζει η καταπολέμηση παρασίτων και εντόμων με χημικά εντομοκτόνα (μονάδες 2); Να αναφέρετε τους εναλλακτικούς τρόπους που βρέθηκαν για την αντιμετώπιση του προβλήματος αυτού (μονάδες 6).

Μονάδες 8

2013 ΟΜΟΓΕΝΕΙΣ

Β4. Ποια είναι τα πλεονεκτήματα από τη χρησιμοποίηση διαγονιδιακών φυτών και ζώων, έναντι της κλασικής μεθόδου των διασταυρώσεων, για την αύξηση της φυτικής και ζωικής παραγωγής;

Μονάδες 6

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Β4. Ποια ζώα ονομάζονται διαγονιδιακά;

Μονάδες 2

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β4. Να εξηγήσετε με ποιον τρόπο μπορεί να επιτευχθεί η βελτίωση της φυτικής και ζωικής παραγωγής εκτός από τη χρήση μεθοδολογιών Γενετικής Μηχανικής.  (μονάδες 4) Ποια είναι τα μειονεκτήματα από την εφαρμογή αυτής της μεθόδου; (μονάδες 3)

Μονάδες 7

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β2. α. Κατά τη δημιουργία των διαγονιδιακών ζώων χρησιμοποιούνται ωάρια που έχουν γονιμοποιηθεί στο εργαστήριο. Σωστό ή Λάθος

Μονάδα 1

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ 

Β4. Μια φαρμακευτική πρωτεΐνη που προορίζεται για ανθρώπινη χρήση, μπορεί να παραχθεί από το γάλα γενετικά τροποποιημένων θηλαστικών, από βακτήρια και από όργανα θηλαστικών που δεν είναι γενετικά τροποποιημένα.

Να αναφέρετε τους λόγους, για τους οποίους προτιμούμε να παράγουμε αυτή την πρωτεΐνη όχι από βακτήρια (μονάδες 2) ή από όργανα θηλαστικών (μονάδες 4), αλλά από το γάλα γενετικά τροποποιημένων θηλαστικών.

Μονάδες 6

2016 ΕΣΠΕΡΙΝΟ

Β5. Σε τι αναφέρονται οι όροι «κλώνος» και «κλωνοποίηση»;

Μονάδες 4

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β1. Στα φυτικά κύτταρα δεν αναμένουμε να υπάρχουν πλασμίδια. Πώς εξηγείται το γεγονός ότι σε ορισμένα φυτικά κύτταρα εντοπίζονται πλασμίδια;

Μονάδες 6

2016 ΟΜΟΓΕΝΕΙΣ

Β1. Να αντιστοιχίσετε σωστά τον αριθμό (1, 2, 3, 4και 5) καθεμιάς από τις πρωτεΐνες της στήλης Ιμε το γράμμα της εφαρμογής (Α, Β, Γ, Δκαι Ε) που αναφέρεται στη στήλη ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. α1αντιθρυψίνη Α: Αντιιικός παράγοντας
2. Παράγοντας VIII B:Αιμορροφιλία Α
3. Παράγοντας ΙΧ Γ: Εμφύσημα
4. Ιντερφερόνες Δ: Τεστ κύησης
5. Μονοκλωνικά αντισώματα Ε: Αιμορροφιλία Β

 

Μονάδες 5

2018 ΕΣΠΕΡΙΝΟ

Β1. Να αντιστοιχίσετε τον κάθε αριθμό της στήλης Ι με ένα μόνο γράμμα της στήλης ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. Περιοριστική ενδονουκλεάση α. Πολυσακχαρίτης
2. Πρωταρχικό τμήμα
3. Πριμόσωμα β. Νουκλεϊκό οξύ
4. Άγαρ
5. Αντίσωμα γ. Πρωτεΐνη
6. Απαμινάση της αδενοσίνης
7. Πλασμίδιο

 

Μονάδες 7

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ

Β2. Να διατάξετε με τη σωστή χρονική σειρά τα παρακάτω στάδια που αφορούν στην κλωνοποίηση του προβάτου Dolly. Αποτυπώστε στο τετράδιό σας τη σωστή σειρά χρησιμοποιώντας μόνο τα γράμματα α έως στ.

α. εισαγωγή ενός πυρήνα από κύτταρο του μαστικού αδένα σε απύρηνο ωάριο.

β.μεταφορά του εμβρύου σε θετή μητέρα.

γ.διαίρεση του κυττάρου που προέκυψε με τη βοήθεια ηλεκτρικής διέγερσης.

δ.λήψη κυττάρων από τον μαστικό αδένα ενός προβάτου και αφαίρεση του πυρήνα τους.

ε.κυοφορία και γέννηση του προβάτου Dolly.

στ.απομόνωση ωαρίου από άλλο πρόβατο και απομάκρυνση του πυρήνα.

Μονάδες 6

ΘΕΜΑ Γ

Β. Να γράψετε τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 9

2001 ΕΣΠΕΡΙΝΟ 

Να απαντήσετε στις δύο ερωτήσεις που ακολουθούν:

  1. Τα έντομα δημιουργούν μεγάλα προβλήματα στη γεωργία και οδηγούν σε σημαντική μείωση της παραγωγής. Γνωρίζετε αν η Βιοτεχνολογία μπορεί να βοηθήσει στην καταπολέμηση των εντόμων και με ποιο τρόπο μπορεί να γίνει αυτό;

Μονάδες 10

  1. Η ινσουλίνη είναι μία πρωτεΐνη που παράγεται από τον ανθρώπινο οργανισμό όπως και η αντιθρυψίνη (ΑΤΤ). Με ποιο τρόπο θα μπορούσε να παραχθεί η ινσουλίνη αν αξιοποιούσαμε τις δυνατότητες της γενετικής μηχανικής και τις ιδιότητες που έχουν τα διαγονιδιακά ζώα;

Μονάδες 15

2002 ΕΣΠΕΡΙΝΟ

Β.Να περιγράψετε από μία μέθοδο μεταφοράς γονιδίων

1.σε φυτά.

2.σε ζώα.

Μονάδες 12

2003 ΕΣΠΕΡΙΝΟ

Α.Το βακτήριοBacillusthuringiensisπου ζει στο έδαφος, παράγει μια τοξίνη η οποία είναι ισχυρότατο εντομοκτόνο. Ποια είναι τα στάδια της διαδικασίας παραγωγής ενός γενετικά τροποποιημένου φυτού που παρουσιάζει αντοχή στα έντομα αξιοποιώντας την παραπάνω ιδιότητα του βακτηρίου αυτού;

Μονάδες 10

Β.Τι είναι τα διαγονιδιακά ζώα;

Μονάδες 5

Ποια πλεονεκτήματα έχει η χρήση των ζώων αυτών για την αύξηση της ζωικής παραγωγής έναντι της κλασικής μεθόδου των διασταυρώσεων;

Μονάδες 10

2004 ΕΣΠΕΡΙΝΟ 

Α. Τι είναι τα διαγονιδιακά ή γενετικά τροποποιημένα φυτά;

Μονάδες 5

Β. Να περιγράψετε τη μέθοδο δημιουργίας των διαγονιδιακών φυτών.

Μονάδες 15

Γ. Να αναφέρετε δύο δυνατότητες που μπορούν να προσφέρουν στους αγρότες τα γενετικά τροποποιημένα φυτά.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

Η παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης μπορεί να γίνει και από τα διαγονιδιακά ζώα.

  1. Ποια είναι τα βήματα της διαδικασίας που προηγούνται της γέννησης ενός διαγονιδιακού ζώου;

Μονάδες 6

  1. Εκτός από τα διαγονιδιακά ζώα, από ποιους άλλους οργανισμούς είναι δυνατή η παραγωγή ανθρώπινης φαρμακευτικής πρωτεΐνης και σε ποιο χαρακτηριστικό του γενετικού κώδικα στηρίζεται η δυνατότητα αυτή;

Μονάδες 10

  1. Γιατί η κλωνοποίηση είναι χρήσιμη για τον πολλαπλασιασμό των διαγονιδιακών ζώων;

Μονάδες 9

2007 ΗΜΕΡΗΣΙΟ

Η Βιοτεχνολογία με την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA, τη χρήση της τεχνικής PCRκαι την παραγωγή μονοκλωνικών αντισωμάτων συνεισφέρει σε τομείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική.

3.Να περιγράψετε τη διαδικασία παραγωγής διαγονιδιακών φυτών, ανθεκτικών στα έντομα, με τη χρήση της τεχνολογίας του ανασυνδυασμένου DNAκαι του βακτηρίου Bacillusthuringiensis.

Μονάδες 10

2007 ΕΣΠΕΡΙΝΟ

Για τη δημιουργία ενός κλωνοποιημένου προβάτου – όπως ήταν η Dolly– χρησιμοποιούνται τρία πρόβατα Α, Β, Γ. Από το πρόβατο Α απομονώνεται ο πυρήνας από κύτταρο των μαστικών αδένων. Από ένα ωάριο του προβάτου Β αφαιρείται ο πυρήνας και στη θέση του εισάγεται ο πυρήνας του κυττάρου από το πρόβατο Α. Προκύπτει έτσι ένα νέο κύτταρο. Το κύτταρο αυτό υφίσταται λίγες διαιρέσεις και το έμβρυο που προκύπτει εμφυτεύεται στη μήτρα του προβάτου Γ. Μετά από λίγους μήνες γεννιέται το νέο πρόβατο (πρόβατο Δ).

2019-02-19, 22.26.37

1.Ποιο από τα πρόβατα Α, Β, Γ έχει ταυτόσημο πυρηνικό DNAμε το πρόβατο Δ και γιατί;

Μονάδες 8

2.Ποιο από τα πρόβατα Α, Β, Γ έχει ταυτόσημο μιτοχονδριακό DNAμε το πρόβατο Δ και γιατί;

Μονάδες 8

3.Με ποιο τρόπο η κλωνοποίηση μπορεί να συνεισφέρει στην προστασία από την εξαφάνιση διαφόρων ζωικών οργανισμών του πλανήτη μας;

Μονάδες 9

2010 ΗΜΕΡΗΣΙΟ 

Γ2. Να αναφέρετε ποιους τύπους αιμορροφιλίας γνωρίζετε και πού οφείλονται (μονάδες 2). Να περιγράψετε τη διαδικασία αντιμετώπισης μίας εξ αυτών, με βάση τη μέθοδο δημιουργίας διαγονιδιακών ζώων (μονάδες 6).

Μονάδες 8 

2016 ΕΣΠΕΡΙΝΟ

Γ3. «Στη μέθοδο αυτή χρησιμοποιούνται ωάρια του ζώου που έχουν γονιμοποιηθεί στο εργαστήριο. Σε αυτά γίνεται εισαγωγή του ξένου DNAμε ειδική μικροβελόνα. Το ξένο γενετικό υλικό ενσωματώνεται συνήθως σε κάποιο από τα χρωμοσώματα του πυρήνα του ζυγωτού».

Πώς ονομάζεται η μέθοδος που περιγράφεται στο παραπάνω κείμενο – απόσπασμα από το σχολικό βιβλίο (μονάδες 3) και πώς οι οργανισμοί που δημιουργούνται με αυτή τη μέθοδο (μονάδες 2);

Μονάδες 5

Γ4. Να αναφέρετε τα ονόματα δύο τουλάχιστον ειδών ζώων που δημιουργούνται αποκλειστικά με την παραπάνω μέθοδο.

