Αρχείο συντάκτη gkarakats

Διαγώνισμα κεφαλαίου 2. Το δόγμα της μοριακής βιολογίας και η ρύθμιση της γονιδιακής έκφρασης.

ΚΕΦ 2ο
σημείωση: στο ερώτημα V του 4 θέματος η ερώτηση: πόσα διαφορετικά μόρια λακτόζης απαιτούνται για την παραγωγή μορίων καταστολέα, αντικαθίσταται από την ερώτηση: πόσα διαφορετικά μόρια mRNA απαιτούνται για την παραγωγή μορίων καταστολέα;

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ 2018

 

ΖΗΤΗΜΑ 1Ο

A.

1) Η φαινοτυπική αναλογία της F2 γενεάς της διασταύρωσης Ρ: ΑΑΒΒΓΓ x ααββγγ στο πρότυπο διασταυρώσεων κατά Μέντελ είναι το ανάπτυγμα όπου αντί για + έχει :

α) (3+1)3

β) (9+1)2

γ) (3+3)2

δ) Τίποτα από τα παραπάνω

2) Ένα υβρίδωμα:

α) είναι τετραπλοείδες για το γονιδίωμα του ποντικου

β) είναι διπλοειδές για το γονιδίωμα του ποντικού

γ) είναι ένα ετεροκαρυο που φέρει τόσο το διπλοειδές γονιδίωμα του ποντικου όσο και το διπλοειδες γονιδιωμα του ανθρώπου

δ) φέρει το γονιδίωμα του ποντικού και το γονιδίωμα του μυελώματος και τα ανθρώπινα γονίδια για την παραγωγή των μονοκλωνικών αντισωμάτων.

3) Τα νουκλεϊκά οξέα είναι αποκλειστικά δομημένα από:

 α) μέταλλα

β) αμέταλλα

γ) μέταλλα και αμέταλλα

δ) είναι μονομερή των κυττάρων

4) Οι δεσμοί υδρογόνου (δ.Η) και οι φωσφοδιεστερικοί δεσμοί (Ρ-δ) απαντώνται στα δίκλωνα μόρια νουκλεϊκών οξέων.

α) Οι δ.Η είναι ασθενείς και δημιουργούνται αυθορμήτως μεταξύ των δύο πολυνουκλεοτιδικών αλυσίδων.

β) Οι Ρ-δ είναι ομοιοπολικοί ισχυροί δεσμοί που δημιουργούνται in vivo κατά τη φάση S και συγκρατούν τα νουκλεοτίδια  σε ένα πολυνουκλεοτιδικό κλώνο.

γ) Οι δ.Η σταθεροποιούν τη δομή της διπλής έλικας. Οι Ρ-δ απαιτούν κατανάλωση ενέργειας για να δημιουργηθούν.

δ) Όλα τα παραπάνω είναι ορθά.

ε) Τίποτα από τα παραπάνω δεν ισχύει.

5) Στα ευκαρυωτικά κύτταρα και στα προκαρυωτικά κύτταρα ισχύει:

γονίδια / γονιδίωμα = ε για ευκαρυωτικά, γονίδια / γονιδίωμα  = π για προκαρυωτικά

Ισχύει γενικά:

α) ε > π

β) π > ε

γ) π = ε

δ) Τίποτα από τα παραπάνω δεν είναι σωστό.

Β. Χαρακτηρίστε ως Σ (Σωστή) ή Λ (Λανθασμένη) την καθεμία από τις παρακάτω προτάσεις.

 1) Το νουκλεόσωμα αποτελείται από 146 ζεύγη νουκλεοτιδίων και 9 πρωτεΐνες.

2) Τα βακτηριακά κύτταρα μίας υγρής καλλιέργειας εκφράζουν τα ίδια γονίδια τόσο στην εκθετική όσο και στη στατική φάση μίας κλειστής καλλιέργειας, δεν εκφράζουν όμως γονίδια κατά τη φάση θανάτου.

3) Είναι εφικτή η δημιουργία cDNA βιβλιοθήκης ενός ρετροϊού, ενός αδενοϊού και του Τ2.

4) Μία μετάλλαξη που καταργεί τη ΘΕΑ του χρωμοσωμικού DNA των βακτηρίων είναι θανατηφόρος. Ομοίως, είναι θνησιγόνα μετάλλαξη και η κατάργηση από μετάλλαξη μίας ΘΕΑ από χρωμοσωμικό DNA ενός ανώτερου φυτού.

5) Σε ενα άτομο ομόζυγο για τα γονίδια βς, έγινε cDNA βιβλιοθήκη των ερυθροκυτταρων του, πριν και μετά την πλήρη θεραπεία του. Μεταξύ ενός ανιχνευτη αποτελούμενο από 25 νουκλεοτίδια και ενός ανιχνευτη αποτελούμενο από 5 νουκλεοτίδια, ποιον θα επέλεγαν οι επιστήμονες για να διακρίνουν τις δυο βιβλιοθήκες του ατόμου αυτού;

6) Αιμοσφαιρινη Α δεν παράγεται στα εμβρυακά ερυθροκύτταρα.

7) Οι δισουλφιδικοί δεσμοί αναπτύσσονται στις πρωτεινες μεταξύ των κυστείνων.

8) Οι επιλεκτικές διασταυρώσεις είναι βιοτεχνολογική μέθοδος

9) Εαν γνωρίζεται ότι το καρβοξυτελικό άκρο της λειτουργικής πρωτεινης είναι στο μικρο πεπτίδιο στο σχήμα που σας δίνεται  πάνω τότε σχεδιάστε πάνω στο μόριο της προϊνσουλίνης τους προσανατολισμούς του ενδιάμεσου πεπτιδιου που αφαιρείται. (2)

img8_2.jpg

(μονάδες 10)

ΖΗΤΗΜΑ 2Ο

 1) Δίνεται το παρακάτω πειραματικό σχήμα των Lederberg and Tatum 1946: 

Σε κάθε δοκιμαστικό σωλήνα υπάρχει διαφορετικό στέλεχος E. coli και διαφορετικό θρεπτικό υλικό.

2018 Προσομοίωση θετικής-02

ΥΠΟΜΝΗΜΑ

1) Bio = Βιοτίνη

2) Phe = Φαινυλαλανίνη

3) Cys = Kυστεΐνη

4) Thr = Θρεονίνη

5) Leu = Λευκίνη

6) Thi = Θειαμίνη

Τα τρυβλία 1 και 2 καθώς και 3 δεν περιέχουν τα συστατικά 1 έως 6 αλλά τα απαραίτητα συστατικά για να συντεθούν μέσω του μεταβολισμού των κυττάρων.

Ενώ και τα τρία τρυβλια εμβολιαστηκαν μόνο στο τρυβλιο 2 αναπτύχθηκαν αποικίες.

Στο επόμενο σχήμα δίνεται η πειραματική διάταξη του Β. Davis (1950).

Σε κάθε πλευρά του σωλήνα υπάρχει διαφορετικό στέλεχος E.coli και διαφορετικό θρεπτικό υλικό όπως φαίνεται στο σχήμα.

 

2018 Προσομοίωση θετικής-03

Σημείωση: Στα τρυβλία  της αμέσως παραπάνω εικόνας ενώ εμβολιαστηκαν το καθένα, με ένα από τα δυο διαφορετικά στελέχη που υπάρχουν στον σωλήνα εκατέρωθεν της ημιπερατής μεμβράνης 4 ωρές μετά τον εμβολιασμό του σωλήνα σε σχήμα U, σε κανένα τρυβλίο δεν αναπτύχθηκαν αποικίες, οι τελειες στο σχημα υποδηλωνουν τα σημεια οπου επεσαν μικροβια κατα τον εμβολιασμο των τρυβλιων αλλα δεν αναπτυχθηκαν εκει αποικιες.

Ποιο είναι το συμπέρασμα που προκύπτει από τα δύο παραπάνω πειράματα;

(15 μονάδες)

2) Δίνονται τα παρακάτω διαγράμματα μεταξύ των ατόμων δύο πληθυσμών που ακολουθούν το πρότυπο διασταυρώσεων κατά Mendel.

2018 Προσομοίωση θετικής-04

Εξηγήστε ποιος χαρακτήρας ελέγχεται μονογονιδιακά και ποιος πολυγονιδιακά (5).

3) Δίνεται το παρακάτω διάγραμμα που εκφράζει την πιθανότητα εμφάνισης μίας μετάλλαξης σε συνάρτηση με το χρόνο έκθεσης των σωματικών κυττάρων σε σταθερή δόση ακτινοβολίας ικανής για μεταλλαξιγένεση (5).

2018 Προσομοίωση θετικής-05

Εξηγήστε για ποιο λόγο τα κύτταρα εμφανίζουν μεγαλύτερη ακτινοευαισθησία στη μεσοφάση.

ΖΗΤΗΜΑ 3Ο                                                                                          ΜΟΝΑΔΕΣ 25

 1) Σας δίνεται το παρακάτω διάγραμμα μεταβολής της θερμοκρασίας σε συνάρτηση με το χρόνο. Σε ποια διαδικασία λαμβάνουν χώρα αυτές οι μεταβολές κυκλικά(2); Γιατί απαιτούνται αυτές οι θερμοκρασίες, τι συμβαίνει κάθε φορά(6); Γιατί οι φάσεις 2 έως 5 επαναλαμβάνονται 30 φορές, ποιο θα είναι το τελικό προϊόν αυτής της επαναληψιμότητας(6);

20170924_095456

2) Ένα φυσιολογικό άτομο προσέρχεται στο νοσοκομείο και εξετάζεται ο καρυότυπός του λαμβάνοντας από το άτομο αυτό αίμα. Μετά το τέλος της διαδικασίας δημιουργίας του καρυότυπου, στο άτομο αυτό εμφανίστηκαν δύο διαφορετικού φύλου, φυσιολογικοί ανθρώπινοι καρυότυποι.

α) Εξηγήστε πώς είναι δυνατόν κάτι τέτοιο!(4)

β) Ποια θα αναμένεται να είναι η ερώτηση που έκαναν οι γιατροί στον άνθρωπο αυτό, μετά την παρατήρηση του καρυότυπού του (3).

γ) Το άτομο αυτό έχει ομάδα αίματος Ο σύμφωνα με το σύστημα ΑΒΟ. Πόσες πρωτεΐνες ευθύνονται για την εμφάνιση αυτού του φαινοτύπου(4);

ΖΗΤΗΜΑ 4Ο

1) Στον πασίγνωστο Αρχαίο Ελληνικό μύθο του Οιδίποδα, ο ήρωας γίνεται τυχαία πατροκτόνος και στη συνέχεια εν αγνοία του παντρεύεται τη μητέρα του Ιοκάστη. Ο Οιδίποδας και η Ιοκάστη απέκτησαν τέσσερα παιδιά, τον Πολυνίκη, τον Ετεοκλή, την Αντιγόνη και την Ισμήνη.

Όταν ο Οιδίποδας έμαθε ποιον σκότωσε και ποια παντρεύτηκε, τυφλώθηκε και στη συνέχεια αυτοεξορίστηκε.

Παρακάτω δίνεται το γενεαλογικό δέντρο της οικογένειας του Οιδίποδα, όπως περιγράφεται στο μύθο.

2018 Προσομοίωση θετικής-06

Σύμφωνα με τον παραπάνω μύθο και με βάση τις γνώσεις σας στη Βιολογία, απαντήστε στις ερωτήσεις:

α) Ποιο είναι το μέγιστο και ποιο το ελάχιστο ποσοστό χρωμοσωμάτων μητρικής προέλευσης που φέρει η Αντιγόνη και η Ισμήνη;

β) Απαντήστε στο ίδιο ερώτημα για τα αρσενικά παιδιά του ζεύγους Οιδίποδα – Ιοκάστης.

γ) Μια σπάνια νόσος που οδηγεί σε τύφλωση εμφανίζεται σε άνδρες και γυναίκες αλλά οι άνδρες όταν εμφανίζουν αυτή τη νόσο πολύ συχνά εμφανίζουν και τρίχες στο εσωτερικό των αυτιών τους. Οι γυναίκες φυσιολογικά δεν εμφανίζουν ποτέ τρίχες στα αυτιά, είτε νοσούν από την ασθένεια που οδηγεί σε τύφλωση, είτε όχι. Όμως υπάρχουν άνδρες με τρίχες στο εσωτερικό των αυτιών που όμως δε νοσούν από αυτή τη μορφή τύφλωσης.

σημείωση: Για τα δυο γονίδια δεν ισχύει ο 2ος νομος Μεντελ. Για το γονίδιο που ελέγχει την τριχοφυια στα αυτιά  δεν ισχύει ο 1ος νομος Μεντελ.

Τόσο ο Λάιος, όσο και ο Οιδίποδας καθώς και οι δύο γιοί του Οιδίποδα εμφανίζουν τρίχες στο εσωτερικό των αυτιών τους. Ωστόσο ο βασιλιάς Λάιος δεν εμφάνισε τη νόσο που θα τον τύφλωνε, παρόλο που είχε ξεπεράσει κατά πολύ την ηλικία εμφάνισής της όταν θανατώθηκε από το γιο του Οιδίποδα.

Με ποια πιθανότητα κάθε γιος του Οιδίποδα θα εμφανίσει τη νόσο της τύφλωσης αυτής;

Υπάρχει περίπτωση η Αντιγόνη και η Ισμήνη να νοσήσουν από αυτή τη μορφή τύφλωσης; Εάν ναι, τότε οι κόρες του Οιδίποδα θα εμφανίσουν και τρίχες στο εσωτερικό των αυτιών τους;

δ) Ο πρωτότοκος γιος του Οιδίποδα, ο Πολυνικης, εάν παντρευόταν την αδελφή του Ισμήνη και έκαναν δύο παιδιά, ένα αγόρι και ένα κορίτσι, με ποια πιθανότητα κάθε παιδί θα εμφάνιζε τρίχες στα αυτιά και αυτή τη μορφή τύφλωσης;

Θεωρούμε γνωστό ότι: Ο Πολυνικης δεν τυφλώθηκε και είχε τρίχες στα αυτιά. Η Ισμήνη δεν τυφλώθηκε και ως γυναίκα δεν είχε τρίχες στα αυτιά. (5 * 4)

2) Δίνονται τα παρακάτω δύο πλασμίδια:

2018 Προσομοίωση θετικής-07

Το πλασμίδιο Α πέπτεται από την περιοριστική ενδονουκλεάση EcoRI.