Μονάδες 4

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ1. Το 1997 οι ερευνητές του Ινστιτούτου Roselinτης Σκωτίας ανακοίνωσαν ότι κλωνοποίησαν το πρόβατο Dolly. Τα γονίδια που έφεραν τα κύτταρα της Dollyπροέρχονταν από ένα ή περισσότερα πρόβατα; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 6)

Μονάδες 8

2018 ΗΜΕΡΗΣΙΟ

Δ3.Ένα είδος διπλοειδούς φυτού έχει δέκα χρωμοσώματα. Ένας ερευνητής έχει στη διάθεσή του δύο Βt διαγονιδιακά φυτά αυτού του είδους. Στο πρώτο, το γονίδιο της τοξίνης έχει ενσωματωθεί σε ένα από τα δύο ομόλογα χρωμοσώματα του πρώτου ζεύγους ενώ το δεύτερο σε ένα από τα δύο ομόλογα χρωμοσώματα του τέταρτου ζεύγους. Εάν τα δύο αυτά φυτά διασταυρωθούν μεταξύ τους, να γράψετε το ποσοστό των απογόνων της F1 γενιάς που θα είναι ανθεκτικά στα έντομα (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 3).

Μονάδες 5

Δεν απαιτείται η διατύπωση των νόμων του Mendel.

Διαγώνισμα κεφαλαίου 2. Το δόγμα της μοριακής βιολογίας και η ρύθμιση της γονιδιακής έκφρασης.

ΚΕΦ 2ο
σημείωση: στο ερώτημα V του 4 θέματος η ερώτηση: πόσα διαφορετικά μόρια λακτόζης απαιτούνται για την παραγωγή μορίων καταστολέα, αντικαθίσταται από την ερώτηση: πόσα διαφορετικά μόρια mRNA απαιτούνται για την παραγωγή μορίων καταστολέα;

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ 2018

 

ΖΗΤΗΜΑ 1Ο

A.

1) Η φαινοτυπική αναλογία της F2 γενεάς της διασταύρωσης Ρ: ΑΑΒΒΓΓ x ααββγγ στο πρότυπο διασταυρώσεων κατά Μέντελ είναι το ανάπτυγμα όπου αντί για + έχει :

α) (3+1)3

β) (9+1)2

γ) (3+3)2

δ) Τίποτα από τα παραπάνω

2) Ένα υβρίδωμα:

α) είναι τετραπλοείδες για το γονιδίωμα του ποντικου

β) είναι διπλοειδές για το γονιδίωμα του ποντικού

γ) είναι ένα ετεροκαρυο που φέρει τόσο το διπλοειδές γονιδίωμα του ποντικου όσο και το διπλοειδες γονιδιωμα του ανθρώπου

δ) φέρει το γονιδίωμα του ποντικού και το γονιδίωμα του μυελώματος και τα ανθρώπινα γονίδια για την παραγωγή των μονοκλωνικών αντισωμάτων.

3) Τα νουκλεϊκά οξέα είναι αποκλειστικά δομημένα από:

 α) μέταλλα

β) αμέταλλα

γ) μέταλλα και αμέταλλα

δ) είναι μονομερή των κυττάρων

4) Οι δεσμοί υδρογόνου (δ.Η) και οι φωσφοδιεστερικοί δεσμοί (Ρ-δ) απαντώνται στα δίκλωνα μόρια νουκλεϊκών οξέων.

α) Οι δ.Η είναι ασθενείς και δημιουργούνται αυθορμήτως μεταξύ των δύο πολυνουκλεοτιδικών αλυσίδων.

β) Οι Ρ-δ είναι ομοιοπολικοί ισχυροί δεσμοί που δημιουργούνται in vivo κατά τη φάση S και συγκρατούν τα νουκλεοτίδια  σε ένα πολυνουκλεοτιδικό κλώνο.

γ) Οι δ.Η σταθεροποιούν τη δομή της διπλής έλικας. Οι Ρ-δ απαιτούν κατανάλωση ενέργειας για να δημιουργηθούν.

δ) Όλα τα παραπάνω είναι ορθά.

ε) Τίποτα από τα παραπάνω δεν ισχύει.

5) Στα ευκαρυωτικά κύτταρα και στα προκαρυωτικά κύτταρα ισχύει:

γονίδια / γονιδίωμα = ε για ευκαρυωτικά, γονίδια / γονιδίωμα  = π για προκαρυωτικά

Ισχύει γενικά:

α) ε > π

β) π > ε

γ) π = ε

δ) Τίποτα από τα παραπάνω δεν είναι σωστό.

Β. Χαρακτηρίστε ως Σ (Σωστή) ή Λ (Λανθασμένη) την καθεμία από τις παρακάτω προτάσεις.

 1) Το νουκλεόσωμα αποτελείται από 146 ζεύγη νουκλεοτιδίων και 9 πρωτεΐνες.

2) Τα βακτηριακά κύτταρα μίας υγρής καλλιέργειας εκφράζουν τα ίδια γονίδια τόσο στην εκθετική όσο και στη στατική φάση μίας κλειστής καλλιέργειας, δεν εκφράζουν όμως γονίδια κατά τη φάση θανάτου.

3) Είναι εφικτή η δημιουργία cDNA βιβλιοθήκης ενός ρετροϊού, ενός αδενοϊού και του Τ2.

4) Μία μετάλλαξη που καταργεί τη ΘΕΑ του χρωμοσωμικού DNA των βακτηρίων είναι θανατηφόρος. Ομοίως, είναι θνησιγόνα μετάλλαξη και η κατάργηση από μετάλλαξη μίας ΘΕΑ από χρωμοσωμικό DNA ενός ανώτερου φυτού.

5) Σε ενα άτομο ομόζυγο για τα γονίδια βς, έγινε cDNA βιβλιοθήκη των ερυθροκυτταρων του, πριν και μετά την πλήρη θεραπεία του. Μεταξύ ενός ανιχνευτη αποτελούμενο από 25 νουκλεοτίδια και ενός ανιχνευτη αποτελούμενο από 5 νουκλεοτίδια, ποιον θα επέλεγαν οι επιστήμονες για να διακρίνουν τις δυο βιβλιοθήκες του ατόμου αυτού;

6) Αιμοσφαιρινη Α δεν παράγεται στα εμβρυακά ερυθροκύτταρα.

7) Οι δισουλφιδικοί δεσμοί αναπτύσσονται στις πρωτεινες μεταξύ των κυστείνων.

8) Οι επιλεκτικές διασταυρώσεις είναι βιοτεχνολογική μέθοδος

9) Εαν γνωρίζεται ότι το καρβοξυτελικό άκρο της λειτουργικής πρωτεινης είναι στο μικρο πεπτίδιο στο σχήμα που σας δίνεται  πάνω τότε σχεδιάστε πάνω στο μόριο της προϊνσουλίνης τους προσανατολισμούς του ενδιάμεσου πεπτιδιου που αφαιρείται. (2)

img8_2.jpg

(μονάδες 10)

ΖΗΤΗΜΑ 2Ο

 1) Δίνεται το παρακάτω πειραματικό σχήμα των Lederberg and Tatum 1946: 

Σε κάθε δοκιμαστικό σωλήνα υπάρχει διαφορετικό στέλεχος E. coli και διαφορετικό θρεπτικό υλικό.

2018 Προσομοίωση θετικής-02

ΥΠΟΜΝΗΜΑ

1) Bio = Βιοτίνη

2) Phe = Φαινυλαλανίνη

3) Cys = Kυστεΐνη

4) Thr = Θρεονίνη

5) Leu = Λευκίνη

6) Thi = Θειαμίνη

Τα τρυβλία 1 και 2 καθώς και 3 δεν περιέχουν τα συστατικά 1 έως 6 αλλά τα απαραίτητα συστατικά για να συντεθούν μέσω του μεταβολισμού των κυττάρων.

Ενώ και τα τρία τρυβλια εμβολιαστηκαν μόνο στο τρυβλιο 2 αναπτύχθηκαν αποικίες.

Στο επόμενο σχήμα δίνεται η πειραματική διάταξη του Β. Davis (1950).

Σε κάθε πλευρά του σωλήνα υπάρχει διαφορετικό στέλεχος E.coli και διαφορετικό θρεπτικό υλικό όπως φαίνεται στο σχήμα.

 

2018 Προσομοίωση θετικής-03

Σημείωση: Στα τρυβλία  της αμέσως παραπάνω εικόνας ενώ εμβολιαστηκαν το καθένα, με ένα από τα δυο διαφορετικά στελέχη που υπάρχουν στον σωλήνα εκατέρωθεν της ημιπερατής μεμβράνης 4 ωρές μετά τον εμβολιασμό του σωλήνα σε σχήμα U, σε κανένα τρυβλίο δεν αναπτύχθηκαν αποικίες, οι τελειες στο σχημα υποδηλωνουν τα σημεια οπου επεσαν μικροβια κατα τον εμβολιασμο των τρυβλιων αλλα δεν αναπτυχθηκαν εκει αποικιες.

Ποιο είναι το συμπέρασμα που προκύπτει από τα δύο παραπάνω πειράματα;

(15 μονάδες)

2) Δίνονται τα παρακάτω διαγράμματα μεταξύ των ατόμων δύο πληθυσμών που ακολουθούν το πρότυπο διασταυρώσεων κατά Mendel.

2018 Προσομοίωση θετικής-04

Εξηγήστε ποιος χαρακτήρας ελέγχεται μονογονιδιακά και ποιος πολυγονιδιακά (5).

3) Δίνεται το παρακάτω διάγραμμα που εκφράζει την πιθανότητα εμφάνισης μίας μετάλλαξης σε συνάρτηση με το χρόνο έκθεσης των σωματικών κυττάρων σε σταθερή δόση ακτινοβολίας ικανής για μεταλλαξιγένεση (5).

2018 Προσομοίωση θετικής-05

Εξηγήστε για ποιο λόγο τα κύτταρα εμφανίζουν μεγαλύτερη ακτινοευαισθησία στη μεσοφάση.

ΖΗΤΗΜΑ 3Ο                                                                                          ΜΟΝΑΔΕΣ 25

 1) Σας δίνεται το παρακάτω διάγραμμα μεταβολής της θερμοκρασίας σε συνάρτηση με το χρόνο. Σε ποια διαδικασία λαμβάνουν χώρα αυτές οι μεταβολές κυκλικά(2); Γιατί απαιτούνται αυτές οι θερμοκρασίες, τι συμβαίνει κάθε φορά(6); Γιατί οι φάσεις 2 έως 5 επαναλαμβάνονται 30 φορές, ποιο θα είναι το τελικό προϊόν αυτής της επαναληψιμότητας(6);

20170924_095456

2) Ένα φυσιολογικό άτομο προσέρχεται στο νοσοκομείο και εξετάζεται ο καρυότυπός του λαμβάνοντας από το άτομο αυτό αίμα. Μετά το τέλος της διαδικασίας δημιουργίας του καρυότυπου, στο άτομο αυτό εμφανίστηκαν δύο διαφορετικού φύλου, φυσιολογικοί ανθρώπινοι καρυότυποι.

α) Εξηγήστε πώς είναι δυνατόν κάτι τέτοιο!(4)

β) Ποια θα αναμένεται να είναι η ερώτηση που έκαναν οι γιατροί στον άνθρωπο αυτό, μετά την παρατήρηση του καρυότυπού του (3).