Το πλασμίδιο Β πέπτεται από μια διαφορετική ενδονουκλεάση που αναγνωρίζει τη δίκλωνη αλληλουχία   GAATTC

CTTAAG

και σπάζει τους φωσφοδιεστερικούς δεσμούς μεταξύ του CT αφήνοντας κολλώδη άκρα.

Τα πλασμίδια Α και Β μπορούν να ανασυνδυαστούν μετά την πέψη τους από τις περιοριστικές ενδονουκλεάσες με τη δράση της DNA δεσμάσης (5);

 

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ 2018 (Β)

ΖΗΤΗΜΑ 1Ο

 Α. Επιλέξτε τη σωστή επιλογή που συμπληρώνει σωστά την πρόταση.

(μονάδες 20)

1) Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά τις ομάδες αίματος στο σύστημα ΑΒΟ του ανθρώπου:

2017 Διαγώνισμα προσομοίωσης Β-01

Τα άτομα της ΙΙΙ γενεάς έχουν φαινοτύπους:

α) Ο, Α, Β, Ο, Ο με πιθανότητα  (1/4)3 x(1/2) 2

β) Ο, Β, Ο, Α, Α με πιθανότητα  4 x(1/4)

γ) Ο, Α, Β, Ο, Α με πιθανότητα   1/4 x 1/4 x 1/4 x 1/4 x 1/4 x 1/4

δ) Ο, Ο, Ο, Ο, Ο με πιθανότητα  1 –  1023/1024

ε) Τίποτα από τα παραπάνω.

 

2) Δίνεται η παρακάτω υποθετική αλληλουχία του ενός κλώνου (κωδική

 

) γονιδίου που κωδικοποιεί για tRNA.

 

ΥΠΟΚΙΝΗΤΗΣ                   ΕΣΩΝΙΟ                     ΕΣΩΝΙΟ                        ΑΛΜ

ATCGCCTTAACCTACTACGCCTATACTATTCTATCCCCGCTATCTCATTCCTTT

—————-                    —————-                        ————                 ————-

Ποια είναι η αλληλουχία του ώριμου μεταγραφήματος;

α) Ομοίως με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

β) Συμπληρωματική με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

γ) Όμοια με την παραπάνω χωρίς τον υποκινητή και τα εσώνια αποτελούμενη από ριβονουκλεοτίδια.

δ) Συμπληρωματική με την παραπάνω χωρίς τον υποκινητή, τα εσώνια και τις ΑΛΜ αποτελούμενη από ριβονουκλεοτίδια.

ε) Τίποτα από τα παραπάνω.

3) Ένα άτομο προσήλθε στο νοσοκομείο και μετά από βιοχημικές εξετάσεις διαπιστώθηκε ότι έχει αυξημένα επίπεδα HbA2 και ήταν μολυσμένο από το πλασμώδιο. Το άτομο αυτό:

α) Νοσεί από δρεπανοκυτταρική αναιμία.

β) Νοσεί από β-θαλασσαιμία.

γ) Νοσεί από λοιμώδες νόσημα (ελονοσία).

δ) Είναι φορέας μίας γενετικής νόσου και δεν κινδυνεύει να πεθάνει από ελονοσία.

ε) Είναι φορέας δύο ασθενειών, της δρεπανοκυτταρικής αναιμίας (γενετική νόσος) και της ελονοσίας (λοιμώδης).

4) Ο καρκίνος είναι ένα γενετικό νόσημα που οφείλεται κατά κανόνα σε:

α) Έλλειψη πρωτοογκογονιδίων και υπερλειτουργία ογκοκατασταλτικών.

β) Έλλειψη ογκοκατασταλτικών και υπερλειτουργία πρωτοογκογονιδίων.

γ) Έλλειψη επιδιορθωτικών ενζύμων και υπερέκφραση ογκοκατασταλτικών γονιδίων.

δ) Λάθη που γίνονται κατά τη μείωση και τη μίτωση και οδηγεί σε ανευπλοειδία.

ε) Τίποτα από τα παραπάνω.

5) Στο βακτήριο E.coli η φυσιολογική έκφραση του ρυθμιστικού γονιδίου του οπερονίου της λακτόζης (υποθετικά) έχει ρυθμό 20 μόρια καταστολέα/24h και ρυθμό αποικοδόμησης καταστολέων 10 μόρια καταστολέα/24h όταν το βακτήριο αναπτύσσεται σε περιβάλλον με 100% γλυκόζη. Ένα βακτήριο που αναπτύσσεται σε περιβάλλον γλυκόζης και λακτόζης μετράται η παραγωγή των mRNA που κωδικοποιούνται από το οπερόνιο της λακτόζης.

2017 Διαγώνισμα προσομοίωσης Β-02

Στις χρονικές στιγμές t1, t2, t3 αντιστοίχως έχουμε μορια mRNA οπερονιου της λακτόζης:

α) 10 μόρια,     100 μόρια,        0 μόρια

β) 0 μόρια,       100 μόρια,        100 μόρια

γ) 10 μόρια,     100 μόρια,        100 μόρια

δ) 100 μόρια,   1000 μόρια,      0 μόρια

ε) Τίποτα από τα παραπάνω

Β. Χαρακτηρίστε ως Σ (Σωστή) ή Λ (Λανθασμένη) την καθεμία από τις παρακάτω προτάσεις:

α) Ένα πείραμα in vivo είναι το πείραμα δημιουργίας αμιγών στελεχών του Mendel.

β) Η Τρισωμία 21 (μη διαχωρισμός του 21ο χρωμοσώματος) έχει περισσότερες πιθανότητες να εμφανιστεί κατά τη μείωση σε σχέση με οποιαδήποτε άλλη τρισωμία του ανθρώπου.

γ) Για τα γονίδια α των αιμοσφαιρίνων ισχύουν οι νόμοι του Mendel.

δ) Ένα θηλυκό άτομο έχει όλα του τα γονίδια σε δύο αντίγραφα, ένα αρσενικό άτομο όχι.

ε) Το ρετινοβλάστωμα είναι μορφή καρκίνου που ελέγχεται μονογονιδιακά.

στ) Υπάρχει γονίδιό μας που γι’ αυτό υπάρχουν εκατοντάδες αντίγραφά του σε ένα μας κύτταρο.

ζ) Το ίδιο προϊόν ζύμωσης μπορεί να παράγεται από τον ίδιο μικροοργανισμό σε μεγάλες ποσότητες, τόσο στην εκθετική όσο και στη στατική.

η) Οι στόχοι της Ιατρικής είναι με τη σειρά: Η πρόληψη, η διάγνωση και η θεραπεία.

θ) Για τη δημιουργία των Βt φυτών δημιουργήθηκε cDNA βιβλιοθήκη του B. thurigiensis.

ι) Τα προϊόντα της ζύμωσης μπορεί να είναι ζωντανά ή νεκρά κύτταρα ή προϊόντα ζωντανών κυττάρων.

 

ΖΗΤΗΜΑ 2Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α. Δίνεται ο παρακάτω πίνακας. Να πραγματοποιηθούν όλες οι πιθανές αντιστοιχίσεις.

                                                            (μονάδες 5)

ΣΥΜΠΛΗΡΩΜΑΤΙΚΟΤΗΤΑ
1.     ΠΡΩΤΑΡΧΙΚΟ ΤΜΗΜΑ RNA Α. in vivo
2.     ΣΥΝΔΕΣΗ ΜΕΤΑΓΡΑΦΙΚΩΝ ΠΑΡΑΓ.
3.     ΔΗΜΙΟΥΡΓΙΑ 3΄       5΄ Ρ-ΔΕΣΜΩΝ B. in vitro
4.     ΣΥΝΔΕΣΗ ΚΟΛΛΩΔΩΝ ΑΚΡΩΝ
5.     ΙΧΝΗΘΕΤΗΜΕΝΟΣ ΑΝΙΧΝΕΥΤΗΣ Γ. ΤΙΠΟΤΑ ΑΠΟ ΤΑ ΠΑΡΑΠΑΝΩ

Β. 1) Ποιο θα είναι το αποτέλεσμα στην πρωτεΐνη που παράγεται σε προκαρυωτικό κύτταρο, αν στο γονίδιο που την κωδικοποιεί γίνει αντικατάσταση μίας βάσης;

(μονάδες 8)

2) Με ποιον από τους παρακάτω τρόπους θα μπορούσε να προκύψει ένα μηρυκαστικό ζώο το οποίο να παράγει τον πηκτικό παράγοντα ΙΧ στο γάλα του:

α) Με τη μέθοδο των επιλεκτικών διασταυρώσεων.

β) Με μεθόδους Γενετικής Μηχανικής.                                                    (μονάδες 2)

Αιτιολογήστε την απάντησή σας.                                                            (μονάδες 5)

3) Να αναφέρετε τα πλεονεκτήματα παραγωγής ανθρώπινης αυξητικής ορμόνης με μεθόδους Γενετικής Μηχανικής σε σχέση με την εξαγωγή της από πτώματα.

(μονάδες 5)

ΖΗΤΗΜΑ 3Ο

Α. Η Ράνια και η Αρεθα είναι δύο φίλες που ταξίδεψαν στο Περού πριν από μερικά χρόνια. Κατά το ταξίδι τους στα υψίπεδα των Άνδεων, εμφάνισαν συμπτώματα αναιμίας και μεταφέρθηκαν στο τοπικό νοσοκομείο, όπου και διαγνώστηκαν φαινοτυπικα ως ετεροζυγες για κάποιο παθολογικό αλληλόμορφο του γενετικού τόπου, όπου εδράζεται το γονίδιο της β σφαιρινης στο 11 χρωμόσωμα μας. Τα γονίδιά της α σφαιρινης εδράζονται στο 16ο χρωμόσωμα μας.

Μετά από βιοχημικές και μοριακές εξετάσεις στην Ελλάδα αποδείχθηκε ότι η Ράνια είναι φορέας της δρεπανοκυτταρική αναιμίας και η Αρεθα της μεσογειακής αναιμίας.

Παρακάτω φαίνεται το γενεαλογικό δένδρο των οικογενειών που δημιούργησαν οι δυο φίλες.

 2018 διόρθωση-01

Το άτομο ΙΙ3 νοσεί από δρεπανοκυτταρική αναιμία και το άτομο ΙΙ6 νοσεί από μεσογειακή αναιμία. Είναι γνωστό ότι τα άτομα ΙΙ8, ΙΙΙ7, ΙV6 είναι ομόζυγα φυσιολογικά για την μεσογειακή αναιμία και το άτομο ΙΙ1 είναι επίσης ομόζυγο φυσιολογικό για το γονίδιο β, ενώ ένα μόνο από τα άτομα ΙΙΙ2, ΙV2, V2 είναι ετεροζυγο για το γονίδιο βς.

Το άτομο VII1 γεννήθηκε με μίκροδρεπανοκυττταρική αναιμία.

α. Εάν υποθέσουμε ότι τα σχολικά εγχειρίδια στο Περού, κάνουν αναφορά στην δρεπανοκυτταρική αναιμία και την μεσογειακή αναιμία, με ποιο τρόπο κληρονόμησης νομίζετε ότι θα αναφέρουν ότι κληρονομούνται οι ασθένειες αυτές; (μονάδες 2)

β. Ποιά ήταν οι πιθανότητα, οι δυο φίλες να αποκτήσουν τον απόγονο VII1, που νοσεί από μίκροδρεπανοκυττταρική αναιμία, όπως προκύπτει από το γενεαλογικό δένδρο ; (5)

γ. Το ζευγάρι VI1, VI2, πρόκειται να αποκτήσει και δεύτερο παιδί. Το ζευγάρι ζήτησε γενετική καθοδήγηση για το ποιό είναι το ενδεχόμενο να αποκτήσει υγιές κορίτσι,  φορέα της δρεπανοκυτταρική αναιμίας ή υγιές αγόρι, φορέα της μεσογειακής αναιμίας ή υγιές κορίτσι ομόζυγο για το φυσιολογικό γονίδιο β1 ή υγιές αγόρι φορέα της δρεπανοκυττταρικής αναιμίας.

Τι τους απάντησε ο γενετιστής πριν και μετά τις μοριακές εξετάσεις για το γονίδιο β στο έμβρυο. Οι γονείς δεν θέλησαν ωστόσο να μάθουν το φύλο του δεύτερου παιδιού τους πριν την γέννηση του.(6)

Η μοριακή εξέταση έγινε με μια περιοριστική ενδονουκλεαση που πέπτει το αλληλόμορφο βς και το β όχι. Επίσης αποδείχθηκε ότι το παθολογικό αλληλόμορφο β1 για την μεσογειακή αναιμία έχει πάθει έλλειψη 25 ζ.β εντός της 5´ αμεταφραστής περιοχής του.