γ) Το άτομο αυτό έχει ομάδα αίματος Ο σύμφωνα με το σύστημα ΑΒΟ. Πόσες πρωτεΐνες ευθύνονται για την εμφάνιση αυτού του φαινοτύπου(4);

ΖΗΤΗΜΑ 4Ο

1) Στον πασίγνωστο Αρχαίο Ελληνικό μύθο του Οιδίποδα, ο ήρωας γίνεται τυχαία πατροκτόνος και στη συνέχεια εν αγνοία του παντρεύεται τη μητέρα του Ιοκάστη. Ο Οιδίποδας και η Ιοκάστη απέκτησαν τέσσερα παιδιά, τον Πολυνίκη, τον Ετεοκλή, την Αντιγόνη και την Ισμήνη.

Όταν ο Οιδίποδας έμαθε ποιον σκότωσε και ποια παντρεύτηκε, τυφλώθηκε και στη συνέχεια αυτοεξορίστηκε.

Παρακάτω δίνεται το γενεαλογικό δέντρο της οικογένειας του Οιδίποδα, όπως περιγράφεται στο μύθο.

2018 Προσομοίωση θετικής-06

Σύμφωνα με τον παραπάνω μύθο και με βάση τις γνώσεις σας στη Βιολογία, απαντήστε στις ερωτήσεις:

α) Ποιο είναι το μέγιστο και ποιο το ελάχιστο ποσοστό χρωμοσωμάτων μητρικής προέλευσης που φέρει η Αντιγόνη και η Ισμήνη;

β) Απαντήστε στο ίδιο ερώτημα για τα αρσενικά παιδιά του ζεύγους Οιδίποδα – Ιοκάστης.

γ) Μια σπάνια νόσος που οδηγεί σε τύφλωση εμφανίζεται σε άνδρες και γυναίκες αλλά οι άνδρες όταν εμφανίζουν αυτή τη νόσο πολύ συχνά εμφανίζουν και τρίχες στο εσωτερικό των αυτιών τους. Οι γυναίκες φυσιολογικά δεν εμφανίζουν ποτέ τρίχες στα αυτιά, είτε νοσούν από την ασθένεια που οδηγεί σε τύφλωση, είτε όχι. Όμως υπάρχουν άνδρες με τρίχες στο εσωτερικό των αυτιών που όμως δε νοσούν από αυτή τη μορφή τύφλωσης.

σημείωση: Για τα δυο γονίδια δεν ισχύει ο 2ος νομος Μεντελ. Για το γονίδιο που ελέγχει την τριχοφυια στα αυτιά  δεν ισχύει ο 1ος νομος Μεντελ.

Τόσο ο Λάιος, όσο και ο Οιδίποδας καθώς και οι δύο γιοί του Οιδίποδα εμφανίζουν τρίχες στο εσωτερικό των αυτιών τους. Ωστόσο ο βασιλιάς Λάιος δεν εμφάνισε τη νόσο που θα τον τύφλωνε, παρόλο που είχε ξεπεράσει κατά πολύ την ηλικία εμφάνισής της όταν θανατώθηκε από το γιο του Οιδίποδα.

Με ποια πιθανότητα κάθε γιος του Οιδίποδα θα εμφανίσει τη νόσο της τύφλωσης αυτής;

Υπάρχει περίπτωση η Αντιγόνη και η Ισμήνη να νοσήσουν από αυτή τη μορφή τύφλωσης; Εάν ναι, τότε οι κόρες του Οιδίποδα θα εμφανίσουν και τρίχες στο εσωτερικό των αυτιών τους;

δ) Ο πρωτότοκος γιος του Οιδίποδα, ο Πολυνικης, εάν παντρευόταν την αδελφή του Ισμήνη και έκαναν δύο παιδιά, ένα αγόρι και ένα κορίτσι, με ποια πιθανότητα κάθε παιδί θα εμφάνιζε τρίχες στα αυτιά και αυτή τη μορφή τύφλωσης;

Θεωρούμε γνωστό ότι: Ο Πολυνικης δεν τυφλώθηκε και είχε τρίχες στα αυτιά. Η Ισμήνη δεν τυφλώθηκε και ως γυναίκα δεν είχε τρίχες στα αυτιά. (5 * 4)

2) Δίνονται τα παρακάτω δύο πλασμίδια:

2018 Προσομοίωση θετικής-07

Το πλασμίδιο Α πέπτεται από την περιοριστική ενδονουκλεάση EcoRI.

Το πλασμίδιο Β πέπτεται από μια διαφορετική ενδονουκλεάση που αναγνωρίζει τη δίκλωνη αλληλουχία   GAATTC

CTTAAG

και σπάζει τους φωσφοδιεστερικούς δεσμούς μεταξύ του CT αφήνοντας κολλώδη άκρα.

Τα πλασμίδια Α και Β μπορούν να ανασυνδυαστούν μετά την πέψη τους από τις περιοριστικές ενδονουκλεάσες με τη δράση της DNA δεσμάσης (5);

 

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ 2018 (Β)

ΖΗΤΗΜΑ 1Ο

 Α. Επιλέξτε τη σωστή επιλογή που συμπληρώνει σωστά την πρόταση.

(μονάδες 20)

1) Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά τις ομάδες αίματος στο σύστημα ΑΒΟ του ανθρώπου:

2017 Διαγώνισμα προσομοίωσης Β-01

Τα άτομα της ΙΙΙ γενεάς έχουν φαινοτύπους:

α) Ο, Α, Β, Ο, Ο με πιθανότητα  (1/4)3 x(1/2) 2

β) Ο, Β, Ο, Α, Α με πιθανότητα  4 x(1/4)

γ) Ο, Α, Β, Ο, Α με πιθανότητα   1/4 x 1/4 x 1/4 x 1/4 x 1/4 x 1/4

δ) Ο, Ο, Ο, Ο, Ο με πιθανότητα  1 –  1023/1024

ε) Τίποτα από τα παραπάνω.

 

2) Δίνεται η παρακάτω υποθετική αλληλουχία του ενός κλώνου (κωδική

 

) γονιδίου που κωδικοποιεί για tRNA.

 

ΥΠΟΚΙΝΗΤΗΣ                   ΕΣΩΝΙΟ                     ΕΣΩΝΙΟ                        ΑΛΜ

ATCGCCTTAACCTACTACGCCTATACTATTCTATCCCCGCTATCTCATTCCTTT

—————-                    —————-                        ————                 ————-

Ποια είναι η αλληλουχία του ώριμου μεταγραφήματος;

α) Ομοίως με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

β) Συμπληρωματική με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

γ) Όμοια με την παραπάνω χωρίς τον υποκινητή και τα εσώνια αποτελούμενη από ριβονουκλεοτίδια.

δ) Συμπληρωματική με την παραπάνω χωρίς τον υποκινητή, τα εσώνια και τις ΑΛΜ αποτελούμενη από ριβονουκλεοτίδια.

ε) Τίποτα από τα παραπάνω.

3) Ένα άτομο προσήλθε στο νοσοκομείο και μετά από βιοχημικές εξετάσεις διαπιστώθηκε ότι έχει αυξημένα επίπεδα HbA2 και ήταν μολυσμένο από το πλασμώδιο. Το άτομο αυτό:

α) Νοσεί από δρεπανοκυτταρική αναιμία.

β) Νοσεί από β-θαλασσαιμία.

γ) Νοσεί από λοιμώδες νόσημα (ελονοσία).

δ) Είναι φορέας μίας γενετικής νόσου και δεν κινδυνεύει να πεθάνει από ελονοσία.

ε) Είναι φορέας δύο ασθενειών, της δρεπανοκυτταρικής αναιμίας (γενετική νόσος) και της ελονοσίας (λοιμώδης).

4) Ο καρκίνος είναι ένα γενετικό νόσημα που οφείλεται κατά κανόνα σε:

α) Έλλειψη πρωτοογκογονιδίων και υπερλειτουργία ογκοκατασταλτικών.

β) Έλλειψη ογκοκατασταλτικών και υπερλειτουργία πρωτοογκογονιδίων.

γ) Έλλειψη επιδιορθωτικών ενζύμων και υπερέκφραση ογκοκατασταλτικών γονιδίων.

δ) Λάθη που γίνονται κατά τη μείωση και τη μίτωση και οδηγεί σε ανευπλοειδία.

ε) Τίποτα από τα παραπάνω.

5) Στο βακτήριο E.coli η φυσιολογική έκφραση του ρυθμιστικού γονιδίου του οπερονίου της λακτόζης (υποθετικά) έχει ρυθμό 20 μόρια καταστολέα/24h και ρυθμό αποικοδόμησης καταστολέων 10 μόρια καταστολέα/24h όταν το βακτήριο αναπτύσσεται σε περιβάλλον με 100% γλυκόζη. Ένα βακτήριο που αναπτύσσεται σε περιβάλλον γλυκόζης και λακτόζης μετράται η παραγωγή των mRNA που κωδικοποιούνται από το οπερόνιο της λακτόζης.

2017 Διαγώνισμα προσομοίωσης Β-02

Στις χρονικές στιγμές t1, t2, t3 αντιστοίχως έχουμε μορια mRNA οπερονιου της λακτόζης:

α) 10 μόρια,     100 μόρια,        0 μόρια

β) 0 μόρια,       100 μόρια,        100 μόρια

γ) 10 μόρια,     100 μόρια,        100 μόρια

δ) 100 μόρια,   1000 μόρια,      0 μόρια

ε) Τίποτα από τα παραπάνω

Β. Χαρακτηρίστε ως Σ (Σωστή) ή Λ (Λανθασμένη) την καθεμία από τις παρακάτω προτάσεις:

α) Ένα πείραμα in vivo είναι το πείραμα δημιουργίας αμιγών στελεχών του Mendel.

β) Η Τρισωμία 21 (μη διαχωρισμός του 21ο χρωμοσώματος) έχει περισσότερες πιθανότητες να εμφανιστεί κατά τη μείωση σε σχέση με οποιαδήποτε άλλη τρισωμία του ανθρώπου.

γ) Για τα γονίδια α των αιμοσφαιρίνων ισχύουν οι νόμοι του Mendel.

δ) Ένα θηλυκό άτομο έχει όλα του τα γονίδια σε δύο αντίγραφα, ένα αρσενικό άτομο όχι.

ε) Το ρετινοβλάστωμα είναι μορφή καρκίνου που ελέγχεται μονογονιδιακά.

στ) Υπάρχει γονίδιό μας που γι’ αυτό υπάρχουν εκατοντάδες αντίγραφά του σε ένα μας κύτταρο.

ζ) Το ίδιο προϊόν ζύμωσης μπορεί να παράγεται από τον ίδιο μικροοργανισμό σε μεγάλες ποσότητες, τόσο στην εκθετική όσο και στη στατική.

η) Οι στόχοι της Ιατρικής είναι με τη σειρά: Η πρόληψη, η διάγνωση και η θεραπεία.

θ) Για τη δημιουργία των Βt φυτών δημιουργήθηκε cDNA βιβλιοθήκη του B. thurigiensis.

ι) Τα προϊόντα της ζύμωσης μπορεί να είναι ζωντανά ή νεκρά κύτταρα ή προϊόντα ζωντανών κυττάρων.

 

ΖΗΤΗΜΑ 2Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α. Δίνεται ο παρακάτω πίνακας. Να πραγματοποιηθούν όλες οι πιθανές αντιστοιχίσεις.