δ. Για ποιο λόγο η αναιμία, που προκαλείται από το αλληλόμορφο β1, αλλά και διάφορα άλλα παθολογικά αλληλόμορφα του γενετικού τόπου της β σφαιρίνης, που οδηγούν σε ελάττωση της φυσιολογικής ποσότητας της HbA ονομάζεται μεσογειακή αναιμία ; (3)

ε. Είναι γνωστό ότι το γονίδιο για την α σφαιρίνη εδράζεται στο 16 χρωμόσωμα μας, και αυτός ο γενετικός τόπος είναι διπλός, διαδοχικά ο ένας μετά τον άλλο. Ο γενετικός τόπος δε, 16p13.2 (πάνω) εκφράζεται με μικρότερο ρυθμό ( υποθετικά στο μισό) σε σχέση με τον γενετικό τόπο του α γονιδίου 16p13.1(κάτω). Εάν υποθέσουμε ότι ο πρώτος γενετικός τόπος φέρει γονίδιο α που εκφράζεται και παράγει 50 μοναδες των αλυσίδων α, τότε ο δεύτερος θα παράγει 100 μονάδες από α σφαιρίνες.

Ένα παιδί του ζευγαριού IV1, IV2, που και οι δυο είναι υγιείς, παντρεύτηκε και απέκτησε δύο παιδιά. Το πρώτο παράγει 200 μονάδες αλυσίδων α και νοσεί από δρεπανοκυτταρική αναιμία, ενώ το δεύτερο παιδί του παράγει 250 μονάδες αλυσίδων α και σε συνθήκες υποξύας εμφανίζει συμπτώματα αναιμίας και δεν παράγει καθόλου HbA2.

Ποιοί είναι οι γόνοτυποι των γονέων των δυο αυτών παιδιών για την α θαλασσαιμία; (2)

Με ποιά πιθανότητα, οι γονείς αυτοί, μπορούν να αποκτήσουν παιδί που θα παράγει 250 μονάδες α σφαιρίνων και θα παράγει περίπου 3% HbA2, ενώ θα νοσεί και από μικροδρεπανοκυττταρική αναιμία; (2)

Β. Το γονίδιο lux της πυγολαμπίδας ενθέτεται σε έναν πλασμιδιακό φορέα κλωνοποίησης που φέρει γονίδιο ανθεκτικότητας στην τετρακυκλίνη (tetR), το οποίο με τη σειρά του φέρει θέση αναγνώρισης από την EcoRI, καθώς και το γονίδιο lacZ του οπερονίου της λακτόζης:

α) Εξηγήστε αν τα κύτταρα-ξενιστές που δέχθηκαν τον ανασυνδυασμένο φορέα κλωνοποίησης θα εμφανίζουν βιοφωταύγεια. (μονάδες 3)

β) Ποια ιδιότητα πρέπει να χαρακτηρίζει τα κύτταρα-ξενιστές (E.coli) ώστε να μπορεί να γίνει η επιλογή των μετασχηματισμένων με το ανασυνδυασμένο.   (μονάδες 2)

ΖΗΤΗΜΑ 4Ο

Α. Τα αλληλόμορφα α+, β+, γ+ και δ+ είναι ανεξάρτητα μεταξύ τους και ελέγχουν το σχηματισμό μαύρου χρώματος σε ένα ζώο. Τα αλληλόμορφα α, β, γ, δ είναι τα υπολειπόμενα τα οποία δεν εκφράζονται.

     Ένα μαύρο άτομο που είναι καθαρή σειρά διασταυρώθηκε με ένα λευκό άτομο και στην F1 γενεά όλοι οι απόγονοι ήταν μαύροι. Στη συνέχεια διασταυρώθηκαν τα άτομα της F1 γενεάς.

Γνωρίζετε ότι το μεταβολικό μονοπάτι είναι:

α+                                β+                             γ+                            δ+

ΛΕΥΚΟ    —>      ΛΕΥΚΟ     —>     ΛΕΥΚΟ   – –>       ΚΑΦΕ    —>     ΜΑΥΡΟ

α) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΛΕΥΚΟ;

β) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΚΑΦΕ;                (μονάδες 5)

Β. Στο βακτήριο E.coli υπάρχει μία πρωτεΐνη με φυσιολογικό αμινοτελικό άκρο:                                         H2N – Met – Val – Ser – Ser – Pro – Met – Gly – Ala – Ala – Met – Ser …

Μία μετάλλαξη προκάλεσε αλλαγή στο αντικωδικόνιο ενός μορίου t

RNA  από 5΄- GAU – 3΄ σε 5΄- CAU – 3΄. Ποιο/α μπορεί να είναι τα πιθανά αμινοτελικά άκρα αυτής της πρωτεΐνης στα μεταλλαγμένα κύτταρα E.coli;               (μονάδες 5)

Γ. Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά την ασθένεια της μυοτονικής δυστροφίας.

2017 Διαγώνισμα προσομοίωσης Β-05

 

Η μυοτονική δυστροφία εμφανίζεται με βαθμιαία σοβαρότερα συμπτώματα από γενεά σε γενεά. Για να εξηγηθεί αυτή η παρατήρηση πραγματοποιήθηκαν μοριακές εξετάσεις στα άτομα Ι2, ΙΙ2 και ΙΙΙ2.

Οι αναλύσεις αυτές έδειξαν ότι ο ιχνηθετημένος ανιχνευτής 5΄CTGCTGCTGCTGCTG 3΄ υβρίδισε στο άτομο Ι2 10 φορές με το άτομο ΙΙ2 300 φορές και με το άτομο ΙΙΙ2 2000 φορές.

α) Ποια διασταύρωση του δοθέντος γενεαλογικού δέντρου αποδεικνύει τον τρόπο κληρονόμισης της ασθένειας; Ποιος είναι ο τύπος κληρονομικότητας;

(μονάδες 2)

β) Τα αποτελέσματα των μοριακών εξετάσεων σε ποιο συμπέρασμα οδηγούν για την αιτία της αυξανόμενης σοβαρότητας των συμπτωμάτων της ασθένειας από γενεά σε γενεά;

(μονάδες 3)

γ) Οι ανιχνευτές υβριδίζουν στην περιοχή της 3΄ αμετάφραστης περιοχής του υπεύθυνου για την ασθένεια γονιδίου. Ποιο από τα τρία διαφορετικά είδη κλωνοποίησης του γονιδίου αυτού μπορούν να χρησιμοποιήσουν οι επιστήμονες; Αιτιολογήστε με συντομία την απάντησή σας.

(μονάδες 3)

δ) Πώς ονομάζονται τα γονίδια που ευθύνονται για την ασθένεια στα άτομα Ι2, ΙΙ2 και ΙΙΙ2;

(μονάδα 1)

ε) Προτείνετε ένα πιθανό τύπο μετάλλαξης που μπορεί να εξηγήσει το διαφορετικό μέγεθος της 3΄ αμετάφραστης περιοχής του υπεύθυνου γονιδίου από γενεά σε γενεά εάν γνωρίζετε ότι είναι αποτέλεσμα μηχανισμού κατά τη διάρκεια του κυτταρικού κύκλου.

(μονάδα 1)

στ) Οι επιστήμονες θέλουν να ενθέσουν σε φορείς έκφρασης (πλασμίδια) τα γονίδια που ευθύνονται για την ασθένεια των ασθενών ατόμων της γενεαλογίας που σας δίνεται. Δίνεται ο περιοριστικός χάρτης του γονιδίου και δύο διαφορετικοί φορείς κλωνοποίησης. Ποια/ες περιοριστικές ενδονουκλεάσες θα χρησιμοποιήσουν οι επιστήμονες ώστε να εξασφαλίσουν των έκφραση των γονιδίων;

2017 Διαγώνισμα προσομοίωσης Β-06

2017 Διαγώνισμα προσομοίωσης Β-07

  1. Ποιος από τους δύο φορείς έκφρασης θα χρησιμοποιηθεί;
  2. Εξηγήστε για ποιο λόγο ο φυσικός Υ1 του γονιδίου της AmpR είναι ο κατάλληλος για την έκφραση του ανθρώπινου γονιδίου στο βακτήριο ξενιστή.

(μονάδες 5)

Διαγώνισμα βιολογίας θετικού προσανατολισμού στα κεφαλαία 2-4

ΖΗΤΗΜΑ 1Ο                                                                                             ΜΟΝΑΔΕΣ 25

 

Α)                                                                                                             ΜΟΝΑΔΕΣ 15

  1. Ποιο από τα παρακάτω πλασμίδια είναι κατάλληλο να χρησιμοποιηθεί ως φορέας κλωνοποίησης σε ζυμομύκητα cDNA βιβλιοθήκης του αλόγου;

2017 Διαγώνι??? 2-4-01

Υπόμνημα: όπου Υ = Υποκινητής, ΑΛΜ= Αλληλουχίες Λήξης της Μεταγραφής,

ΘΕΑ= Θέση Έναρξης της Αντιγραφής, TetR = γονίδιο ανθεκτικότητας στο αντιβιοτικό τετρακυκλινη, Killer= γονίδιο που κωδικοποιεί για μια τοξική πρωτεΐνη για τον ξενιστή, lacZ  = γονίδιο που κωδικοποιεί για την β-γαλακτοζιδαση, Polylinker= πολλές διαφορετικές μοναδικές διαδοχικές αλληλεπικαλυπτόμενες θέσεις περιορισμού. Κάθε polylinker εδώ είναι διαφορετικός από τους άλλους.

1ο πλασμιδιο: οι υποκινητές είναι οι φυσικοί υποκινητές των αναφερομένων γονίδιων.

2ο πλασμιδιο: ο πρώτος υποκινητής είναι γονίδιου της ζύμης, ο δεύτερος υποκινητής είναι ο φυσικός υποκινητής του γονίδιου lacZ.

3o  πλασμιδιο: όλοι οι υποκινητές και οι ΑΛΜ ανήκουν στη ζύμη.

4ο πλασμιδιο: οι ΑΛΜ στα δεξιά ανήκουν στο γονίδιο της ανθεκτικότητας στην τετρακυκλινη και όλοι οι υποκινητες ανήκουν στη ζυμη.

  1. Πόσα γονίδια υπάρχουν στο παρακάτω τμήμα γονιδιωματικής βιβλιοθήκης του βακτηρίου Treponema Pallidum. Ορίστε τα τμήματα που τα αποτελούν.

2017 Διαγώνι??? 2-4-02

Ο Υποκινητής δεξιά είναι ο Υ1 και βρίσκεται στην περιοχή Β του χρωμοσώματος

Τ και Ρ Συντηρημένες αλληλουχίες

 

α) Δύο γονίδια: γονίδια: (Υ1 : Γ + Δ, Υ2 : Ε + Δ + Γ + Β + Α + Ω)

β) Δύο γονίδια: γονίδια: (Υ1 : Γ + Δ, Υ2 : Η + Θ)

γ) Δύο γονίδια: γονίδια: (Υ1 : Β + Α + Ω, Υ2 : Ζ + Ε + Δ)

δ) Δύο γονίδια: γονίδια: (Υ2 : Η + Θ, Υ1 : Α + Ω)

  1. Ο ρυθμός της κυτταρικής διαφοροποίησης στο σύνολο του οργανισμού από την εμβρυική ηλικία μέχρι τα βαθιά γεράματα θα μπορούσε να αποδοθεί με το γράφημα:

2017 Διαγώνι??? 2-4-03

Σημείωση: Τα διαγράμματα δεν δίνονται υπό κλίμακα.

  1. Η αντιγραφή ενός κυκλικού μορίου DNA μπορεί να γίνεται σύμφωνα με ότι γνωρίζετε από το σχολικό βιβλίο.

2017 Διαγώνι??? 2-4-04

ε) Με όλους τους παραπάνω τρόπους.

στ) Με τους δύο πρώτους αναλόγως το είδος του κυκλικού μορίου.

  1. Δίνονται τα παρακάτω δύο γραμμικά μόρια DNA:

2017 Διαγώνι??? 2-4-05

Σημείωση: από τα αριστερά προς τα δεξιά είναι τα θραύσματα Α1, Α2, Α3 και Β1, Β2, Β3.

Τα μόρια DNA πέπτονται από δύο διαφορετικές Π.Ε την EcoRI και ένα περιοριστικό ένζυμο που αναγνωρίζει την αλληλουχία     5΄ C TTAAG

                                                                                                GAATT C

και κόβει μεταξύ του C και Τ σε κάθε κλώνο.

Εν συνεχεία τα δύο αυτά κομμένα μόρια αναμειγνύονται παρουσία του ενζύμου DNA δεσμάση. Μπορούν να δημιουργηθούν οι συνδυασμοί:

α) Α1 + Α3, Β1 + Β3, Α2 + Β2

β) Α1 + Β3, Β1 + Α3, Α2 + Β2

γ) Α1 + Β1, Α3 + Β3, Α2 + Β2

δ) Α1 + Α3, Β1 + Β3

Β) Χαρακτηρίστε ως Σ ή Λ καθεμία από τις παρακάτω προτάσεις:

ΜΟΝΑΔΕΣ 10

  1. Σε ένα βακτήριο έχει συμβεί λάθος κατά την αντιγραφή του DNA του (κυρίως μόριο), το οποίο δεν επιδιορθώθηκε στη ΘΕΑ και δεν αναγνωρίζεται από τις DNA ελικάσες, η μετάλλαξη αυτή είναι θνησιγόνος.
  2. Σε ένα ευκαρυωτικό χρωμόσωμα έγινε το ίδιο λάθος, όπως παραπάνω, σε ένα σημείο του χρωμοσώματος, είναι η μετάλλαξη αυτή θανατηφόρα;
  3. Τα ευκαρυωτικά χρωμοσώματα σε κάθε μίτωση είναι πιο κοντά από τα αντίστοιχα της προηγούμενης μίτωσης στην ίδια κυτταρική σειρά, αυτό συμβαίνει και με το βακτηριακό DNA.
  4. Στο διπλανό σχήμα για την ενίσχυση του τμήματος Α με PCR τα κατάλληλα τεχνητά ολιγονουκλεοτίδια είναι το ζευγάρι 1-3.

2017 Διαγώνι??? 2-4-06

5. Εάν ένα ευκαρυωτικό γονίδιο έχει 4 εσώνια, από το γονίδιο αυτό προκύπτουν έως 8 διαφορετικά ώριμα mRNA.

 

 

ΖΗΤΗΜΑ 2ο                                                                                             ΜΟΝΑΔΕΣ 25

1) Σε μία άσκηση ενός πανεπιστημιακού εργαστηρίου Μοριακής Βιολογίας μία ομάδα φοιτητών προσπαθεί να δημιουργήσει τη γονιδιωματική βιβλιοθήκη του βακτηρίου Lactobacillus sp.

Οι φοιτητές διαθέτουν ένα φορέα κλωνοποίησης πλασμίδιο που φέρει γονίδια ανθεκτικότητας στα αντιβιοτικά Στρεπτομυκίνη (StrR) και Αμπικιλλίνη (AmpR). Το τελευταίο φέρει και τη μοναδική θέση ανασυνδυασμού. Τα βακτήρια-ξενιστές είναι ένα κατάλληλο στέλεχος E.coli.

Στην εργασία τους οι φοιτητές έγραψαν:

«Μετά τον ανασυνδυασμό των φορέων κλωνοποίησης από τα θραύσματα του DNA του Lactobacillus sp. επακολούθησε ο μετασχηματισμός των βακτηρίων-ξενιστών. Μετά τον μετασχηματισμό, υπήρχαν 3 κατηγορίες βακτηρίων E.coli.

α) Τα μη μετασχηματισμένα που δεν φέρουν ανθεκτικότητα ούτε σε Str, ούτε σε Amp.

β) Τα μετασχηματισμένα

  1. Με το μη ανασυνδυασμένο φορέα κλωνοποίησης που έχουν ανθεκτικότητα και στα δύο αντιβιοτικά.
  2. Με τον ανασυνδυασμένο φορέα κλωνοποίησης που φέρουν ανθεκτικότητα μόνο στο αντιβιοτικό Str.

Ο διαχωρισμός των βακτηρίων που αποτελούν τη βιβλιοθήκη από τα υπόλοιπα κύτταρα E.coli θα γίνει ως εξής:

Τα ζητούμενα βακτήρια  E.coli είναι τα μετασχηματισμένα με το ανασυνδυασμένο πλασμίδιο.

Στην την υγρή βακτηριακή καλλιέργεια των ξενιστών που χρησιμοποιήθηκαν για το μετασχηματισμό τους, υπήρχε το αντιβιοτικό Str, οπότε τα μόνα βακτήρια που επέζησαν ήταν τα μετασχηματισμένα. Από αυτή την υγρή καλλιέργεια επιλέγουμε κάποια βακτήρια και τα καλλιεργούμε μεμονωμένα σε υγρό θρεπτικό υλικό. Στη συνέχεια χωρίζουμε τους απογόνους σε δύο ίσα μέρη και σε κάποια βακτήρια από τα δύο αυτά μέρη χορηγούμε αμπικιλλίνη. Αν πεθάνουν κάποια, συμπεραίνουμε ότι προέρχονται από την ομάδα που μας ενδιαφέρει, δηλαδή τα μετασχηματισμένα με το ανασυνδυασμένο πλασμίδιο.»

Εξηγήστε γιατί οι φοιτητές μηδενίστηκαν από τον υπεύθυνο του εργαστηρίου.

μονάδες 5

2) Εργάζεστε σε μία φαρμακευτική βιομηχανία και ενδιαφέρεστε να δημιουργήσετε  το εμβόλιο κατά ενός νέου ιού. Ξεκινάτε ψάχνοντας στο γονιδίωμα του ιού, ώστε να βρείτε τα/το γονίδιο που κωδικοποιεί για μία κατάλληλη πρωτεΐνη αντιγονικό καθοριστή του ιού.

Εξηγήστε το είδος της βιβλιοθήκης του ιικού DNA που θα δημιουργήσετε, γονιδιωματική ή cDNA;

3) Δίνεται το παρακάτω μόριο RNA προϊόν της μεταγραφής ενός βακτηρίου. Το μόριο αυτό είναι λειτουργικό.

2017 Διαγώνι??? 2-4-07

α) Τι είδους γονίδιο το κωδικοποιεί αυτό το μόριο RNA; (3)

β) Γράψτε το τμήμα του γονιδίου που το κωδικοποιεί και αφορά την περιοχή 3. Προσδιορίστε την κωδική αλυσίδα του γονιδίου και τον προσανατολισμό των κλώνων του. (4)

γ) Τι είδους δεσμοί σταθεροποιούν αυτή τη δομή του μορίου RNA εντός της περιοχής 2; Ποιο ένζυμο καταλύει τη δημιουργία αυτών των δεσμών; (2)

δ) Στην περιοχή 1 δίνεται ένα τμήμα της αλληλουχίας της. Μπορούμε να υπολογίσουμε τα % των βάσεων %Α, %U, %C και %G στην απέναντι πλευρά της περιοχής 1 από αυτήν που δίνεται η ακολουθία; (3)

ε) Απαντήστε στο ίδιο ερώτημα αν η ακολουθία αυτή της περιοχής 1 ήταν εντός της περιοχής 2. (3)

ΖΗΤΗΜΑ 3Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α) Παρακάτω δίνονται τα τμήματα δύο διαφορετικών γονιδίων. Το γονίδιο 1 κωδικοποιεί για μία πρωτεΐνη που εκφράζεται πάντα σε υψηλό ρυθμό. Το γονίδιο 2 εκφράζεται μόνο σε ένα κατάλληλο αναπτυξιακό στάδιο του οργανισμού.

Συνέβη αναδιάταξη γονιδίων και το τμήμα του γονιδίου 2 που δίνεται τοποθετήθηκε κοντά στον υποκινητή του γονιδίου 1. Δημιουργήθηκαν 4 διαφορετικές αναδιατάξεις. Εξηγήστε σε ποια από όλες εκφράστηκε το τμήμα του γονιδίου ② και για ποιο λόγο δεν εκφράστηκε σωστά ή καθόλου στις άλλες πιθανές αναδιατάξεις.

Σημείωση: Η αλληλουχία που δίνεται Italics και υπογραμμισμένη αποτελεί τον υποκινητή. Τα νούμερα δηλώνουν το πλήθος των νουκλεοτιδίων.  Στο γονίδιο ② η υπογράμμιση δηλώνει το πλαίσιο ανάγνωσης του γονιδίου. Στο γονίδιο ① τα bold ζεύγη βάσεων δηλώνουν τις 4 πιθανές θέσεις αναδιάταξης του γονιδίου ②. Το τμήμα του γονιδίου ② τοποθετείται κάθε φορά αμέσως μετά τη θέση 83, 136, 155, 183 του γονιδίου ①.

gene

Β) Το φυσιολογικό γονίδιο ① αντιγράφεται. Από τη θέση 80 έως τη θέση 140 υπάρχει θέση έναρξης της αντιγραφής.

Δίνονται τα παρακάτω πρωταρχικά τμήματα:

  1. 5΄ AGAGAGAAGA 3΄
  2. 5΄ CUCCCCCGCG 3΄
  3. 5΄ GAUAUAAUCU 3΄
  4. 5΄ CCAUACAUAG 3΄

τα οποία είναι τα πρώτα πρωταρχικά τμήματα που τοποθετούνται από τα πριμοσώματα. Γνωρίζετε ότι το πριμόσωμα τοποθετεί πρωταρχικό τμήμα 10 νουκλεοτιδίων κάθε 30 νουκλεοτίδια από το 5΄ άκρο του ακριβώς προηγούμενου πρωταρχικού τμήματος.

  • Να βρεθούν τα δύο επόμενα πρωταρχικά τμήματα που θα τοποθετήσουν τα πριμοσώματα. (10)
  • Σε ποιο κλώνο, στον πάνω ή στον κάτω, κινείται η DNA πολυμεράση χρησιμοποιώντας τον ως καλούπι που τοποθέτησε το 29ο νουκλεοτίδιο στον κλώνο που συντίθεται ασυνεχώς και το νουκλεοτίδιο αυτό ήταν η Τ. (3)

ΖΗΤΗΜΑ 4Ο

 Σε δύο διαφορετικά βακτηριακά στελέχη E.coli μελετήθηκε η κινητική της παραγωγής της β-γαλακτοσιδάσης, παρουσία και απουσία λακτόζης. Όταν δεν υπήρχε λακτόζη, τα βακτήρια αναπτύσσονταν σε γαλακτόζη.

2017 Διαγώνι??? 2-4-08

Για την ερμηνεία της καμπύλης ① δημιουργήθηκαν οι γονιδιωματικές βιβλιοθήκες των δύο στελεχών. Σε κάθε περίπτωση χρησιμοποιήθηκαν οι ίδιες περιοριστικές ενδονουκλεάσες και για τα δύο στελέχη. Η χρήση αυτών των Π.Ε. επιτρέπει την κοπή του γονιδιώματος του E.coli με τέτοιο τρόπο ώστε να δημιουργείται θραύσμα με ακέραιο το τμήμα που περιλαμβάνει από τον υποκινητή του ρυθμιστικού γονιδίου μέχρι και τις αλληλουχίες λήξης της μεταγραφής των δομικών γονιδίων.

Από τη σύγκριση των αλληλουχιών των οπερονίων των δύο στελεχών δεν παρατηρήθηκε καμία διαφορά μεταξύ τους.

Η σύγκριση έγινε με πέψη με ορισμένο πλήθος και είδος περιοριστικών ενδονουκλεάσεων που πέπτουν εντός του απομονωμένου τμήματος.

Σημειωση:το παρακάτω σχήμα δεν αφορά το PCR.

2017 Διαγώνι??? 2-4-10

Τα παραπάνω αποτελέσματα ηλεκτροφορισης αφορουν τη γονιδιωματική βιβλιοθήκη  για τους κλώνους που περιέχουν το οπερόνιο στις  βιβλιοθήκες Α και Β.

Κάθε  μια από τις πέψεις i, ii, iii  έγινε με διαφορετικό σύνολο περιοριστικών ενζύμων.

Ακολούθησε PCR μέθοδος στα γονιδιώματα των στελεχών:

  1. PCR για την ενίσχυση του γονιδίου της β-γαλακτοσιδάσης.
  2. PCR για την ενίσχυση του χειριστή.
  3. PCR για την ενίσχυση του ρυθμιστικού γονιδίου.

Κατόπιν επακολούθησε πέψη των προϊόντων της PCR για τη σύγκριση των αλληλουχιών αυτών των δύο στελεχών.

Ακόμη είχε γίνει υβριδοποίηση των γονιδιωματικών βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των αποικιών των παραπάνω περιοχών του οπερονίου.

Τα αποτελέσματα του PCR είναι: Για την ενίσχυση των περιοχών DNA:

2017 Διαγώνι??? 2-4-11

iii

2017 Διαγώνι??? 2-4-09

Ακόμη είχε γίνει υβριδοποίηση των γονιδιωματικών βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των αποικιών των παραπάνω περιοχών του οπερονίου.

Τα αποτελέσματα της υβριδοποίησης είναι:

table

 

Σύμφωνα με την παραπάνω πειραματική διαδικασία, απαντήστε:

α) Για ποιο λόγο οι επιστήμονες δημιούργησαν γονιδιωματικές και όχι cDNA βιβλιοθήκες των δύο στελεχών;

β) Για ποιο λόγο δημιούργησαν τις δύο διαφορετικές βιβλιοθήκες χρησιμοποιώντας τα ίδια ένζυμα;

γ) Για ποιο λόγο συνέκριναν τις αλληλουχίες των δύο οπερονίων των δύο στελεχών; Πώς γίνεται η σύγκριση με την πέψη;

δ) Για ποιο λόγο έγινε PCR των συγκεκριμένων περιοχών του γονιδιώματος που ανήκουν στο οπερόνιο των δύο στελεχών από ολόκληρο το γονιδίωμα;

ε) Για ποιο λόγο συνέκριναν ως προς την αλληλουχία τα προϊόντα του PCR, που έγινε για στοχευμένα τμήματα του οπερονίου, αφού είχαν συγκρίνει ήδη αυτές τις περιοχές εντός των βιβλιοθηκών;

στ) Για ποιο λόγο μετά το πρώτο PCR έγινε υβριδοποίηση των βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των συγκεκριμένων αλληλουχιών;

ζ) Ερμηνεύστε για ποιο λόγο το στέλεχος B    εμφανίζει αυτή τη συμπεριφορά παρουσία γαλακτόζης.

Διαγώνισμα Βιολογίας θετικής Κατευθύνσης κεφαλαίου 4 – Τεχνολογία ανασυνδυασμένου DNA

Ζήτημα 1.                                                                                                                           Μονάδες 25

  1. Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BamHI είναι:

5′ G|GATCC 3′

3′ CCTAG|G 5′

Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BclI είναι:

 5′ T|GATCA 3′

 3′ ACTAG|T 5′

Ένα γραμμικό μόριο DNA διαθέτει μοναδική θέση αναγνώρισης BamHI και ένα άλλο μόριο επίσης γραμμικό, με την ίδια κατά τα άλλα, ακριβώς αλληλουχία διαθέτει μοναδική θέση BclI, στη θέση της BamHI. Τα δυο μόρια πέπτονται ανεξάρτητα το ένα από το άλλο με την κατάλληλη περιοριστική ενδονουκλεάση το καθένα. Τα προϊόντα της πέψης αναμιγνύονται και προστίθεται το ένζυμο DNA δεσμάση. Στο τελικό μείγμα προστίθονται και οι δυο περιοριστικές ενδονουκλεάσες BamHI και BclI.

 Δημιουργούνται:

α. 4 διαφορετικά μόρια DNA

β. 2 διαφορετικά μόρια DNA

γ.1 μόριο DNA

δ. 2 όμοια μόρια DNA

 2. Στο παραπάνω μείγμα:

α. δρουν και οι δυο περιοριστικές ενδονουκλεάσες πάντα

β. δρα μόνο η μια από τις δυο περιοριστικές ενδονουκλεάσες πάντα

γ. μπορεί να δράσει ή η μια ή άλλη περιοριστική ενδονουκλεάση

δ. μπορεί να μην δράσει καμιά από τις δυο περιοριστικές ενδονουκλεάσες.