                                                            (μονάδες 5)

ΣΥΜΠΛΗΡΩΜΑΤΙΚΟΤΗΤΑ
1.     ΠΡΩΤΑΡΧΙΚΟ ΤΜΗΜΑ RNA Α. in vivo
2.     ΣΥΝΔΕΣΗ ΜΕΤΑΓΡΑΦΙΚΩΝ ΠΑΡΑΓ.
3.     ΔΗΜΙΟΥΡΓΙΑ 3΄       5΄ Ρ-ΔΕΣΜΩΝ B. in vitro
4.     ΣΥΝΔΕΣΗ ΚΟΛΛΩΔΩΝ ΑΚΡΩΝ
5.     ΙΧΝΗΘΕΤΗΜΕΝΟΣ ΑΝΙΧΝΕΥΤΗΣ Γ. ΤΙΠΟΤΑ ΑΠΟ ΤΑ ΠΑΡΑΠΑΝΩ

Β. 1) Ποιο θα είναι το αποτέλεσμα στην πρωτεΐνη που παράγεται σε προκαρυωτικό κύτταρο, αν στο γονίδιο που την κωδικοποιεί γίνει αντικατάσταση μίας βάσης;

(μονάδες 8)

2) Με ποιον από τους παρακάτω τρόπους θα μπορούσε να προκύψει ένα μηρυκαστικό ζώο το οποίο να παράγει τον πηκτικό παράγοντα ΙΧ στο γάλα του:

α) Με τη μέθοδο των επιλεκτικών διασταυρώσεων.

β) Με μεθόδους Γενετικής Μηχανικής.                                                    (μονάδες 2)

Αιτιολογήστε την απάντησή σας.                                                            (μονάδες 5)

3) Να αναφέρετε τα πλεονεκτήματα παραγωγής ανθρώπινης αυξητικής ορμόνης με μεθόδους Γενετικής Μηχανικής σε σχέση με την εξαγωγή της από πτώματα.

(μονάδες 5)

ΖΗΤΗΜΑ 3Ο

Α. Η Ράνια και η Αρεθα είναι δύο φίλες που ταξίδεψαν στο Περού πριν από μερικά χρόνια. Κατά το ταξίδι τους στα υψίπεδα των Άνδεων, εμφάνισαν συμπτώματα αναιμίας και μεταφέρθηκαν στο τοπικό νοσοκομείο, όπου και διαγνώστηκαν φαινοτυπικα ως ετεροζυγες για κάποιο παθολογικό αλληλόμορφο του γενετικού τόπου, όπου εδράζεται το γονίδιο της β σφαιρινης στο 11 χρωμόσωμα μας. Τα γονίδιά της α σφαιρινης εδράζονται στο 16ο χρωμόσωμα μας.

Μετά από βιοχημικές και μοριακές εξετάσεις στην Ελλάδα αποδείχθηκε ότι η Ράνια είναι φορέας της δρεπανοκυτταρική αναιμίας και η Αρεθα της μεσογειακής αναιμίας.

Παρακάτω φαίνεται το γενεαλογικό δένδρο των οικογενειών που δημιούργησαν οι δυο φίλες.

 2018 διόρθωση-01

Το άτομο ΙΙ3 νοσεί από δρεπανοκυτταρική αναιμία και το άτομο ΙΙ6 νοσεί από μεσογειακή αναιμία. Είναι γνωστό ότι τα άτομα ΙΙ8, ΙΙΙ7, ΙV6 είναι ομόζυγα φυσιολογικά για την μεσογειακή αναιμία και το άτομο ΙΙ1 είναι επίσης ομόζυγο φυσιολογικό για το γονίδιο β, ενώ ένα μόνο από τα άτομα ΙΙΙ2, ΙV2, V2 είναι ετεροζυγο για το γονίδιο βς.

Το άτομο VII1 γεννήθηκε με μίκροδρεπανοκυττταρική αναιμία.

α. Εάν υποθέσουμε ότι τα σχολικά εγχειρίδια στο Περού, κάνουν αναφορά στην δρεπανοκυτταρική αναιμία και την μεσογειακή αναιμία, με ποιο τρόπο κληρονόμησης νομίζετε ότι θα αναφέρουν ότι κληρονομούνται οι ασθένειες αυτές; (μονάδες 2)

β. Ποιά ήταν οι πιθανότητα, οι δυο φίλες να αποκτήσουν τον απόγονο VII1, που νοσεί από μίκροδρεπανοκυττταρική αναιμία, όπως προκύπτει από το γενεαλογικό δένδρο ; (5)

γ. Το ζευγάρι VI1, VI2, πρόκειται να αποκτήσει και δεύτερο παιδί. Το ζευγάρι ζήτησε γενετική καθοδήγηση για το ποιό είναι το ενδεχόμενο να αποκτήσει υγιές κορίτσι,  φορέα της δρεπανοκυτταρική αναιμίας ή υγιές αγόρι, φορέα της μεσογειακής αναιμίας ή υγιές κορίτσι ομόζυγο για το φυσιολογικό γονίδιο β1 ή υγιές αγόρι φορέα της δρεπανοκυττταρικής αναιμίας.

Τι τους απάντησε ο γενετιστής πριν και μετά τις μοριακές εξετάσεις για το γονίδιο β στο έμβρυο. Οι γονείς δεν θέλησαν ωστόσο να μάθουν το φύλο του δεύτερου παιδιού τους πριν την γέννηση του.(6)

Η μοριακή εξέταση έγινε με μια περιοριστική ενδονουκλεαση που πέπτει το αλληλόμορφο βς και το β όχι. Επίσης αποδείχθηκε ότι το παθολογικό αλληλόμορφο β1 για την μεσογειακή αναιμία έχει πάθει έλλειψη 25 ζ.β εντός της 5´ αμεταφραστής περιοχής του.

δ. Για ποιο λόγο η αναιμία, που προκαλείται από το αλληλόμορφο β1, αλλά και διάφορα άλλα παθολογικά αλληλόμορφα του γενετικού τόπου της β σφαιρίνης, που οδηγούν σε ελάττωση της φυσιολογικής ποσότητας της HbA ονομάζεται μεσογειακή αναιμία ; (3)

ε. Είναι γνωστό ότι το γονίδιο για την α σφαιρίνη εδράζεται στο 16 χρωμόσωμα μας, και αυτός ο γενετικός τόπος είναι διπλός, διαδοχικά ο ένας μετά τον άλλο. Ο γενετικός τόπος δε, 16p13.2 (πάνω) εκφράζεται με μικρότερο ρυθμό ( υποθετικά στο μισό) σε σχέση με τον γενετικό τόπο του α γονιδίου 16p13.1(κάτω). Εάν υποθέσουμε ότι ο πρώτος γενετικός τόπος φέρει γονίδιο α που εκφράζεται και παράγει 50 μοναδες των αλυσίδων α, τότε ο δεύτερος θα παράγει 100 μονάδες από α σφαιρίνες.

Ένα παιδί του ζευγαριού IV1, IV2, που και οι δυο είναι υγιείς, παντρεύτηκε και απέκτησε δύο παιδιά. Το πρώτο παράγει 200 μονάδες αλυσίδων α και νοσεί από δρεπανοκυτταρική αναιμία, ενώ το δεύτερο παιδί του παράγει 250 μονάδες αλυσίδων α και σε συνθήκες υποξύας εμφανίζει συμπτώματα αναιμίας και δεν παράγει καθόλου HbA2.

Ποιοί είναι οι γόνοτυποι των γονέων των δυο αυτών παιδιών για την α θαλασσαιμία; (2)

Με ποιά πιθανότητα, οι γονείς αυτοί, μπορούν να αποκτήσουν παιδί που θα παράγει 250 μονάδες α σφαιρίνων και θα παράγει περίπου 3% HbA2, ενώ θα νοσεί και από μικροδρεπανοκυττταρική αναιμία; (2)

Β. Το γονίδιο lux της πυγολαμπίδας ενθέτεται σε έναν πλασμιδιακό φορέα κλωνοποίησης που φέρει γονίδιο ανθεκτικότητας στην τετρακυκλίνη (tetR), το οποίο με τη σειρά του φέρει θέση αναγνώρισης από την EcoRI, καθώς και το γονίδιο lacZ του οπερονίου της λακτόζης:

α) Εξηγήστε αν τα κύτταρα-ξενιστές που δέχθηκαν τον ανασυνδυασμένο φορέα κλωνοποίησης θα εμφανίζουν βιοφωταύγεια. (μονάδες 3)

β) Ποια ιδιότητα πρέπει να χαρακτηρίζει τα κύτταρα-ξενιστές (E.coli) ώστε να μπορεί να γίνει η επιλογή των μετασχηματισμένων με το ανασυνδυασμένο.   (μονάδες 2)

ΖΗΤΗΜΑ 4Ο

Α. Τα αλληλόμορφα α+, β+, γ+ και δ+ είναι ανεξάρτητα μεταξύ τους και ελέγχουν το σχηματισμό μαύρου χρώματος σε ένα ζώο. Τα αλληλόμορφα α, β, γ, δ είναι τα υπολειπόμενα τα οποία δεν εκφράζονται.

     Ένα μαύρο άτομο που είναι καθαρή σειρά διασταυρώθηκε με ένα λευκό άτομο και στην F1 γενεά όλοι οι απόγονοι ήταν μαύροι. Στη συνέχεια διασταυρώθηκαν τα άτομα της F1 γενεάς.

Γνωρίζετε ότι το μεταβολικό μονοπάτι είναι:

α+                                β+                             γ+                            δ+

ΛΕΥΚΟ    —>      ΛΕΥΚΟ     —>     ΛΕΥΚΟ   – –>       ΚΑΦΕ    —>     ΜΑΥΡΟ

α) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΛΕΥΚΟ;

β) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΚΑΦΕ;                (μονάδες 5)

Β. Στο βακτήριο E.coli υπάρχει μία πρωτεΐνη με φυσιολογικό αμινοτελικό άκρο:                                         H2N – Met – Val – Ser – Ser – Pro – Met – Gly – Ala – Ala – Met – Ser …

Μία μετάλλαξη προκάλεσε αλλαγή στο αντικωδικόνιο ενός μορίου t

RNA  από 5΄- GAU – 3΄ σε 5΄- CAU – 3΄. Ποιο/α μπορεί να είναι τα πιθανά αμινοτελικά άκρα αυτής της πρωτεΐνης στα μεταλλαγμένα κύτταρα E.coli;               (μονάδες 5)

Γ. Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά την ασθένεια της μυοτονικής δυστροφίας.

2017 Διαγώνισμα προσομοίωσης Β-05

 

Η μυοτονική δυστροφία εμφανίζεται με βαθμιαία σοβαρότερα συμπτώματα από γενεά σε γενεά. Για να εξηγηθεί αυτή η παρατήρηση πραγματοποιήθηκαν μοριακές εξετάσεις στα άτομα Ι2, ΙΙ2 και ΙΙΙ2.

Οι αναλύσεις αυτές έδειξαν ότι ο ιχνηθετημένος ανιχνευτής 5΄CTGCTGCTGCTGCTG 3΄ υβρίδισε στο άτομο Ι2 10 φορές με το άτομο ΙΙ2 300 φορές και με το άτομο ΙΙΙ2 2000 φορές.

α) Ποια διασταύρωση του δοθέντος γενεαλογικού δέντρου αποδεικνύει τον τρόπο κληρονόμισης της ασθένειας; Ποιος είναι ο τύπος κληρονομικότητας;

(μονάδες 2)

β) Τα αποτελέσματα των μοριακών εξετάσεων σε ποιο συμπέρασμα οδηγούν για την αιτία της αυξανόμενης σοβαρότητας των συμπτωμάτων της ασθένειας από γενεά σε γενεά;

(μονάδες 3)

γ) Οι ανιχνευτές υβριδίζουν στην περιοχή της 3΄ αμετάφραστης περιοχής του υπεύθυνου για την ασθένεια γονιδίου. Ποιο από τα τρία διαφορετικά είδη κλωνοποίησης του γονιδίου αυτού μπορούν να χρησιμοποιήσουν οι επιστήμονες; Αιτιολογήστε με συντομία την απάντησή σας.

(μονάδες 3)

δ) Πώς ονομάζονται τα γονίδια που ευθύνονται για την ασθένεια στα άτομα Ι2, ΙΙ2 και ΙΙΙ2;

(μονάδα 1)

ε) Προτείνετε ένα πιθανό τύπο μετάλλαξης που μπορεί να εξηγήσει το διαφορετικό μέγεθος της 3΄ αμετάφραστης περιοχής του υπεύθυνου γονιδίου από γενεά σε γενεά εάν γνωρίζετε ότι είναι αποτέλεσμα μηχανισμού κατά τη διάρκεια του κυτταρικού κύκλου.

(μονάδα 1)

στ) Οι επιστήμονες θέλουν να ενθέσουν σε φορείς έκφρασης (πλασμίδια) τα γονίδια που ευθύνονται για την ασθένεια των ασθενών ατόμων της γενεαλογίας που σας δίνεται. Δίνεται ο περιοριστικός χάρτης του γονιδίου και δύο διαφορετικοί φορείς κλωνοποίησης. Ποια/ες περιοριστικές ενδονουκλεάσες θα χρησιμοποιήσουν οι επιστήμονες ώστε να εξασφαλίσουν των έκφραση των γονιδίων;

2017 Διαγώνισμα προσομοίωσης Β-06

2017 Διαγώνισμα προσομοίωσης Β-07

  1. Ποιος από τους δύο φορείς έκφρασης θα χρησιμοποιηθεί;
  2. Εξηγήστε για ποιο λόγο ο φυσικός Υ1 του γονιδίου της AmpR είναι ο κατάλληλος για την έκφραση του ανθρώπινου γονιδίου στο βακτήριο ξενιστή.

(μονάδες 5)

Διαγώνισμα βιολογίας θετικού προσανατολισμού στα κεφαλαία 2-4

ΖΗΤΗΜΑ 1Ο                                                                                             ΜΟΝΑΔΕΣ 25

 

Α)                                                                                                             ΜΟΝΑΔΕΣ 15

  1. Ποιο από τα παρακάτω πλασμίδια είναι κατάλληλο να χρησιμοποιηθεί ως φορέας κλωνοποίησης σε ζυμομύκητα cDNA βιβλιοθήκης του αλόγου;

2017 Διαγώνι??? 2-4-01

Υπόμνημα: όπου Υ = Υποκινητής, ΑΛΜ= Αλληλουχίες Λήξης της Μεταγραφής,

ΘΕΑ= Θέση Έναρξης της Αντιγραφής, TetR = γονίδιο ανθεκτικότητας στο αντιβιοτικό τετρακυκλινη, Killer= γονίδιο που κωδικοποιεί για μια τοξική πρωτεΐνη για τον ξενιστή, lacZ  = γονίδιο που κωδικοποιεί για την β-γαλακτοζιδαση, Polylinker= πολλές διαφορετικές μοναδικές διαδοχικές αλληλεπικαλυπτόμενες θέσεις περιορισμού. Κάθε polylinker εδώ είναι διαφορετικός από τους άλλους.

1ο πλασμιδιο: οι υποκινητές είναι οι φυσικοί υποκινητές των αναφερομένων γονίδιων.

2ο πλασμιδιο: ο πρώτος υποκινητής είναι γονίδιου της ζύμης, ο δεύτερος υποκινητής είναι ο φυσικός υποκινητής του γονίδιου lacZ.

3o  πλασμιδιο: όλοι οι υποκινητές και οι ΑΛΜ ανήκουν στη ζύμη.

4ο πλασμιδιο: οι ΑΛΜ στα δεξιά ανήκουν στο γονίδιο της ανθεκτικότητας στην τετρακυκλινη και όλοι οι υποκινητες ανήκουν στη ζυμη.

  1. Πόσα γονίδια υπάρχουν στο παρακάτω τμήμα γονιδιωματικής βιβλιοθήκης του βακτηρίου Treponema Pallidum. Ορίστε τα τμήματα που τα αποτελούν.

2017 Διαγώνι??? 2-4-02

Ο Υποκινητής δεξιά είναι ο Υ1 και βρίσκεται στην περιοχή Β του χρωμοσώματος

Τ και Ρ Συντηρημένες αλληλουχίες

 

α) Δύο γονίδια: γονίδια: (Υ1 : Γ + Δ, Υ2 : Ε + Δ + Γ + Β + Α + Ω)

β) Δύο γονίδια: γονίδια: (Υ1 : Γ + Δ, Υ2 : Η + Θ)

γ) Δύο γονίδια: γονίδια: (Υ1 : Β + Α + Ω, Υ2 : Ζ + Ε + Δ)

δ) Δύο γονίδια: γονίδια: (Υ2 : Η + Θ, Υ1 : Α + Ω)

  1. Ο ρυθμός της κυτταρικής διαφοροποίησης στο σύνολο του οργανισμού από την εμβρυική ηλικία μέχρι τα βαθιά γεράματα θα μπορούσε να αποδοθεί με το γράφημα:

2017 Διαγώνι??? 2-4-03

Σημείωση: Τα διαγράμματα δεν δίνονται υπό κλίμακα.

  1. Η αντιγραφή ενός κυκλικού μορίου DNA μπορεί να γίνεται σύμφωνα με ότι γνωρίζετε από το σχολικό βιβλίο.

2017 Διαγώνι??? 2-4-04

ε) Με όλους τους παραπάνω τρόπους.

στ) Με τους δύο πρώτους αναλόγως το είδος του κυκλικού μορίου.

  1. Δίνονται τα παρακάτω δύο γραμμικά μόρια DNA:

2017 Διαγώνι??? 2-4-05

Σημείωση: από τα αριστερά προς τα δεξιά είναι τα θραύσματα Α1, Α2, Α3 και Β1, Β2, Β3.

Τα μόρια DNA πέπτονται από δύο διαφορετικές Π.Ε την EcoRI και ένα περιοριστικό ένζυμο που αναγνωρίζει την αλληλουχία     5΄ C TTAAG

                                                                                                GAATT C

και κόβει μεταξύ του C και Τ σε κάθε κλώνο.

Εν συνεχεία τα δύο αυτά κομμένα μόρια αναμειγνύονται παρουσία του ενζύμου DNA δεσμάση. Μπορούν να δημιουργηθούν οι συνδυασμοί:

α) Α1 + Α3, Β1 + Β3, Α2 + Β2

β) Α1 + Β3, Β1 + Α3, Α2 + Β2

γ) Α1 + Β1, Α3 + Β3, Α2 + Β2

δ) Α1 + Α3, Β1 + Β3

Β) Χαρακτηρίστε ως Σ ή Λ καθεμία από τις παρακάτω προτάσεις:

ΜΟΝΑΔΕΣ 10

  1. Σε ένα βακτήριο έχει συμβεί λάθος κατά την αντιγραφή του DNA του (κυρίως μόριο), το οποίο δεν επιδιορθώθηκε στη ΘΕΑ και δεν αναγνωρίζεται από τις DNA ελικάσες, η μετάλλαξη αυτή είναι θνησιγόνος.
  2. Σε ένα ευκαρυωτικό χρωμόσωμα έγινε το ίδιο λάθος, όπως παραπάνω, σε ένα σημείο του χρωμοσώματος, είναι η μετάλλαξη αυτή θανατηφόρα;
  3. Τα ευκαρυωτικά χρωμοσώματα σε κάθε μίτωση είναι πιο κοντά από τα αντίστοιχα της προηγούμενης μίτωσης στην ίδια κυτταρική σειρά, αυτό συμβαίνει και με το βακτηριακό DNA.
  4. Στο διπλανό σχήμα για την ενίσχυση του τμήματος Α με PCR τα κατάλληλα τεχνητά ολιγονουκλεοτίδια είναι το ζευγάρι 1-3.

2017 Διαγώνι??? 2-4-06

5. Εάν ένα ευκαρυωτικό γονίδιο έχει 4 εσώνια, από το γονίδιο αυτό προκύπτουν έως 8 διαφορετικά ώριμα mRNA.

 

 

ΖΗΤΗΜΑ 2ο                                                                                             ΜΟΝΑΔΕΣ 25

1) Σε μία άσκηση ενός πανεπιστημιακού εργαστηρίου Μοριακής Βιολογίας μία ομάδα φοιτητών προσπαθεί να δημιουργήσει τη γονιδιωματική βιβλιοθήκη του βακτηρίου Lactobacillus sp.

Οι φοιτητές διαθέτουν ένα φορέα κλωνοποίησης πλασμίδιο που φέρει γονίδια ανθεκτικότητας στα αντιβιοτικά Στρεπτομυκίνη (StrR) και Αμπικιλλίνη (AmpR). Το τελευταίο φέρει και τη μοναδική θέση ανασυνδυασμού. Τα βακτήρια-ξενιστές είναι ένα κατάλληλο στέλεχος E.coli.

Στην εργασία τους οι φοιτητές έγραψαν:

«Μετά τον ανασυνδυασμό των φορέων κλωνοποίησης από τα θραύσματα του DNA του Lactobacillus sp. επακολούθησε ο μετασχηματισμός των βακτηρίων-ξενιστών. Μετά τον μετασχηματισμό, υπήρχαν 3 κατηγορίες βακτηρίων E.coli.

α) Τα μη μετασχηματισμένα που δεν φέρουν ανθεκτικότητα ούτε σε Str, ούτε σε Amp.

β) Τα μετασχηματισμένα

  1. Με το μη ανασυνδυασμένο φορέα κλωνοποίησης που έχουν ανθεκτικότητα και στα δύο αντιβιοτικά.
  2. Με τον ανασυνδυασμένο φορέα κλωνοποίησης που φέρουν ανθεκτικότητα μόνο στο αντιβιοτικό Str.

Ο διαχωρισμός των βακτηρίων που αποτελούν τη βιβλιοθήκη από τα υπόλοιπα κύτταρα E.coli θα γίνει ως εξής:

Τα ζητούμενα βακτήρια  E.coli είναι τα μετασχηματισμένα με το ανασυνδυασμένο πλασμίδιο.

Στην την υγρή βακτηριακή καλλιέργεια των ξενιστών που χρησιμοποιήθηκαν για το μετασχηματισμό τους, υπήρχε το αντιβιοτικό Str, οπότε τα μόνα βακτήρια που επέζησαν ήταν τα μετασχηματισμένα. Από αυτή την υγρή καλλιέργεια επιλέγουμε κάποια βακτήρια και τα καλλιεργούμε μεμονωμένα σε υγρό θρεπτικό υλικό. Στη συνέχεια χωρίζουμε τους απογόνους σε δύο ίσα μέρη και σε κάποια βακτήρια από τα δύο αυτά μέρη χορηγούμε αμπικιλλίνη. Αν πεθάνουν κάποια, συμπεραίνουμε ότι προέρχονται από την ομάδα που μας ενδιαφέρει, δηλαδή τα μετασχηματισμένα με το ανασυνδυασμένο πλασμίδιο.»