 3. Ποια από τις παρακάτω αλληλουχίες αποτελεί πιθανή θέση αναγνώρισης κάποιας περιοριστικής ενδονουκλεάσης; (α.,β.,γ. : δίνονται δίκλωνες αλληλουχίες)

α. 5’A|CTGC3′

3’TGAC|G5′

β. 5′ T|TTAAA3′

3’AAATT|T5′

γ. 5′ G|GATCA3′

3′ CCTAG|T5′

δ. 5’G|AATTC3′

 4. Μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη:

α. Για το γονίδιο της EcoRI, β. Για το γονίδιο του tRNA της Aργινίνης των λευκοκυττάρων μας

γ. Για το οπερόνιο της λακτόζης, δ. Για το γονίδιο της αντίστροφης μεταγραφάσης του HIV.

 5. Ένας φορέας κλωνοποίησης διαθέτει εκτός από το γονίδιο ανθεκτικότητας στην καναμυκίνη (αντιβιοτικό) και το γονίδιο LeuI που κωδικοποιεί το ένζυμο το οποίο απαιτείται για την σύνθεση του αμινοξέα Λεύκινη και μπορεί να χρησιμοποιηθεί ως γονίδιο για την επιλογή των μετασχηματισμένων ξενιστών με το ανασυνδυασμένο πλασμίδιο.

Ποιο γονότυπο και ποιο φαινότυπο πρέπει να εμφανίζουν τα επιθυμητά κύτταρα ξενιστές;

α. Πριν το μετασχηματισμό ήταν LeuI- και μετά τον μετασχηματισμό αυξάνονται σε περιβάλλον δίχως Λεύκινη.

β. Πριν το μετασχηματισμό ήταν LeuI+ και μετά το μετασχηματισμό δεν αυξάνεται σε περιβάλλον δίχως Λεύκινη

γ. Μετά το μετασχηματισμό ήταν LeuI- και αυξάνεται σε περιβάλλον δίχως Λεύκινη

δ. Μετά το μετασχηματισμό ήταν LeuI+ και δεν αυξάνεται σε περιβάλλον δίχως Λευκινη

 Ζήτημα 2                                                                                                                          Μονάδες 25

  1. Διαθέτετε το γονίδιο Ψ2 και θέλετε να το ενθέσετε εντός του φορέα κλωνοποίησης Β2 οποίος διαθέτει τις εξής θέσεις περιορισμού (οι αλληλουχίες είναι δίκλωνες αλλά δίνονται μόνο ο ένας από τους δυο κλώνους).

StuI : 5′ AGG|CCT3′                                                                                            SalI: 5΄G|TCGAC3′

Ψ2:5′ TCCGGCGGAATTCCAAGGCCT[ΑΤG…κωδική περιοχή]CGTCGACTCCGGC 3′

       3′ AGGCCGCCTTAAGGTTCCGGA[TAC…κωδική περιοχή]GCAGCTGAGGCCG 5′

 Τμήμα του Β2 _________Διεύθυνσης μεταγραφής_>____StuI_____SalI____EcoRI__________͢

α. Υπάρχουν δυο διαφορετικοί τρόποι ένθεσης του γονιδίου Ψ2 (κωδική περιοχή του) στο πλασμίδιο Β2. Ποιοι είναι αυτοί (4); Ποιο/α περιοριστικό/α ένζυμο/α θα χρησιμοποιήσετε  για να πεψετε το πλασμίδιο και το γονίδιο ώστε να απομονώσετε μόνο την κωδική περιοχή του γονιδίου(2);

β. Ποιος από τους δυο αυτούς τρόπους είναι ο κατάλληλος για να είναι δυνατή η έκφραση του γονιδίου Ψ2 στο κύτταρο ξενιστή (μονάδες 2); Αιτιολογήστε την απάντηση σας (7).

2. Εξηγήστε πως θα μπορούσαμε να παράξουμε την αιμοσφαιρίνη Α, που αποτελείται από 2 α και 2 β πολυπεπτιδικές αλυσίδες, από βακτήρια με την τεχνολογία της cDNA βιβλιοθήκης (10).

 

 Ζήτημα 3                                                                                                                         Μονάδες 25

  1. Δίνεται το παρακάτω υποθετικό γονίδιο του λ φάγου που κωδικοποιεί για ένα ολιγοπεπτιδιο. Το γονίδιο αυτό θέλουμε να το κλωνοποιησουμε με σκοπό την παραγωγή του ολιγοπεπτιδίου που κωδικοποιεί σε ζυμομύκητα.

Υ ATTG…CGGAATTCAAATGCCCCAGTTCATGTΑGAATTCTAAGCGC…ATGCAGTAG…AAA     

 Y TAAC…GCCTTAAGTTTACGGGGTCAAGTACATCTTAAGATTCGCG…TACGTCATC…TTT

Για την κλωνοποιήση του συγκεκριμένου γονίδιου θα επιλέξετε μεταξύ των παρακάτω φορέων κλωνοποιήσης.

2017 inmid-01

 

Σημείωση: Η θέση περιορισμού  μπορεί να βρίσκεται ακριβώς δίπλα στον υποκινητή τόσο του ενός όσο και του άλλου πλασμίδιου, όμως σε κάθε περίπτωση πρεπει να λειτουργεί ως θέση αναγνώρισης της EcoRI.

Στο πλασμίδιο 1, ο εσωτερικός μητρικός κλώνος όταν αντιγράφεται στη διχάλα που εξελίσσεται προς τα αριστερά, ο νεοσυντιθέμενος συμπληρωματικός κλώνος του, συντίθεται συνεχώς.

Στο πλασμίδιο 2, ο αντίστοιχος μητρικός κλώνος, στη διχάλα που εξελίσσεται προς τα δεξιά, ο νεοσυντιθέμενος συμπληρωματικός κλώνος του συντίθεται συνεχώς.

Α. Ποια είναι κωδική και ποια μη κωδική αλυσίδα του γονιδίου του λ-φάγου (6);

Β. Ποιο ολιγοπεπτίδιο κωδικοποιεί αυτό το γονίδιο (4);

Γ. Ποιο από τα πλασμιδια θα χρησιμοποιήσετε για την κλωνοποιήση του γονιδίου (1) και αιτιολογήστε την απάντηση σας (6).

Δ. Μετά την επιτυχή έκφραση του γονιδίου στα κύτταρα ξενιστές απομονώθηκαν δυο διαφορετικά ολιγοπεπτίδια που παράγονται από τα μετασχηματισμένα κύτταρα ζυμών με τα ανασυνδυασμενα πλασμιδια. Τα δυο αυτά ολιγοπεπτιδια παράγονται από διαφορετικά μετασχηματισμένα μυκητιακα κύτταρα. Δηλαδή το ίδιο κύτταρο δεν παράγει και τα δυο ολιγοπεπτιδια. Και τα δυο είναι προϊόντα έκφρασης του ετερολογου γονιδίου που ανασυνδυάστηκε με τον φορέα κλωνοποιήσης.

Εξηγήστε το φαινόμενο (5).

Ε. Είναι δυνατόν το κύτταρο ζύμης ξενιστής να παράγει το λειτουργικό ολιγοπεπιδιο του λ-φαγου δεδομένου ότι ο λ-φαγος προσβάλει βακτηρία (3);

 

Ζήτημα 4                                                                                                                          Μοναδες 25

Δίνεται η παρακάτω αλληλουχία του γονιδίου Φ1 (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) που κωδικοποιεί για το ένζυμο του βακτηρίου Lactobacillus arabinosus που σχηματίζει την βιταμίνη Β9 (φολικό οξύ).

Από την γονιδιωματική βιβλιοθήκη του βακτηρίου απομονώθηκε το γονίδιο Φ1 με στόχο την εισαγωγή του σε κατάλληλο φορέα κλωνοποίησης που θα μετασχηματίσει κύτταρα ζυμών αρτοποιίας ώστε να εμπλουτίζεται το ψωμί με φολικό οξύ.

Στο δοθέν γονίδιο δεν περιλαμβάνεται η αλληλουχία του υποκινητή του. Υποδεικνύονται τα κωδικόνια έναρξης και λήξης του Φ1 και εντός των 1500 ζ. β. που παρεμβάλλονται μεταξύ των κωδικονίων έναρξης και λήξης δεν υπάρχουν θέσεις αναγνώρισης των περιοριστικών ενζύμων: XbaI (5′TCTAGA3′ ), SacI (5′GAGCTC3′ ), BamHI (5′GGATCC3′), BglI(5′AGATCT3′), NdeI(.5′CATATG 3′ )

5′ GTCTAGAAGAGCTCCTTGGATCCAAAGATCTACCATATGTCTCGCCTA   1500 συνέχεια του γονιδιου

5’GTCTAGAAGAGCTCTGGATCCAAGATCTACCATATGTAAGCG3′

Δίνεται επίσης ο φορέας κλωνοποίησης που θα χρησιμοποιηθεί για την κλωνοποίηση του γονιδίου Φ1 στη ζύμη αρτοποιίας. Δίνεται ακόμη η αλληλουχία του φορέα κλωνοποίησης (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) από τη θέση BglI μέχρι τη θέση SacI, όπου περιλαμβάνεται και ο υποκινητής που θα είναι υπεύθυνος για τη μεταγραφή του γονιδίου Φ1.

Τμήμα του φορέα κλωνοποίησης:

__________Διεύθυνση μεταγραφής>___XbaI__NdeI___BamHI___SacI_____________________

 

Υποκινητής

———————->

5′AGATCTCGATCCCCCGAAATTAATACGACTCACTATACGGGAATTGTCACCGCATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATCGAGCTCCGTCGAC3′

NH2-MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluSerSerSerValAsp-COOH

Σημείωση: Τα έντονα γράμματα αποτελούν τον υποκινητή του γονιδίου στον πλασμιδιακό φορέα κλωνοποίησης και το κωδικόνιο έναρξης αυτού του γονιδίου αναφοράς στον φορέα κλωνοποίησης, είναι μέσα στη θέση αναγνώρισης της NdeI.

α. Για την έκφραση του γονιδίου Φ1 στη ζύμη, ποιες πρωτεΐνες και από ποιον οργανισμό θα πρέπει να συνδεθούν με τον υποκινητή του φορέα κλωνοποίησης που θα χρησιμοποιηθεί;

Μονάδες 8

β. Αν υποθέσουμε ότι τα επιπλέον αμινοξέα στο αμινοτελικό άκρο της πρωτεΐνης που κωδικοποιείται από το Φ1 γονίδιο δεν επηρεάζουν την λειτουργικότητα της απαντήστε στις παρακάτω ερωτήσεις:

  1. I) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με πέψη με BamHI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματίστικε με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

ΙΙ) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με με πέψη με το ένζυμο SacI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματίστικε με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

Μονάδες  4Χ4=16

 

 

 

 

Επαναληπτικό Διαγώνισμα Βιολογίας Θετικού Προσανατολισμού κεφαλαίων 1,2,4 &7

Ζήτημα 1.

Α. Επιλέξτε την ορθή απάντηση:

  1. κατά την μεταγραφη των γονιδιων του οπερονιου της λακτοζης δημιουργουνται…………………. mRNA

Α. 1, β. 2, γ. 3, δ.4                                                                     (5 μονάδες)

  1. Από τα ………διαφορετικα κωδικονια , …………κωδικοποιουν αμινοξεα και ………οδηγουν στον τερματισμο της πρωτεινοσυνθεσης.

Α. 180, 20, 4 β. 20, 17, 3 γ. 20, 17, 4, δ. 64, 61, 3                                     (5 μοναδες)

  1. Ερωτήσεις Σωστού – Λάθους:

Α. Για να κατασκευστει μια cDNA βιβλιοθηκη απομονωνεται το ολικο mRNA από κυτταρα που εκφραζουν το γονιδιο που θελουμε να μελετησουμε.

Β. Η μεταβολή του πληθυσμού σε συνάρτηση με τον χρόνο μιας συνεχούς καλλιέργειας φυσιολογικών κυττάρων E.coli, που τροφοδοτείται με θρεπτικο υλικό το οποιο, περιέχει ως πηγη C γλυκόζη και λακτόζη σε ίσες αναλογίες, εμφανίζει καμπύλη διαύξησης.

Γ. Στην αντιγραφή του βακτηριακου DNA συμμετέχουν δυο DNA πολυμερασες.

Δ. Ένα φυσιολογικο ανθρωπινο σωματικο κυτταρο εχει στον πυρηνα του 24* 10^9 βασεις κατά την μεταφαση της μιτωσης του.

Ε. Κατά την πεψη ενός κυκλικου μοριου DNA από την EcoRI, ανά θεση περιορισμού, σπαζουν περισσοτεροι φωσφοδιεστερικοί δεσμοι, από ότι ενός γραμμικου μοριου DNA, με τον ίδιο αριθμό θραυσμάτων.

Δινεται ότι το κάθε μοριο διαθετει 4 θεσεις αναγνωρισης της EcoRI.                (15 μοναδες)

Ζητημα 2

Α. Γιατι τα κυτταρα ενός πολυκυτταρου οργανισμου, παροτι εχουν όλα τα ιδια γονιδια  διαφερουν στην μορφη και την λειτουργια τους; (5 μοναδες)

Β. Ένα διπλοειδες κυτταρο υφισταται μιτωση και στη συνεχεια  τα θυγατρικα κυτταρα υφιστανται μειωση.

Σχεδιαστε ένα κοινό διαγραμμα, οπου θα φαινονται οι μεταβολες της ποσοτητας του γενετικου υλικου του ενός κυτταρου, σε σχεση με το χρονο.

Αιτιολογηστε την απαντηση σας.