Εξηγήστε γιατί οι φοιτητές μηδενίστηκαν από τον υπεύθυνο του εργαστηρίου.

μονάδες 5

2) Εργάζεστε σε μία φαρμακευτική βιομηχανία και ενδιαφέρεστε να δημιουργήσετε  το εμβόλιο κατά ενός νέου ιού. Ξεκινάτε ψάχνοντας στο γονιδίωμα του ιού, ώστε να βρείτε τα/το γονίδιο που κωδικοποιεί για μία κατάλληλη πρωτεΐνη αντιγονικό καθοριστή του ιού.

Εξηγήστε το είδος της βιβλιοθήκης του ιικού DNA που θα δημιουργήσετε, γονιδιωματική ή cDNA;

3) Δίνεται το παρακάτω μόριο RNA προϊόν της μεταγραφής ενός βακτηρίου. Το μόριο αυτό είναι λειτουργικό.

2017 Διαγώνι??? 2-4-07

α) Τι είδους γονίδιο το κωδικοποιεί αυτό το μόριο RNA; (3)

β) Γράψτε το τμήμα του γονιδίου που το κωδικοποιεί και αφορά την περιοχή 3. Προσδιορίστε την κωδική αλυσίδα του γονιδίου και τον προσανατολισμό των κλώνων του. (4)

γ) Τι είδους δεσμοί σταθεροποιούν αυτή τη δομή του μορίου RNA εντός της περιοχής 2; Ποιο ένζυμο καταλύει τη δημιουργία αυτών των δεσμών; (2)

δ) Στην περιοχή 1 δίνεται ένα τμήμα της αλληλουχίας της. Μπορούμε να υπολογίσουμε τα % των βάσεων %Α, %U, %C και %G στην απέναντι πλευρά της περιοχής 1 από αυτήν που δίνεται η ακολουθία; (3)

ε) Απαντήστε στο ίδιο ερώτημα αν η ακολουθία αυτή της περιοχής 1 ήταν εντός της περιοχής 2. (3)

ΖΗΤΗΜΑ 3Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α) Παρακάτω δίνονται τα τμήματα δύο διαφορετικών γονιδίων. Το γονίδιο 1 κωδικοποιεί για μία πρωτεΐνη που εκφράζεται πάντα σε υψηλό ρυθμό. Το γονίδιο 2 εκφράζεται μόνο σε ένα κατάλληλο αναπτυξιακό στάδιο του οργανισμού.

Συνέβη αναδιάταξη γονιδίων και το τμήμα του γονιδίου 2 που δίνεται τοποθετήθηκε κοντά στον υποκινητή του γονιδίου 1. Δημιουργήθηκαν 4 διαφορετικές αναδιατάξεις. Εξηγήστε σε ποια από όλες εκφράστηκε το τμήμα του γονιδίου ② και για ποιο λόγο δεν εκφράστηκε σωστά ή καθόλου στις άλλες πιθανές αναδιατάξεις.

Σημείωση: Η αλληλουχία που δίνεται Italics και υπογραμμισμένη αποτελεί τον υποκινητή. Τα νούμερα δηλώνουν το πλήθος των νουκλεοτιδίων.  Στο γονίδιο ② η υπογράμμιση δηλώνει το πλαίσιο ανάγνωσης του γονιδίου. Στο γονίδιο ① τα bold ζεύγη βάσεων δηλώνουν τις 4 πιθανές θέσεις αναδιάταξης του γονιδίου ②. Το τμήμα του γονιδίου ② τοποθετείται κάθε φορά αμέσως μετά τη θέση 83, 136, 155, 183 του γονιδίου ①.

gene

Β) Το φυσιολογικό γονίδιο ① αντιγράφεται. Από τη θέση 80 έως τη θέση 140 υπάρχει θέση έναρξης της αντιγραφής.

Δίνονται τα παρακάτω πρωταρχικά τμήματα:

  1. 5΄ AGAGAGAAGA 3΄
  2. 5΄ CUCCCCCGCG 3΄
  3. 5΄ GAUAUAAUCU 3΄
  4. 5΄ CCAUACAUAG 3΄

τα οποία είναι τα πρώτα πρωταρχικά τμήματα που τοποθετούνται από τα πριμοσώματα. Γνωρίζετε ότι το πριμόσωμα τοποθετεί πρωταρχικό τμήμα 10 νουκλεοτιδίων κάθε 30 νουκλεοτίδια από το 5΄ άκρο του ακριβώς προηγούμενου πρωταρχικού τμήματος.

  • Να βρεθούν τα δύο επόμενα πρωταρχικά τμήματα που θα τοποθετήσουν τα πριμοσώματα. (10)
  • Σε ποιο κλώνο, στον πάνω ή στον κάτω, κινείται η DNA πολυμεράση χρησιμοποιώντας τον ως καλούπι που τοποθέτησε το 29ο νουκλεοτίδιο στον κλώνο που συντίθεται ασυνεχώς και το νουκλεοτίδιο αυτό ήταν η Τ. (3)

ΖΗΤΗΜΑ 4Ο

 Σε δύο διαφορετικά βακτηριακά στελέχη E.coli μελετήθηκε η κινητική της παραγωγής της β-γαλακτοσιδάσης, παρουσία και απουσία λακτόζης. Όταν δεν υπήρχε λακτόζη, τα βακτήρια αναπτύσσονταν σε γαλακτόζη.

2017 Διαγώνι??? 2-4-08

Για την ερμηνεία της καμπύλης ① δημιουργήθηκαν οι γονιδιωματικές βιβλιοθήκες των δύο στελεχών. Σε κάθε περίπτωση χρησιμοποιήθηκαν οι ίδιες περιοριστικές ενδονουκλεάσες και για τα δύο στελέχη. Η χρήση αυτών των Π.Ε. επιτρέπει την κοπή του γονιδιώματος του E.coli με τέτοιο τρόπο ώστε να δημιουργείται θραύσμα με ακέραιο το τμήμα που περιλαμβάνει από τον υποκινητή του ρυθμιστικού γονιδίου μέχρι και τις αλληλουχίες λήξης της μεταγραφής των δομικών γονιδίων.

Από τη σύγκριση των αλληλουχιών των οπερονίων των δύο στελεχών δεν παρατηρήθηκε καμία διαφορά μεταξύ τους.

Η σύγκριση έγινε με πέψη με ορισμένο πλήθος και είδος περιοριστικών ενδονουκλεάσεων που πέπτουν εντός του απομονωμένου τμήματος.

Σημειωση:το παρακάτω σχήμα δεν αφορά το PCR.

2017 Διαγώνι??? 2-4-10

Τα παραπάνω αποτελέσματα ηλεκτροφορισης αφορουν τη γονιδιωματική βιβλιοθήκη  για τους κλώνους που περιέχουν το οπερόνιο στις  βιβλιοθήκες Α και Β.

Κάθε  μια από τις πέψεις i, ii, iii  έγινε με διαφορετικό σύνολο περιοριστικών ενζύμων.

Ακολούθησε PCR μέθοδος στα γονιδιώματα των στελεχών:

  1. PCR για την ενίσχυση του γονιδίου της β-γαλακτοσιδάσης.
  2. PCR για την ενίσχυση του χειριστή.
  3. PCR για την ενίσχυση του ρυθμιστικού γονιδίου.

Κατόπιν επακολούθησε πέψη των προϊόντων της PCR για τη σύγκριση των αλληλουχιών αυτών των δύο στελεχών.

Ακόμη είχε γίνει υβριδοποίηση των γονιδιωματικών βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των αποικιών των παραπάνω περιοχών του οπερονίου.

Τα αποτελέσματα του PCR είναι: Για την ενίσχυση των περιοχών DNA:

2017 Διαγώνι??? 2-4-11

iii

2017 Διαγώνι??? 2-4-09

Ακόμη είχε γίνει υβριδοποίηση των γονιδιωματικών βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των αποικιών των παραπάνω περιοχών του οπερονίου.

Τα αποτελέσματα της υβριδοποίησης είναι:

table

 

Σύμφωνα με την παραπάνω πειραματική διαδικασία, απαντήστε:

α) Για ποιο λόγο οι επιστήμονες δημιούργησαν γονιδιωματικές και όχι cDNA βιβλιοθήκες των δύο στελεχών;

β) Για ποιο λόγο δημιούργησαν τις δύο διαφορετικές βιβλιοθήκες χρησιμοποιώντας τα ίδια ένζυμα;

γ) Για ποιο λόγο συνέκριναν τις αλληλουχίες των δύο οπερονίων των δύο στελεχών; Πώς γίνεται η σύγκριση με την πέψη;

δ) Για ποιο λόγο έγινε PCR των συγκεκριμένων περιοχών του γονιδιώματος που ανήκουν στο οπερόνιο των δύο στελεχών από ολόκληρο το γονιδίωμα;

ε) Για ποιο λόγο συνέκριναν ως προς την αλληλουχία τα προϊόντα του PCR, που έγινε για στοχευμένα τμήματα του οπερονίου, αφού είχαν συγκρίνει ήδη αυτές τις περιοχές εντός των βιβλιοθηκών;

στ) Για ποιο λόγο μετά το πρώτο PCR έγινε υβριδοποίηση των βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των συγκεκριμένων αλληλουχιών;

ζ) Ερμηνεύστε για ποιο λόγο το στέλεχος B    εμφανίζει αυτή τη συμπεριφορά παρουσία γαλακτόζης.

Διαγώνισμα Βιολογίας θετικής Κατευθύνσης κεφαλαίου 4 – Τεχνολογία ανασυνδυασμένου DNA

Ζήτημα 1.                                                                                                                           Μονάδες 25

  1. Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BamHI είναι:

5′ G|GATCC 3′

3′ CCTAG|G 5′

Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BclI είναι:

 5′ T|GATCA 3′

 3′ ACTAG|T 5′

Ένα γραμμικό μόριο DNA διαθέτει μοναδική θέση αναγνώρισης BamHI και ένα άλλο μόριο επίσης γραμμικό, με την ίδια κατά τα άλλα, ακριβώς αλληλουχία διαθέτει μοναδική θέση BclI, στη θέση της BamHI. Τα δυο μόρια πέπτονται ανεξάρτητα το ένα από το άλλο με την κατάλληλη περιοριστική ενδονουκλεάση το καθένα. Τα προϊόντα της πέψης αναμιγνύονται και προστίθεται το ένζυμο DNA δεσμάση. Στο τελικό μείγμα προστίθονται και οι δυο περιοριστικές ενδονουκλεάσες BamHI και BclI.

 Δημιουργούνται:

α. 4 διαφορετικά μόρια DNA

β. 2 διαφορετικά μόρια DNA

γ.1 μόριο DNA

δ. 2 όμοια μόρια DNA

 2. Στο παραπάνω μείγμα:

α. δρουν και οι δυο περιοριστικές ενδονουκλεάσες πάντα

β. δρα μόνο η μια από τις δυο περιοριστικές ενδονουκλεάσες πάντα

γ. μπορεί να δράσει ή η μια ή άλλη περιοριστική ενδονουκλεάση

δ. μπορεί να μην δράσει καμιά από τις δυο περιοριστικές ενδονουκλεάσες.

 3. Ποια από τις παρακάτω αλληλουχίες αποτελεί πιθανή θέση αναγνώρισης κάποιας περιοριστικής ενδονουκλεάσης; (α.,β.,γ. : δίνονται δίκλωνες αλληλουχίες)

α. 5’A|CTGC3′

3’TGAC|G5′

β. 5′ T|TTAAA3′

3’AAATT|T5′

γ. 5′ G|GATCA3′

3′ CCTAG|T5′

δ. 5’G|AATTC3′

 4. Μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη:

α. Για το γονίδιο της EcoRI, β. Για το γονίδιο του tRNA της Aργινίνης των λευκοκυττάρων μας

γ. Για το οπερόνιο της λακτόζης, δ. Για το γονίδιο της αντίστροφης μεταγραφάσης του HIV.

 5. Ένας φορέας κλωνοποίησης διαθέτει εκτός από το γονίδιο ανθεκτικότητας στην καναμυκίνη (αντιβιοτικό) και το γονίδιο LeuI που κωδικοποιεί το ένζυμο το οποίο απαιτείται για την σύνθεση του αμινοξέα Λεύκινη και μπορεί να χρησιμοποιηθεί ως γονίδιο για την επιλογή των μετασχηματισμένων ξενιστών με το ανασυνδυασμένο πλασμίδιο.

Ποιο γονότυπο και ποιο φαινότυπο πρέπει να εμφανίζουν τα επιθυμητά κύτταρα ξενιστές;

α. Πριν το μετασχηματισμό ήταν LeuI- και μετά τον μετασχηματισμό αυξάνονται σε περιβάλλον δίχως Λεύκινη.

β. Πριν το μετασχηματισμό ήταν LeuI+ και μετά το μετασχηματισμό δεν αυξάνεται σε περιβάλλον δίχως Λεύκινη

γ. Μετά το μετασχηματισμό ήταν LeuI- και αυξάνεται σε περιβάλλον δίχως Λεύκινη

δ. Μετά το μετασχηματισμό ήταν LeuI+ και δεν αυξάνεται σε περιβάλλον δίχως Λευκινη

 Ζήτημα 2                                                                                                                          Μονάδες 25

  1. Διαθέτετε το γονίδιο Ψ2 και θέλετε να το ενθέσετε εντός του φορέα κλωνοποίησης Β2 οποίος διαθέτει τις εξής θέσεις περιορισμού (οι αλληλουχίες είναι δίκλωνες αλλά δίνονται μόνο ο ένας από τους δυο κλώνους).

StuI : 5′ AGG|CCT3′                                                                                            SalI: 5΄G|TCGAC3′

Ψ2:5′ TCCGGCGGAATTCCAAGGCCT[ΑΤG…κωδική περιοχή]CGTCGACTCCGGC 3′

       3′ AGGCCGCCTTAAGGTTCCGGA[TAC…κωδική περιοχή]GCAGCTGAGGCCG 5′

 Τμήμα του Β2 _________Διεύθυνσης μεταγραφής_>____StuI_____SalI____EcoRI__________͢

α. Υπάρχουν δυο διαφορετικοί τρόποι ένθεσης του γονιδίου Ψ2 (κωδική περιοχή του) στο πλασμίδιο Β2. Ποιοι είναι αυτοί (4); Ποιο/α περιοριστικό/α ένζυμο/α θα χρησιμοποιήσετε  για να πεψετε το πλασμίδιο και το γονίδιο ώστε να απομονώσετε μόνο την κωδική περιοχή του γονιδίου(2);

β. Ποιος από τους δυο αυτούς τρόπους είναι ο κατάλληλος για να είναι δυνατή η έκφραση του γονιδίου Ψ2 στο κύτταρο ξενιστή (μονάδες 2); Αιτιολογήστε την απάντηση σας (7).

2. Εξηγήστε πως θα μπορούσαμε να παράξουμε την αιμοσφαιρίνη Α, που αποτελείται από 2 α και 2 β πολυπεπτιδικές αλυσίδες, από βακτήρια με την τεχνολογία της cDNA βιβλιοθήκης (10).

 

 Ζήτημα 3                                                                                                                         Μονάδες 25

  1. Δίνεται το παρακάτω υποθετικό γονίδιο του λ φάγου που κωδικοποιεί για ένα ολιγοπεπτιδιο. Το γονίδιο αυτό θέλουμε να το κλωνοποιησουμε με σκοπό την παραγωγή του ολιγοπεπτιδίου που κωδικοποιεί σε ζυμομύκητα.

Υ ATTG…CGGAATTCAAATGCCCCAGTTCATGTΑGAATTCTAAGCGC…ATGCAGTAG…AAA     

 Y TAAC…GCCTTAAGTTTACGGGGTCAAGTACATCTTAAGATTCGCG…TACGTCATC…TTT

Για την κλωνοποιήση του συγκεκριμένου γονίδιου θα επιλέξετε μεταξύ των παρακάτω φορέων κλωνοποιήσης.

2017 inmid-01

 

Σημείωση: Η θέση περιορισμού  μπορεί να βρίσκεται ακριβώς δίπλα στον υποκινητή τόσο του ενός όσο και του άλλου πλασμίδιου, όμως σε κάθε περίπτωση πρεπει να λειτουργεί ως θέση αναγνώρισης της EcoRI.

Στο πλασμίδιο 1, ο εσωτερικός μητρικός κλώνος όταν αντιγράφεται στη διχάλα που εξελίσσεται προς τα αριστερά, ο νεοσυντιθέμενος συμπληρωματικός κλώνος του, συντίθεται συνεχώς.

Στο πλασμίδιο 2, ο αντίστοιχος μητρικός κλώνος, στη διχάλα που εξελίσσεται προς τα δεξιά, ο νεοσυντιθέμενος συμπληρωματικός κλώνος του συντίθεται συνεχώς.

Α. Ποια είναι κωδική και ποια μη κωδική αλυσίδα του γονιδίου του λ-φάγου (6);

Β. Ποιο ολιγοπεπτίδιο κωδικοποιεί αυτό το γονίδιο (4);

Γ. Ποιο από τα πλασμιδια θα χρησιμοποιήσετε για την κλωνοποιήση του γονιδίου (1) και αιτιολογήστε την απάντηση σας (6).

Δ. Μετά την επιτυχή έκφραση του γονιδίου στα κύτταρα ξενιστές απομονώθηκαν δυο διαφορετικά ολιγοπεπτίδια που παράγονται από τα μετασχηματισμένα κύτταρα ζυμών με τα ανασυνδυασμενα πλασμιδια. Τα δυο αυτά ολιγοπεπτιδια παράγονται από διαφορετικά μετασχηματισμένα μυκητιακα κύτταρα. Δηλαδή το ίδιο κύτταρο δεν παράγει και τα δυο ολιγοπεπτιδια. Και τα δυο είναι προϊόντα έκφρασης του ετερολογου γονιδίου που ανασυνδυάστηκε με τον φορέα κλωνοποιήσης.

Εξηγήστε το φαινόμενο (5).

Ε. Είναι δυνατόν το κύτταρο ζύμης ξενιστής να παράγει το λειτουργικό ολιγοπεπιδιο του λ-φαγου δεδομένου ότι ο λ-φαγος προσβάλει βακτηρία (3);

 

Ζήτημα 4                                                                                                                          Μοναδες 25

Δίνεται η παρακάτω αλληλουχία του γονιδίου Φ1 (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) που κωδικοποιεί για το ένζυμο του βακτηρίου Lactobacillus arabinosus που σχηματίζει την βιταμίνη Β9 (φολικό οξύ).

Από την γονιδιωματική βιβλιοθήκη του βακτηρίου απομονώθηκε το γονίδιο Φ1 με στόχο την εισαγωγή του σε κατάλληλο φορέα κλωνοποίησης που θα μετασχηματίσει κύτταρα ζυμών αρτοποιίας ώστε να εμπλουτίζεται το ψωμί με φολικό οξύ.

Στο δοθέν γονίδιο δεν περιλαμβάνεται η αλληλουχία του υποκινητή του. Υποδεικνύονται τα κωδικόνια έναρξης και λήξης του Φ1 και εντός των 1500 ζ. β. που παρεμβάλλονται μεταξύ των κωδικονίων έναρξης και λήξης δεν υπάρχουν θέσεις αναγνώρισης των περιοριστικών ενζύμων: XbaI (5′TCTAGA3′ ), SacI (5′GAGCTC3′ ), BamHI (5′GGATCC3′), BglI(5′AGATCT3′), NdeI(.5′CATATG 3′ )

5′ GTCTAGAAGAGCTCCTTGGATCCAAAGATCTACCATATGTCTCGCCTA   1500 συνέχεια του γονιδιου

5’GTCTAGAAGAGCTCTGGATCCAAGATCTACCATATGTAAGCG3′

Δίνεται επίσης ο φορέας κλωνοποίησης που θα χρησιμοποιηθεί για την κλωνοποίηση του γονιδίου Φ1 στη ζύμη αρτοποιίας. Δίνεται ακόμη η αλληλουχία του φορέα κλωνοποίησης (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) από τη θέση BglI μέχρι τη θέση SacI, όπου περιλαμβάνεται και ο υποκινητής που θα είναι υπεύθυνος για τη μεταγραφή του γονιδίου Φ1.

Τμήμα του φορέα κλωνοποίησης:

__________Διεύθυνση μεταγραφής>___XbaI__NdeI___BamHI___SacI_____________________

 

Υποκινητής

———————->

5′AGATCTCGATCCCCCGAAATTAATACGACTCACTATACGGGAATTGTCACCGCATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATCGAGCTCCGTCGAC3′

NH2-MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluSerSerSerValAsp-COOH

Σημείωση: Τα έντονα γράμματα αποτελούν τον υποκινητή του γονιδίου στον πλασμιδιακό φορέα κλωνοποίησης και το κωδικόνιο έναρξης αυτού του γονιδίου αναφοράς στον φορέα κλωνοποίησης, είναι μέσα στη θέση αναγνώρισης της NdeI.

α. Για την έκφραση του γονιδίου Φ1 στη ζύμη, ποιες πρωτεΐνες και από ποιον οργανισμό θα πρέπει να συνδεθούν με τον υποκινητή του φορέα κλωνοποίησης που θα χρησιμοποιηθεί;

Μονάδες 8

β. Αν υποθέσουμε ότι τα επιπλέον αμινοξέα στο αμινοτελικό άκρο της πρωτεΐνης που κωδικοποιείται από το Φ1 γονίδιο δεν επηρεάζουν την λειτουργικότητα της απαντήστε στις παρακάτω ερωτήσεις:

  1. I) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με πέψη με BamHI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματίστικε με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

ΙΙ) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με με πέψη με το ένζυμο SacI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματίστικε με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

Μονάδες  4Χ4=16

 

 

 

 

Επαναληπτικό Διαγώνισμα Βιολογίας Θετικού Προσανατολισμού κεφαλαίων 1,2,4 &7

Ζήτημα 1.