Δινεται ότι το γενετικο υλικο του πυρηνα του κυτταρου, κατά την μεταφαση της μιτωσης του, εχει μηκος 4* 10 8 ζευγη βασεων. (10 μοναδες)

Γ. Στο παρακατω σχημα φαινεται η διχαλα αντιγραφης ενός πλασμιδιου. Αφου μεταφερετε το σχημα στο τετραδιο σας, συμπληρωστε τον προσανατολισμο των αλυσιδων στα ακρα της διχαλας, καθως και τον προσανατολισμο της αντιγραφης σε κάθε αλυσιδα. Τελος, να χαρακτηρισετε τον τροπο συνθεσης των νεων αλυσιδων του DNA.

2017 Επαναλληπτικό 1 2 4 7-01

Αιτιολογηστε συντομα την απαντηση σας.  (2+2+2+4 = 10 μοναδες)

Ζητημα 3

Μια συνεχης καλλιεργεια βακτηριων E. coli, περιέχει εξ’αρχης, δυο διαφορετικά στελεχη βακτηριων. Τα βακτηρια που ανηκουν στο ένα στέλεχος, διαθετουν ένα πλασμίδιο, το οποιο περιέχει, ένα γονιδιο ανθεκτηκοτητας στο αντιβιοτικο καναμυκινη.

Τα βακτηρια που ανηκουν στο άλλο στέλεχος, διαθετουν ένα διαφορετικό πλασμιδιο, που φερει ένα διαφορετικο γονιδιο ανθεκτικοτητας στην καναμυκινη (το οποιο κωδικοποιει την ιδια πρωτεινη, με το γονιδιο ανθεκτικοτητας του πρωτου πλαδμιδιου), καθώς και ένα γονιδιο ανθεκτικοτητας στην πενικιλινη.

Τα βακτηρια  της καλλιεργειας αναπτυσονται σε ζυμωτηρα, στον οποιο προσθετουμε την χρονικη στιγμη t1 χ ποσοτητα καναμυκινης, την στιγμη t2 y/2 ποσοτητα πενικιλινης και την στιγμη t3 y ποσοτητα πενικιλινης.

Το ακόλουθο διαγραμμα, δειχνει τις μεταβολες στον πληθυσμο των μικροοργανισμων σε σχεση με τον χρονο.

2017 Επαναλληπτικό 1 2 4 7-02

Α. Να εξηγησετε γιατι, παροτι και τα δυο στελεχη διαθετουν ένα γονιδιο ανθεκτικοτητας στην καναμυκινη, μετα την προσθηκη του αντιβιοτικου στο θρεπτικο υλικο την χρονικη στιγμη t1, παρουσιαζεται μερικη μειωση του πληθυσμου των βακτηριων. Ποιο στέλεχος διαθέτει μεγαλύτερη ανθεκτικότητα στην Καναμυκινη1; (4+1 μοναδες)

Β. Να χαρακτηρισετε κάθε φαση της καλλιέργειας, όπως εμφανιζεται στο διαγραμμα και να αιτιολογησετε την απαντηση σας. (5 μοναδες)

Γ. Να εξηγησετε γιατι τα βακτηρια της καλλιεργειας «αντιδρούν», διαφορετικα αναμεσα στις δυο περιπτωσεις προσθηκης πενικιλινης.(5 μοναδες)

Δ. Σε μια νεα δημιουργια της καλλιεργειας, προσθετουμε μικροτερες ποσοτητες καναμυκινης και πενικιλινης σε σχεση με τις αρχικες. Πιστεύετε, ότι αυτό θα επηρεασει τον ρυθμο αναπτυξης των βακτηριων της καλλιεργειας; Να αιτιολογησετε την απαντηση σας. Σχεδιαστε το νέο πιθανο διαγραμμα του ρυθμου αναπτυξης των βακτηριων, συμφωνα με την απαντηση σας.

Υποθεστε ότι οι προσθηκες των αντιβιοτικων εγιναν στις ιδιες αντιστοιχες στιγμες όπως φαινονται στο διαγραμμα που σας δοθηκε. (2+3+5=10)

Ζητημα 4

Τρια δειγματα πλασμιδιακου DNA, πεπτονται με διάφορες περιοριστικες ενδονουκλεασες και στη συνεχεια αναλυονται σε πηκτωμα αγαροζης. Τα αποτελεσματα είναι αυτά που φαινονται στις εικονες. Γνωριζετε ότι κανενα πλασμιδιο δεν εχει δυο ιδιες θεσεις αναγνωρισης. Επίσης, είναι γνωστό, ότι το πλασμιδιο 1  εχει μηκος 20.000 ζευγη βασεων, το πλασμιδιο 2 εχει μηκος 15.000 ζευγη βασεων  και το πλασμιδιο 3 εχει μηκος 10.000 ζευγη βασεων.

2017 Επαναλληπτικό 1 2 4 7-03

2017 Επαναλληπτικό 1 2 4 7-04

Σημείωση: Στο τρίτο πήκτωμα αγαροζης, με την σειρά  που δίνονται, στο πρώτο πλασμίδιο, η ζώνη στα 10.000 ζεύγη νουκλεοτιδιων, είναι διπλάσια σε πάχος από όλες τις  υπόλοιπες των τεσσάρων πηκτωματων αγαροζης.

Α. Σχεδιαστε τον περιοριστικο χαρτη καθε πλασμιδιου (για το πλασμιδιο 1 αρκει μια εκδοχη). Δεν απαιτηται αιτιολογηση. (6 μοναδες).

Β. Δινεται η αλληλουχια ενός  υποθετικου γονιδιου του πλασμιδιου 2, που κωδικοποιει τη συνθεση μιας πρωτεινης.

Αλυσιδα1. …TCGACGGGTACGCTATGCGCCGTTTTGTAAAAACGAGGACTTTG…

Αλυσιδα 2….ΑGCTGCCCATGCGATACGCGGCAAAACATTTTTGCTCCTGAAAC…

Η υπογραμμιση δηλωνει την 5΄αμεταφραστη περιοχη .

  1. ποια αλυσιδα είναι η κωδικη και ποια η μη κωδικη και σημειωστε τα 5΄και 3΄ακρα της κάθε αλυσιδας. Αιτιολογηστε την απαντηση σας. (μονάδες 2 + 4).
  2. Ο υποκινητης του παραπανω γονιδιου αποτελειται από 120 βασεις. Από αυτές, το 15% είναι αδενινες. Να βρειτε τα ποσοστα και τους αριθμους των υπολοιπων. (μοναδες 3).

Γ. Δινεται το ακόλουθο γονιδιο, το οποιο κωδικοποιει τη συνθεση μιας πρωτεινης του ανθρωπου:

5’ AGCGAATTCGCTCTGCAG…GGATCC…GCTAT…ATG…GAATTC…TAGCTGCAG…GGATCC3’

3’ TCGCTTAAGCGAGACGTC…CCTAGG…CGATA…TAC…CTTAAG…ATCGACGTC…CCTAGG5’

3’ ΑΜΕΤΑΦΡΑΣΤΗ ΑΛΜ

Οπου ΑΛΜ= Αλληλουχιες ληξης της Μεταγραφης. Οι ΑΛΜ βρισκονται στις αλληλουχίες που ακολουθουν αμεσως μετα την 3′ αμεταφραστη περιοχη του δοθεντος γονιδιου. Η αλληλουχία του υποκινητή, είναι η υπογραμμισμένη στα αριστερά αλληλουχία του γονιδίου που δίνεται.

Να προσδιορισετε ποια/ποιες περιοριστικη/ες ενδονουκλεαση/ες μπορει/ουν να χρησιμοποιηθει/ουν για την πεψη του γονιδιου, ώστε στη συνεχεια να ενθεθει ακεραιο σε καποιο από τα πλασμιδια του προηγούμενου ερωτήματος και να μπορει να εκφραζεται επιτυχως. Να αιτιολογηθει η απαντηση σας.

Δ. Να προσδιορισετε ποιο/α πλασμιδιο/α θα μπορουσε/αν να χρησιμοποιηθει/ουν ως φορεας/εις κλωνοποιησης για το γονιδιο του προηγουμενου ερωτηματος, με βαση την απαντηση σας στο προηγουμενο ερωτημα. Να εξηγησετε επισης ποιες άλλες προυποθεσεις θα πρεπει να πληροι/ουν αυτό/α το/τα πλασμιδιο/α ώστε να μπορει να χρησιμοποιηθει επιτυχως ως φορεας κλωνοποιησης.

(μοναδες 2+4=6)

Δίνονται:

Θέση αναγνώρισης της PstI……………… Θέση αναγνώρισης της BamHI

5’ CTGCAG3’…………………………………………………………5’GGATCC3’

3’ GACGTC5’ …………………………………………………………3’CCTAGG5’

 

Δημιουργημένο απο την α’ φοιτήτρια της Ιατρικής Κωνσταντίνα Ραουζαίου

Ένα σχόλιο για τη δυσκολία των θεμάτων των πανελληνίων εξετάσεων

Τα τελευταία χρόνια το Υπουργείο Παιδείας δημοσιεύει αναλυτικότερα στοιχεία για τις βαθμολογίες των υποψηφίων, τα οποία μας δίνουν τη δυνατότητα να αξιολογήσουμε τα θέματα των εξετάσεων και την καταλληλόλητά τους στον διαχωρισμό των υποψηφίων σε καλούς, πολύ καλούς και άριστους. Παραθέτουμε παρακάτω μια διαγραμματική απεικόνιση των κατανομών των βαθμολογιών των μαθητών για 5 βασικά μαθήματα, απαραίτητα για την εισαγωγή σε σχολές υψηλής ζήτησης για τα έτη 2016 και 2017.

Βαθμολογίες ανά μάθημα

Η Χημεία και η Φυσική είναι δύο μαθήματα στα οποία οι θεματοδότες αποτυγχάνουν θεαματικά να διαχωρίσουν τους άριστους από τους απλώς καλούς υποψηφίους. Και στα δύο μαθήματα παρουσιάζεται μια αριστερή ασσυμετρία στην κατανομή των βαθμολογιών, πράγμα που πρακτικά σημαίνει ότι μεγάλος αριθμός υποψηφίων γράφουν άριστα ή κάτι πολύ κοντά σε αυτό. Στη Χημεία συγκεκριμένα βλέπουμε ότι ιδιαίτερα το 2016, περίπου το 23% των υποψηφίων έγραψε 19-20. Το ίδιο πρόβλημα παρουσιάζεται, σε μικρότερο και με τα θέματα του 2017, καθώς και με τη Φυσική. Παρόμοιο πρόβλημα παρουσιάζεται και στη Βιολογία, αν και σε μικρότερη κλίμακα. Εδώ αξίζει να σταθούμε λίγο παραπάνω στη Φυσική, ένα παραδοσιακά δύσκολο μάθημα, στο οποίο όμως τα τελευταία δύο χρόνια «έπεσαν» εύκολα θέματα με αποτέλεσμα τη συσσώρευση αριστούχων στην κορυφή ακόμα και εκεί.

Η έκθεση από την άλλη πλευρά είναι ένα ιδιόμορφο μάθημα, στο οποίο από ότι φαίνεται είναι σχετικά εφικτό για έναν μαθητή να γράψει ανάμεσα στο 13-17, ενώ μόνο ένα πολύ μικρό ποσοστό των μαθητών καταφέρνει να αριστεύσει.

Η ιδανική κατανομή βαθμολογιών παρουσιάζεται στα μαθηματικά, όπου παρουσιάζεται μια δεξιά ασσυμετρία. Οι άριστοι μαθητές είναι λίγοι, αλλά όχι μηδαμινοί, όπως στην έκθεση και όσο χαμηλώνει ο βαθμός, τόσο αυξάνονται οι μαθητές που τον επιτυγχάνουν. Αυτό μπορεί να λογιστεί ως επιτυχία των θεματοδοτών στα μαθηματικά, οι οποίοι έχουν ελαχιστοποιήσει τα θέματα θεωρίας, άρα και την αποστήθιση, και κλιμακώνουν ορθά τη δυσκολία των θεμάτων τους, έτσι ώστε να επιτυγχάνεται η διάκριση των καλών, των πολύ καλών και των αρίστων υποψηφίων.

Οι θεματοδότες των υπόλοιπων μαθημάτων μπορούν να διδαχθούν πολλά από τους συναδέλφους τους των μαθηματικών. Πρωτότυπες ασκήσεις υπάρχουν πλέον και σε μαθήματα όπως η βιολογία, τα οποία παλαιότερα οι μαθητές αποστήθιζαν. Δε δικαιούμαστε να αδικούμε τους άριστους συνωστίζοντάς τους μαζί με ένα σημαντικό ποσοστό καλών απλώς υποψηφίων, οι οποίοι αριστεύουν λόγω των εύκολων θεμάτων στα περισσότερα μαθήματα.

 

Γιώργος Καρακατσάνης

Οικονομολόγος

Διαγώνισμα Κεφάλαιο 6 Μεταλλάξεις Βιολογία Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

 Επιλέξτε την ορθή απάντηση:

  1. Πόσα αντίγραφα του γονίδιου των αλυσίδων δ διαθέτουμε φυσιολογικά στα χρωμοσώματα μας, σε ένα ευθροκύτταρο μας, που κυκλοφορεί στο αίμα μας:

α. 2 β. 4   γ. 6  δ. 12  ε.0

  1. Ένα ενήλικο ετερόζυγο άτομο με γονότυπο ββς έχει τις εξής αιμοσφαιρίνες:

α. HbA, HbS, HbF, HbA2

β. HbA, HbS, HbF, HbA2 και μπορει και HbAS

γ. HbA, HbS

δ. HbS, HbF

ε. HbA, HbS, HbA2

  1. Έμβρυο 18 εβδομάδων με γονότυπο ββς διαθέτει τις εξής πολυπεπτιδικές αλυσίδες για τις αιμοσφαιρίνες του.