Α. Επιλέξτε την ορθή απάντηση:

  1. κατά την μεταγραφη των γονιδιων του οπερονιου της λακτοζης δημιουργουνται…………………. mRNA

Α. 1, β. 2, γ. 3, δ.4                                                                     (5 μονάδες)

  1. Από τα ………διαφορετικα κωδικονια , …………κωδικοποιουν αμινοξεα και ………οδηγουν στον τερματισμο της πρωτεινοσυνθεσης.

Α. 180, 20, 4 β. 20, 17, 3 γ. 20, 17, 4, δ. 64, 61, 3                                     (5 μοναδες)

  1. Ερωτήσεις Σωστού – Λάθους:

Α. Για να κατασκευστει μια cDNA βιβλιοθηκη απομονωνεται το ολικο mRNA από κυτταρα που εκφραζουν το γονιδιο που θελουμε να μελετησουμε.

Β. Η μεταβολή του πληθυσμού σε συνάρτηση με τον χρόνο μιας συνεχούς καλλιέργειας φυσιολογικών κυττάρων E.coli, που τροφοδοτείται με θρεπτικο υλικό το οποιο, περιέχει ως πηγη C γλυκόζη και λακτόζη σε ίσες αναλογίες, εμφανίζει καμπύλη διαύξησης.

Γ. Στην αντιγραφή του βακτηριακου DNA συμμετέχουν δυο DNA πολυμερασες.

Δ. Ένα φυσιολογικο ανθρωπινο σωματικο κυτταρο εχει στον πυρηνα του 24* 10^9 βασεις κατά την μεταφαση της μιτωσης του.

Ε. Κατά την πεψη ενός κυκλικου μοριου DNA από την EcoRI, ανά θεση περιορισμού, σπαζουν περισσοτεροι φωσφοδιεστερικοί δεσμοι, από ότι ενός γραμμικου μοριου DNA, με τον ίδιο αριθμό θραυσμάτων.

Δινεται ότι το κάθε μοριο διαθετει 4 θεσεις αναγνωρισης της EcoRI.                (15 μοναδες)

Ζητημα 2

Α. Γιατι τα κυτταρα ενός πολυκυτταρου οργανισμου, παροτι εχουν όλα τα ιδια γονιδια  διαφερουν στην μορφη και την λειτουργια τους; (5 μοναδες)

Β. Ένα διπλοειδες κυτταρο υφισταται μιτωση και στη συνεχεια  τα θυγατρικα κυτταρα υφιστανται μειωση.

Σχεδιαστε ένα κοινό διαγραμμα, οπου θα φαινονται οι μεταβολες της ποσοτητας του γενετικου υλικου του ενός κυτταρου, σε σχεση με το χρονο.

Αιτιολογηστε την απαντηση σας.

Δινεται ότι το γενετικο υλικο του πυρηνα του κυτταρου, κατά την μεταφαση της μιτωσης του, εχει μηκος 4* 10 8 ζευγη βασεων. (10 μοναδες)

Γ. Στο παρακατω σχημα φαινεται η διχαλα αντιγραφης ενός πλασμιδιου. Αφου μεταφερετε το σχημα στο τετραδιο σας, συμπληρωστε τον προσανατολισμο των αλυσιδων στα ακρα της διχαλας, καθως και τον προσανατολισμο της αντιγραφης σε κάθε αλυσιδα. Τελος, να χαρακτηρισετε τον τροπο συνθεσης των νεων αλυσιδων του DNA.

2017 Επαναλληπτικό 1 2 4 7-01

Αιτιολογηστε συντομα την απαντηση σας.  (2+2+2+4 = 10 μοναδες)

Ζητημα 3

Μια συνεχης καλλιεργεια βακτηριων E. coli, περιέχει εξ’αρχης, δυο διαφορετικά στελεχη βακτηριων. Τα βακτηρια που ανηκουν στο ένα στέλεχος, διαθετουν ένα πλασμίδιο, το οποιο περιέχει, ένα γονιδιο ανθεκτηκοτητας στο αντιβιοτικο καναμυκινη.

Τα βακτηρια που ανηκουν στο άλλο στέλεχος, διαθετουν ένα διαφορετικό πλασμιδιο, που φερει ένα διαφορετικο γονιδιο ανθεκτικοτητας στην καναμυκινη (το οποιο κωδικοποιει την ιδια πρωτεινη, με το γονιδιο ανθεκτικοτητας του πρωτου πλασμιδιου), καθώς και ένα γονιδιο ανθεκτικοτητας στην πενικιλινη.

Τα βακτηρια  της καλλιεργειας αναπτυσονται σε ζυμωτηρα, στον οποιο προσθετουμε την χρονικη στιγμη t1 χ ποσοτητα καναμυκινης, την στιγμη t2 y/2 ποσοτητα πενικιλινης και την στιγμη t3 y ποσοτητα πενικιλινης.

Το ακόλουθο διαγραμμα, δειχνει τις μεταβολες στον πληθυσμο των μικροοργανισμων σε σχεση με τον χρονο.

2017 Επαναλληπτικό 1 2 4 7-02

Α. Να εξηγησετε γιατι, παροτι και τα δυο στελεχη διαθετουν ένα γονιδιο ανθεκτικοτητας στην καναμυκινη, μετα την προσθηκη του αντιβιοτικου στο θρεπτικο υλικο την χρονικη στιγμη t1, παρουσιαζεται μερικη μειωση του πληθυσμου των βακτηριων. Ποιο στέλεχος διαθέτει μεγαλύτερη ανθεκτικότητα στην Καναμυκινη1; (4+1 μοναδες)

Β. Να χαρακτηρισετε κάθε φαση της καλλιέργειας, όπως εμφανιζεται στο διαγραμμα και να αιτιολογησετε την απαντηση σας. (5 μοναδες)

Γ. Να εξηγησετε γιατι τα βακτηρια της καλλιεργειας «αντιδρούν», διαφορετικα αναμεσα στις δυο περιπτωσεις προσθηκης πενικιλινης.(5 μοναδες)

Δ. Σε μια νεα δημιουργια της καλλιεργειας, προσθετουμε μικροτερες ποσοτητες καναμυκινης και πενικιλινης σε σχεση με τις αρχικες. Πιστεύετε, ότι αυτό θα επηρεασει τον ρυθμο αναπτυξης των βακτηριων της καλλιεργειας; Να αιτιολογησετε την απαντηση σας. Σχεδιαστε το νέο πιθανο διαγραμμα του ρυθμου αναπτυξης των βακτηριων, συμφωνα με την απαντηση σας.

Υποθεστε ότι οι προσθηκες των αντιβιοτικων εγιναν στις ιδιες αντιστοιχες στιγμες όπως φαινονται στο διαγραμμα που σας δοθηκε. (2+3+5=10)

Ζητημα 4

Τρια δειγματα πλασμιδιακου DNA, πεπτονται με διάφορες περιοριστικες ενδονουκλεασες και στη συνεχεια αναλυονται σε πηκτωμα αγαροζης. Τα αποτελεσματα είναι αυτά που φαινονται στις εικονες. Γνωριζετε ότι κανενα πλασμιδιο δεν εχει δυο ιδιες θεσεις αναγνωρισης. Επίσης, είναι γνωστό, ότι το πλασμιδιο 1  εχει μηκος 20.000 ζευγη βασεων, το πλασμιδιο 2 εχει μηκος 15.000 ζευγη βασεων  και το πλασμιδιο 3 εχει μηκος 10.000 ζευγη βασεων.

2017 Επαναλληπτικό 1 2 4 7-03

2017 Επαναλληπτικό 1 2 4 7-04

Σημείωση: Στο τρίτο πήκτωμα αγαροζης, με την σειρά  που δίνονται, στο πρώτο πλασμίδιο, η ζώνη στα 10.000 ζεύγη νουκλεοτιδιων, είναι διπλάσια σε πάχος από όλες τις  υπόλοιπες των τεσσάρων πηκτωματων αγαροζης.

Α. Σχεδιαστε τον περιοριστικο χαρτη καθε πλασμιδιου (για το πλασμιδιο 1 αρκει μια εκδοχη). Δεν απαιτηται αιτιολογηση. (6 μοναδες).

Β. Δινεται η αλληλουχια ενός  υποθετικου γονιδιου του πλασμιδιου 2, που κωδικοποιει τη συνθεση μιας πρωτεινης.

Αλυσιδα1. …TCGACGGGTACGCTATGCGCCGTTTTGTAAAAACGAGGACTTTG…

Αλυσιδα 2….ΑGCTGCCCATGCGATACGCGGCAAAACATTTTTGCTCCTGAAAC…

Η υπογραμμιση δηλωνει την 5΄αμεταφραστη περιοχη .

  1. ποια αλυσιδα είναι η κωδικη και ποια η μη κωδικη και σημειωστε τα 5΄και 3΄ακρα της κάθε αλυσιδας. Αιτιολογηστε την απαντηση σας. (μονάδες 2 + 4).
  2. Ο υποκινητης του παραπανω γονιδιου αποτελειται από 120 βασεις. Από αυτές, το 15% είναι αδενινες. Να βρειτε τα ποσοστα και τους αριθμους των υπολοιπων. (μοναδες 3).

Γ. Δινεται το ακόλουθο γονιδιο, το οποιο κωδικοποιει τη συνθεση μιας πρωτεινης του ανθρωπου:

5’ AGCGAATTCGCTCTGCAG…GGATCC…GCTAT…ATG…GAATTC…TAGCTGCAG…GGATCC3’

3’ TCGCTTAAGCGAGACGTC…CCTAGG…CGATA…TAC…CTTAAG…ATCGACGTC…CCTAGG5’

3’ ΑΜΕΤΑΦΡΑΣΤΗ ΑΛΜ

Οπου ΑΛΜ= Αλληλουχιες ληξης της Μεταγραφης. Οι ΑΛΜ βρισκονται στις αλληλουχίες που ακολουθουν αμεσως μετα την 3′ αμεταφραστη περιοχη του δοθεντος γονιδιου. Η αλληλουχία του υποκινητή, είναι η υπογραμμισμένη στα αριστερά αλληλουχία του γονιδίου που δίνεται.

Να προσδιορισετε ποια/ποιες περιοριστικη/ες ενδονουκλεαση/ες μπορει/ουν να χρησιμοποιηθει/ουν για την πεψη του γονιδιου, ώστε στη συνεχεια να ενθεθει ακεραιο σε καποιο από τα πλασμιδια του προηγούμενου ερωτήματος και να μπορει να εκφραζεται επιτυχως. Να αιτιολογηθει η απαντηση σας.

Δ. Να προσδιορισετε ποιο/α πλασμιδιο/α θα μπορουσε/αν να χρησιμοποιηθει/ουν ως φορεας/εις κλωνοποιησης για το γονιδιο του προηγουμενου ερωτηματος, με βαση την απαντηση σας στο προηγουμενο ερωτημα. Να εξηγησετε επισης ποιες άλλες προυποθεσεις θα πρεπει να πληροι/ουν αυτό/α το/τα πλασμιδιο/α ώστε να μπορει να χρησιμοποιηθει επιτυχως ως φορεας κλωνοποιησης.

(μοναδες 2+4=6)

Δίνονται:

Θέση αναγνώρισης της PstI……………… Θέση αναγνώρισης της BamHI

5’ CTGCAG3’…………………………………………………………5’GGATCC3’

3’ GACGTC5’ …………………………………………………………3’CCTAGG5’

 

Δημιουργημένο απο την α’ φοιτήτρια της Ιατρικής Κωνσταντίνα Ραουζαίου