α. α,β,γ,βς

β. α,γ,δ

γ. α,γ

δ. α,β,δ

ε. β,δ,γ

  1. Ένα άτομο με σύνδρομο Klinefelter, διαθέτει:

α. Φυσιολογικό πλήθος αλληλομόρφων γονίδιων.

β. Διπλάσιο πλήθος όλων των γονίδιων που εδράζουν στα φυλετικά χρωμοσώματα

γ. Δυο αντίγραφα για κάθε αυτοσωμικό γονίδιο, δυο αντίγραφα για το γονίδιο της αιμοροφίλιας και τρία αντίγραφα για κάθε γονίδιο που εδράζεται στην ομόλογη περιοχή των φυλετικών χρωμοσωμάτων.

δ. Τέσσερα γονίδια α, δυο γονίδια β, δυο γονίδια γ, δυο γονίδια δ στην φάση G1 του κυτταρικού κύκλου.

ε. Υψηλά επίπεδα HbF εάν έχει γονότυπο ομόζυγο για το γονίδιο βς και εμφανίζει ανθεκτικότητα στην προσβολή από το πλασμώδιο.

  1. Άτομο με γονότυπο ααααββςγγδδ, διαθέτει:

α. HbA 100%

β. HbS 100%

γ. ΗbS & HbA σε αναλογία 1:1

δ. Σε συνθήκες έλλειψης οξυγόνου όλα τα κύτταρα των ερυθρών αιμοσφαιρίων δρεπανώνονται.

ε. Οι δυο νόμοι του Μέντελ, ισχύουν για το σύνολο των αναφερόμενων γονίδιων.

Ζήτημα 2ο                                                                                   Μονάδες 25

  1. Μια γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που πραγματοποιήθηκε διαπιστώθηκε ότι διαθέτει 45 χρωμοσώματα καθώς απουσίαζε ένα φυλετικό χρωμόσωμα και διέθετε μόνο ένα Χ φυλετικό, ενώ εμφανίζει και φαινοτυπικά χαρακτηριστικά συνδρόμου Down.

α. Τι είδους μεταλλάξεις φέρει το έμβρυο; (2)

β. Ποιος από τους δυο γονείς μπορεί να ευθύνεται για το σύνδρομο τις μονοσωμίας; Με ποιο τρόπο μπορεί να προέκυψε ο μεταλλαγμένος γαμέτης; (1 + 5)

γ. Το έμβρυο εμφανίζει μειωμένα επίπεδα αιμοσφαιρινών. Δώστε μια πιθανή εξήγηση για την εμφάνιση του φαινομένου Down και των μειωμένων επιπέδων των αιμοσφαιρινών  στο έμβρυο. (7)

2. Ποιες μεταλλάξεις χαρακτηρίζονται ως διπλασιασμός; Αναφέρετε τρία παραδείγματα γονίδιων που ο διπλασιασμός αποτέλεσε στην μια περίπτωση θετικής μετάλλαξης και στις άλλες περιπτώσεις αρνητική μετάλλαξη. (2+3)

  1. Συγκρίνετε τους μηχανισμούς προστασίας από τις μεταλλάξεις μεταξύ των προκαρυωτικών και των ευκαρυωτικών κυττάρων. (5)

Ζήτημα 3ο                                                                                                                  Μονάδες 25

  1. Δίνεται η παρακάτω μεταλλαγμένη αλληλουχία της κωδικής αλυσίδας του γονιδίου β, των αλυσίδων β των αιμοσφαιρινών μας (αλληλόμορφο Const. Christine). Στην αλληλουχία των 95 νουκλεοτιδίων που δίνεται δεν εμφανίζεται κωδικόνιο λήξης, ούτε κάποιο εσώνιο.

GGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTGTTGGG…95 ΝΟΥΚΛΕΟΤΙΔΙΑ…ΑTGTTTAGTGATGGCCTGGCTGATCACCTGGA 3′

α. Σύμφωνα με τον γενετικό κώδικα, ποιο κωδικόνιο και ποιο αμινοξύ βρίσκεται και κωδικοποιείται  αντιστοίχως, ακριβώς μπροστά από τα 95 νουκλοτιδια; (3)

β. Προσδιορίστε την θέση του υποκινητή του μεταλλαγμένου γονιδίου β. (1) και γράψτε στο τετράδιο σας τις αλληλουχίες του γονιδίου που είναι εξονικες, αλλά δεν συνδέεται μαζί τους το ριβοσωμα. (2).

γ. Αυτό το μεταλλαγμένο αλληλόμορφο, φέρει μια σημειακή μετάλλαξη αντικατάστασης βάσης, σε σχέση με το αλληλόμορφο βς. Ποια είναι αυτή η αλλαγή; Ποιο αμινοξύ κωδικοποιείται ; (3)

δ. Προσδιορίστε το αμινοξύ που κωδικοποιείται από το κωδικόνιο που ακολουθεί την αλληλουχία των 95 νουκλεοτιδίων. (3)

2.

α. Σε ένα άτομο εληφθησαν δείγματα μυϊκού ιστού και πραγματοποιήθηκε καρυότυπος. Τα αποτελέσματα έδειξαν τρεις διαφορετικούς καρυοτύπους, σε τρία διαφορετικά κύτταρα του.

α. ΧΟ+44  β. ΧΥ+44    γ. ΧΥΥY+44.

Εξηγήστε πως είναι δυνατόν να υπάρξει τέτοιο άτομο. (7)

β. Σε ένα άτομο με γονότυπο βςβς, επιχειρήθηκε η ένθεση, με την βοήθεια κατάλληλου ιού φορέα, του φυσιολογικού γονιδίου β, στο γονιδίωμα των αιμοποιητικων κυττάρων του. Ποιος θα είναι ο φαινότυπος του ατόμου αυτού,

 

ως προς την δρεπανοκυτταρικη αναιμία, μετά την ένθεση του φυσιολογικού γονιδίου β, στο γονιδίωμα των αιμοποιητικων κυττάρων του (2); Αιτιολογήστε την απάντηση σας. (4)

 

 

Ζήτημα 4ο                                  Μονάδες 25

 

Α. Δίνεται το παρακάτω γενεαλογικό δένδρο:

2017 Κεφάλαιο 6 Μεταλλάξεις blog-01

 

Το ζευγάρι ΙΙΙ1 x ΙΙΙ2 απέκτησε τρία παιδία, τα οποία: Το πρώτο εμφανίζει ελαφριάς μορφής αναιμίας, το δεύτερο παιδί βαριά μορφή β-θαλασσαιμία και μικρό ποσοστό δρεπανοκυττάρων κατά τη δοκιμασία δρεπάνωσης, ενώ εμφανίζει και υψηλή συγκέντρωση HbF και τέλος το τρίτο παιδί  εμφάνισε στους πρώτους μήνες της ζωής του πολύ βαριά μορφής αναιμία, ενώ στις κυτταρολογικές εξετάσεις εμφανίστηκαν πολύ υψηλού επιπέδου ποσοστά δρεπανοκυττάρων.

Έγιναν μοριακές εξετάσεις τόσο για την β-θαλασσαιμία όσο και για την δρεπανοκυτταρική αναιμία. Τα αποτελέσματα φαίνονται στα παρακάτω πηκτώματα αγαρόζης.

Η απόσταση της θέσης  περιορισμού NhdI από την θέση περιορισμού MstII, είναι 20 ζεύγη βάσεων το οποίο δεν αποδίδεται στο σχήμα.

2017 Κεφάλαιο 6 Μεταλλάξεις blog-02

 

Οι μοριακές εξετάσεις έγιναν για το γονίδιο της δρεπανοκκυτταρικής αναιμίας. Χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση MstII, η οποία κόβει το παθολογικό αλληλόμορφο.

Για την β θαλασσαιμία χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση  NhdI, η οποία πέπτει το φυσιολογικό αλληλόμορφο εντός της 5’ αμετάφραστης περιοχής του γονίδιου και αφήνει ανέπαφο το παθολογικό αλληλόμορφο. Η επιλογή της NhdI, έγινε δεδομένου ότι το άτομο ΙΙ1 έπασχε από πολύ βαριά μορφή β-θαλασσαιμίας και είχαν ελεγχθεί σε προγενέστερο μοριακό έλεγχο, τα υπεύθυνα  γονίδια του. Κανένα άτομο της γενεαλογίας δεν εμφάνισε α-θαλασσαιμία.

1. Με βάση τα αποτελέσματα του μοριακού έλεγχου προσδιορίστε τους γονότυπους των ατόμων του δένδρου που ελέγχθηκαν με μοριακές εξετάσεις ως προς την HbA. (5)

  1. Προσδιορίστε την πιθανότητα εμφάνισης που είχε το άτομο IV2. (3)

3. Εξηγήστε πως μπορεί να προέκυψε το άτομο IV3, τι είδους μεταλλάξεις συνέβησαν.(4)

4. Προσδιορίστε τον γονότυπο των ατόμων ΙΙΙ1 και ΙΙΙ2 ως προς τα γονίδια των αιμοσφαιρίνων  HbA2, HbF. Γνωρίζετε ότι το άτομο IV1 εμφανίζει ελαφριά μορφή αναιμίας, παρόλο που είναι ετερόζυγο, επειδή σε περαιτέρω βιοχημικές αναλύσεις διαπιστώθηκε ότι δεν ανιχνεύεται HbA2. (2)

5. Ποιο θα είναι το πρότυπο των ζωνών του γονίδιου βς στο πήκτωμα αγαρόζης, όταν αυτό πέπτεται ταυτοχρόνως με τις περιοριστικές ενδονουκλεάσες MstII & NhdI ;(3)

6. Γνωρίζουμε ότι τα ώριμα ερυθρά αιμοσφαίρια δεν διαθέτουν πυρήνα, διαθέτουν όμως ριβοσωμάτα. Είναι τα ώριμα ερυθρά αιμοσφαίρια ζωντανά κύτταρα; (3)

Β. Παρακάτω δίνεται τμήμα του 1ου εξωνίου του γονιδίου για τη β-αλυσίδα της αιμοσφαιρίνης HbA. Κάθε τμήμα προέρχεται από διαφορετικό αλληλόμορφο.

Γονίδιο βi

AGGCTTATGGTGCACCTTACGCCAGAGGAG

TCCGAATTACCACGTGGAATGCGGTCTCCTC

Γονίδιο βii

AGGCTTATGGTGCACCTTACGCCAGTGGAG

TCCGAATACCACGTGGAATGCGGTCACCTC

Γονίδιο βiii

AGGCTTATGGTGCACCTTACGCCAGTAGGAG

TCCGAATACCACGTGGAATGCGGTCATCCTC

Γονίδιο βiv

AGGCTTATCGGTGCACCTTACGCCAGAGGAG

TCCGAATAGCCACGTGGAATGCGGTCTCCTC

Να βρεθεί το είδος της γονιδιακής μετάλλαξης για τα  παθολογικά αλληλόμορφα γονίδια.

Ποιό είναι το γονίδιο βς ; (4+1)

Διαγώνισμα βιολογίας θετικού προσανατολισμού. Κεφάλαια: 1-2-4-7

Ζήτημα 1.                                                                                                   Μονάδες 25

  1. Δίνεται το παρακάτω σχήμα που αναπαριστά ένα χρωμόσωμα.

 

Επαναληπτικό 1-2-4-7-01

Το τμήμα Α θέλουμε να κλωνοποιηθεί in vitro.  Η αντιγραφή τελειώνει κάθε φορά στο τέλος του μητρικού κλώνου που λειτουργεί ως καλούπι.

Μετά από πόσους κύκλους αντιγραφής θα υπάρχει στον δοκιμαστικό σωλήνα για πρώτη φορά το επιθυμητό τμήμα Α.

α. Νo x 2κ

β. 2κ

γ. κ

δ.2

ε. 3

  1. Το τμήμα Α αποτελεί γονίδιο. Το προϊόν της μεταγραφής διαθέτει 70% πουρίνες, από αυτές το 30% δημιουργεί δυο δεσμούς υδρογόνου σε δίκλωνο μόριο. Γνωρίζετε ακόμη ότι η πουρίνη που σχηματίζει δυο δεσμούς υδρογόνου και συμμετέχει στο μεταγράψιμο τμήμα, του γονιδίου Α στην μη κωδική αλυσίδα, αποτελεί το 20% του κλώνου αυτού, στο γονίδιο Α.

Ο λόγος A+T/G+C του γονιδίου Α είναι (στον μη κωδικό κλώνο) στο τμήμα που αντιπροσωπεύεται στο προϊόν της μεταγραφής, μετά την ολοκλήρωση της διαδικασίας.

α. περίπου 7/3

β.1

γ. περίπου ½

δ. περίπου 2/3

ε. Δεν υπολογίζεται

  1. Για την μεταγραφή αυτού του γονιδίου απαιτήθηκε να ξετυλιχθούν 14 νουκλεοσώματα, στα οποία συμπεριλαμβάνονται και εκείνα στα σημεία Μ και Ν, που φαίνονται στην εικόνα 1. Το μήκος του RNA που παράχθηκε αποτελείται από 2746 νουκλεοτίδια. Το χρωμόσωμα έχει μήκος 2 χ 106 ζ.β. και ξεκινάει και τελειώνει με νουκλεόσωμα.  Ποιο είναι το πλήθος των ιστόνων που απαιτούνται για το πακετάρισμα του;

α.  περίπου 2 χ 104

β. περίπου 16 χ 104

γ. περίπου 8 χ 104

δ. 32 χ 104

ε. περίπου 106

  1. Το μεταφράσιμο τμήμα του γονιδίου Α αποτελείται από 600 κωδικόνια. Η 5’ αμετάφραστη περιοχή του, προκαλεί τη δημιουργία συμπλόκου έναρξης με τέτοιο ρυθμό ώστε το αμέσως προηγούμενο ριβόσωμα να έχει ήδη μεταφράσει 10 κωδικόνια μέχρι να συνδεθεί το επόμενο μόριο tRNA σε αυτό . Πόσα   πλήρη ριβοσώματα θα αποτελούν το πολύσωμα του mRNA του γονιδίου Α όταν το πρώτο ριβόσωμα έχει ολοκληρώσει την πολυπεπτιδική αλυσίδα;

α. 60

β.65

γ. 66

δ. 59

ε. 66,6

  1. Η θέση Ε που φαίνεται στο σχήμα έχει την αλληλουχία:

5’ ——————–GGAATTCC——————-3’

3’———————CCTTAAGG——————5’

Α. Υπάρχει η περιοριστική ενδονουλεάση MdI, η οποία αναγνωρίζει την παραπάνω αλληλουχία οκτώ νουκλεοτιδίων και πέμπτει τους φωσφοδιεστερικούς δεσμούς 5’-G-G-3’ καθώς και τους 14 δεσμούς υδρογόνου μεταξύ των παρεμβαλλόμενων ζευγών βάσεων. Πάσα διαφορετικά τμήματα που περιέχουν το γονίδιο Α προκύπτουν μετά την πέψη του χρωμοσώματος με τα ένζυμα EcoRI και MdI, ταυτόχρονα;

α. 1

β.2

γ. 3

δ. 4

ε. Κανένα.

Β. Το διπλανό πλασμίδιο χρησιμοποιήθηκε ως φορέας κλωνοποίησης του τμήματος Α. Πόσα διαφορετικά ανασυνδυασμένα πλασμίδια μπορούν να προκύψουν;

Δίνεται ο φορέας κλωνοποίησης  που θα χρησιμοποιηθεί.

Επαναληπτικό 1-2-4-7-02

 

α. 1

β. 2

γ. 3

δ.4

ε. Κανένα.

Ζήτημα 2.                                                                                           Μονάδες 25

  1. Να αναφέρετε τους λόγους για τους οποίους το βακτήριο Ε. coli χρησιμοποιείται ως οργανισμός μοντέλο της Μοριακής Βιολογίας. (μόρια 4)
  2. Εξηγήστε για ποιο λόγο προσθέτουμε αζωτούχες και φωσφορικές ενώσεις στις πετρελαιοκηλίδες που πρόκειται να «καθαριστούν» με την δράση μικροοργανισμών οι οποίοι μεταβολίζουν το πετρέλαιο.  (μόρια 5)
  3. Κατατάξτε τα γονίδια των οργανισμών ως προς τη θέση τους στο κύτταρο και ως προς τη θέση του γενετικού τους τόπου. (μόρια 5)
  4. Στην εικόνα 1 φαίνεται ένα μέρος μιας βιολογικής διαδικασίας που βρίσκεται σε εξέλιξη.

CUCUUTCT

GAGAAACATGCATACGAC                    Εικόνα 1

α. Να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας.               (μόρια 2)

β. Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1. (μόρια 3)

γ. Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού.              (μόρια 1)

  1. Τα παρακάτω βήματα περιγράφουν μια εργαστηριακή καλλιέργεια μικροοργανισμών. Να τοποθετήσετε τα βήματα στη σωστή σειρά, γράφοντας μόνο τον αντίστοιχο αριθμό. α.προετοιμασία κατάλληλων θρεπτικών υλικών β. εμβολιασμός μικρής ποσότητας του μικροοργανισμού γ. απομόνωση οργανισμού στο εργαστήριο δ. ανάπτυξη καλλιέργειας σε κατάλληλες συνθήκες ε. αποστείρωση θρεπτικών υλικών και μέσων.           (μόρια 5)

Ζήτημα 3.                                                                                                    Μονάδες 25

  1. Δίνονται τα παρακάτω τρία σχήματα, δυο από αυτά αφορούν ακριβώς το ίδιο τμήμα ενός κλώνου ενός μορίου DNA σε διαφορετικές χρονικές στιγμές του κυτταρικού κύκλου ενός ευκαρυωτικού κυττάρου, στο οποίο ανήκει αυτός ο κλώνος DNA. Το τρίτο σχήμα αφορά την ίδια ακριβώς διαδικασία με μια από τις δυο διαδικασίες in vivo που δίνονται. Η διαδικασία που παριστάνεται στο τρίτο σχήμα πραγματοποιείται in vitro.

 

Επαναληπτικό 1-2-4-7-03

Α. Ποιες διαδικασίες αφορούν τα σχήματα 1, 2 και 3;

Β. Να ονομάσετε τις πρωτεΐνες α,β,γ,δ και ε.

Γ. Ποια είναι η λειτουργία του σημείου 1 στο μόριο του DNA;

Ποιες διαφορές γνωρίζετε μεταξύ των σημείων 1 στο μόριο του DNA ανάμεσα στους προκαρυωτικούς και τους ευκαρυωτικούς οργανισμούς;

Υπάρχουν διαφορές μεταξύ των δυο κατηγοριών οργανισμών που αναφέρθηκαν και για τις πρωτεΐνες α, που αναγνωρίζουν τα σημεία όπως το 1;

Δ. Τι είδους βιολογικά μακρομόρια είναι οι κλώνοι ι και ιι καθώς και ιιι;

Ποια δομική διαφορά εντοπίζεται μεταξύ των κλώνων ι και ιιι;

Ε. Ποιες πρωτεΐνες έδρασαν και ποιες πρόκειται να δράσουν ακόμη εκατέρωθεν του σημείου 2;

ΣΤ. πόσες πρωτεΐνες έδρασαν στο σημείο 3; Ονομάστε τις πρωτεΐνες αυτές.

Ζ. Ποιες από τις πρωτεΐνες που εμφανίζονται στα σχήματα εκτελούν εργασίες που έχουν το ίδιο τελικό αποτέλεσμα;

Η. Σε ποιο από τα τρία σχήματα γνωρίζετε ότι ένα προκαρυωτικό ένζυμο  «διαβάζει» ευκαρυωτικό γενετικό υλικό;

Θ. Ποια από τις διαδικασίες που φαίνονται στα σχήματα εκτελείται μια φορά στο δεδομένο τμήμα DNA, στην ζωή του κυττάρου;

Ι. Εξηγήστε τις πρακτικές εφαρμογές που βρίσκει η διαδικασία η οποία εκτελείται in vitro.                                                                                         (μόρια 1.5, 1.5, 1, 2, 2, 1, 2, 1, 1, 1)

  1. Σε ένα εργαστήριο Μοριακής Βιολογίας, επαναλήφθηκαν τα πειράματα που απέδειξαν τον μετασχηματισμό των προκαρυωτικών κυττάρων.

Οι οργανισμοί μελετήθηκαν με σύγχρονα μέσα και τεχνικές που μας παρέχει η τεχνολογία του ανασυνδυασμένου DNA.

Οι επιστήμονες δημιούργησαν την γονιδιωματική βιβλιοθήκη των δυο στελεχών του βακτηρίου D. pneumoniae και απομόνωσαν το γονίδιο που κωδικοποιεί για την πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος στα λεία στελέχη.

Στην συνέχεια με τεχνικές Γενετικής Μηχανικής μετασχημάτισαν ένα πληθυσμό από αδρά στελέχη του βακτηρίου. Από τον πληθυσμό που μετασχηματίστηκε και τον αρχικό πληθυσμό των λείων βακτηρίων, λήφθηκε δείγμα κυττάρων, στο οποίο πραγματοποιήθηκε PCR για την ενίσχυση του γονιδίου που ελέγχει για το κάλυμμα, από το γονιδίωμα των βακτηρίων. Τα αποτελέσματα αναλύθηκαν και πήραμε τα εξής:

Επαναληπτικό 1-2-4-7-04

 

Α. Ποιο από τα βακτηρία που αναλύθηκαν είναι το αδρό , ποιο το λείο και ποιο το μετασχηματισμένο αδρό σε λείο;                                                                         (μόρια 1,5)

Β. Δίνεται ο ένας από τους δύο κλώνους του γονιδίου που ενισχύθηκε και δυο μόρια tRNA που μετείχαν στην μετάφραση του.

5′ …TCAATTAGTGTACCCTTTATGATCACCTGGGTACATTGATTAGAT…3′

3′ UUA5′ και 5′ GUA 3′  τα αντικωδικόνια των δυο μορίων tRNA .

Ο κλώνος που δίνεται είναι ο κωδικός ή ο μη κωδικός του γονιδίου;

Αιτιολογήστε την απάντηση σας.                                                                           (μόρια 1 και 1,5)

Γ. Γνωρίζετε ότι μεταξύ της αλληλουχίας αναγνώρισης του mRNA από την μικρή ριβοσωμική υπομονάδα και του κωδικονίου έναρξης υπάρχουν τέσσερα νουκλεοτίδια της 5′ αμετάφραστης περιοχής. Ποια θα είναι η αλληλουχία της κωδικής αλυσίδας του γονιδίου rRNA που θα συνδέεται με το μόριο mRNA το οποίο θα προκύπτει κατά την μεταγραφή του δοθέντος γονιδίου;                                                                                                                  (μόρια 1)

Δ. Τα αδρά στελέχη του D. pneumoniae,  που χρησιμοποιήθηκαν για να μετασχηματιστούν δεν διαθέτουν πλασμίδια και είναι ανθεκτικά στο αντιβιοτικό τετρακυκλίνη (tet). Οι ερευνητές είχαν στην διάθεσή τους, τους παρακάτω φορείς κλωνοποίησης.

Ποιον  μπορούν επιλέξουν για να επιτύχουν τον μετασχηματισμό;

Αιτιολογείστε την απάντηση σας.                                                                            (μόρια 1 και 2,5)

 

Επαναληπτικό 1-2-4-7-05

Όπου: Polilynker: Πολλές, διαδοχικές, αλληλεπικαλυπτόμενες, μοναδικές θέσεις αναγνώρισης περιοριστικών ενδονουκλεασών. Τουλάχιστον μια από αυτές είναι κατάλληλη για την ένθεση του επιθυμητού γονιδίου.

Ε. Τα ανασυνδυασμένα βακτήρια καλλιεργήθηκαν στο εργαστήριο και πήραμε τις παρακάτω καμπύλες: Βιομάζα = f(t) και Πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος = f(t).

Επαναληπτικό 1-2-4-7-06

 

Γνωρίζουμε ότι το γονίδιο του λείου πνευμονιόκοκκου που ανασυνδυάστηκε, διαθέτει μια θέση περιορισμού NdeI, εντός του μεταφράσιμου τμήματος του. Μια καλλιέργεια,  όπως η παραπάνω (διάγραμμα 2), παρουσίασε την εξής εικόνα ως προς την παραγωγή της ετερόλογης πρωτεΐνης από τα μετασχηματισμένα αδρά στελέχη.

Μέτα από την απομόνωση των κυττάρων της καλλιέργειας και στη συνέχεια την απομόνωση των γονιδίων από τους πλασμιδιακούς φορείς κλωνοποίησης και στην  περαιτέρω πορεία πέψης του γονιδίου που ευθύνεται για το κάλυμμα των λείων στελεχών του πνευμονιόκοκκου από την NdeI, έδειξε ότι τα μισά γονίδια μπορούσαν να κοπούν και τα άλλα μισά όχι. Εξηγήστε σύντομα το φαινόμενο. Είναι γνωστό ότι  η καλλιέργεια δεν εκτέθηκε σε κανέναν  εξωγενή μεταλλαξιγόνο παράγοντα και  θεωρούμε ότι σε κάθε κύτταρο ξενιστή εισέρχεται μόνο ένα πλασμίδιο φορέας κλωνοποίησης, το οποίο αντιγράφεται μόνο μια φορά εντός του ξενιστή του.                                                    (μόρια 2,5)

Ζήτημα 4ο                                                                                                   Μονάδες 25

  1. Ένα στέλεχος E. coli, μετασχηματίζεται με το γονίδιο που ευθύνεται για το κάλυμμα (κάψα) του λείου στελέχους του πνευμονόκοκκου. Για τον μετασχηματισμό χρησιμοποιήθηκαν τρεις διαφορετικοί φορείς κλωνοποίησης, όπως φαίνονται παρακάτω και δημιουργηθηκαν τρεις διαφορετικες υγρες καλλιεργειες των μετασχηματισμενων κυτταρων που η καθεμιά έχει μετασχηματιστεί με διαφορετικό  φορέα κλωνοποίησης. Οι καλλιέργειες αναπτύσσονται αρχικά σε γλυκόζη και μετά την εξάντληση της, η αύξηση της κάθε καλλιέργειας συνεχίζεται με λακτόζη. Σε ποια χρονική στιγμή αναμένεται να εκφράζεται η ετερόλογη πρωτεΐνη σε καθεμιά από τις τρεις καλλιέργειες;

Επαναληπτικό 1-2-4-7-08

2.

Επαναληπτικό 1-2-4-7-07

2. Δίνονται οι παραπάνω καμπύλες α, β, γ που αφορούν τρεις διαφορετικές υγρές καλλιέργειες. Ποια από αυτές αντιστοιχεί στην αύξηση της καλλιέργειας E. coli, σε υγρό θρεπτικό υλικό με πηγή άνθρακα  λακτόζη, ποια με γλυκόζη και ποια με γαλακτόζη. Γνωρίζεται ότι σε κάθε μια από τις καλλιέργειες η πηγή άνθρακα βρίσκεται σε ίσες συγκεντρώσεις  με τις υπόλοιπες καλλιέργειες που εξετάζονται;

Δίνεται ακόμη ότι το βακτήριο E. coli, μπορεί να προσλάβει και να μεταβολίσει την γαλακτόζη. Η γαλακτόζη εντός του κυττάρου μετατρέπεται μετά από τρία μεταβολικά βήματα σε 6-φωσφόρο-γλυκόζη που αποτελεί το προϊόν και του πρώτου μεταβολικού βήματος της καταβολικής οδού διάσπασης της γλυκόζης στο κύτταρο.