Author Archives: gkarakats

Η αγορά άξιων των βάσεων για τις θετικές σπουδές στην Ελλάδα

Όπως παρουσιάστηκε στο 11ο συνέδριο «Βιολογία Αλλάζει την Κοινωνία» Αθήνα 14-16.12.2018

Παρουσίαση συνεδρίου


Με αφορμή την ανακοίνωση των φετινών (2018) βάσεων των εισαγωγικών εξετάσεων για την είσοδο των υποψηφίων φοιτητών στα ΑΕΙ και ΑΤΕΙ της χώρας, παρουσιάζουμε παρακάτω την στατιστική μελέτη των αποτελεσμάτων για πέντε (5) μαθήματα που αφορούν την εισαγωγή των υποψηφίων των θετικών σπουδών τόσο του 2ου όσο και του 3ου Επιστημονικού Πεδίου, από τα Γενικά Λύκεια όλης της Ελλάδος.
Η διαγραμματική παρουσίαση1 αυτής της μελέτης, αφορά τις τρεις τελευταίες συνεχόμενες χρονιές, που εφαρμόστηκε το «νέο» σύστημα εισαγωγής στην τριτοβάθμια εκπαίδευση, με την εξέταση σε τέσσερα συν ένα (4+1) μαθήματα αντί για έξι (6), που ήταν από το 2006 μέχρι το 2015.
Τα έτη λοιπόν που μελετάμε, είναι τα 2016-2017-2018 και φυσικά τα δεδομένα προέρχονται από τα επίσημα στατιστικά στοιχεία που δημοσίευσε το Υπουργείο Παιδείας Έρευνας και Θρησκευμάτων (Υπουργείο Παιδείας εφεξής).
Αξίζει να αναφερθεί, ότι μονάχα για αυτά τα τρία τελευταία έτη, το Υπουργείο Παιδείας έχει δημοσιεύσει στατιστικώς επεξεργάσιμα αποτελέσματα, τα οποία όμως αφορούν μονάχα τις βαθμολογίες πάνω από τη βάση του 10.
Τα αποτελέσματα δηλαδή που δημοσιεύθηκαν από το Υπουργείο Παιδείας, αφορούν τις βαθμολογίες που πέτυχαν οι υποψήφιοι από το 10 μέχρι το 20, ανά 1 μονάδα, 10-10,9, 11-11,9, 12-12,9, 13-13,9 κ.ο.κ.

2016-2018

Εικόνα 1: Παρουσίαση της κατανομής των βαθμολογιών των μαθημάτων της θετικής κατεύθυνσης, για τα έτη 2016 έως 2018.

Τα στοιχεία που δίνονται ωστόσο από το Υπουργείο Παιδείας, δεν διακρίνουν ομαδοποιημένα ανά πεδίο, τις βαθμολογίες στα κοινά μαθήματα του 2ου και του 3ου επιστημονικού πεδίου (Φυσική, Χημεία) ούτε και για το μάθημα της Έκθεσης, δεν γίνεται ομαδοποίηση των υποψηφίων ανά επιστημονικό πεδίο. Για τις βαθμολογίες κάτω της βάσης του 10, το Υπουργείο Παιδείας δεν έχει δώσει αναλυτικούς πίνακες με το πλήθος των υποψηφίων ανά βαθμό, για κανένα από τα μαθήματα της θετικής κατεύθυνσης, ούτε όμως και των υπολοίπων κατευθύνσεων, δηλαδή δεν μπορούμε να γνωρίζουμε πόσοι από τους υποψήφιους έχουν γράψει βαθμολογίες μεταξύ 1-1,9, 2-2,9 κ.ο.κ. Συνεπώς, είναι αδύνατη η στατιστική τους επεξεργασία. Ωστόσο, δίνονται στον παρακάτω πίνακα τα ποσοστά του πλήθους των υποψηφίων της θετικής κατεύθυνσης, που έγραψαν βαθμολογίες πάνω και κάτω από την βάση του 10, για τα έτη 2016, 2017 και 2018, τα οποία εξετάζονται στην παρούσα εργασία.

Πίνακας 1. Ποσοστιαία κατανομή υποψηφίων θετικών σπουδών σε βαθμολογίες κάτω και πάνω της βάσης του 10 για τα έτη 2016 έως 2018.

Screenshot 2018-12-16 at 22.28.26

Όπως φαίνεται καθαρά από τα παραπάνω διαγράμματα (Εικ.1), υπήρξε μέσα σε αυτή την τριετία, μία τάση, ώστε η δεξιά ασυμμετρία που παρατηρούνταν στα μαθήματα Φυσική, Χημεία, Βιολογία να προσεγγίσει την κανονική κατανομή.
Η δεξιά ασυμμετρία παρουσιάζει μία σταθερά ανοδική κατανομή των ποσοστώσεων των βαθμολογίων των υποψηφίων σε αναλογίες από 10 προς 20. Δηλαδή οι λιγότεροι μαθητές έγραψαν 10-10,9, περισσότεροι 11-11,9 κ.ο.κ. ενώ οι περισσότεροι μαθητές έγραψαν μεταξύ 19 και 20! Προφανώς αυτό, δεν μπορεί να αποδοθεί πάρα μόνο στο γεγονός ότι τα θέματα ήταν πολύ εύκολα και συνεπώς με χαμηλή διακριτή ικανότητα, ώστε να ξεχωρίσουν τους άριστους από τους πολύ καλούς, τους πολύ καλούς από τους καλούς και αυτούς από τους μέτριους κ.ο.κ.
Η κανονική κατανομή, είναι η κατηγοριοποίηση των βαθμολογιών των υποψηφίων σε μορφή κώδωνα, δηλαδή οι περισσότεροι μαθητές γράφουν βαθμολογίες μεταξύ 14-16 και λιγότεροι γράφουν βαθμολογίες από 10 έως 14 (με αυξητική τάση μεταξύ 10 με 14) ενώ ακόμη λιγότεροι γράφουν βαθμολογίες μεταξύ 16-20 (με πτωτική τάση μεταξύ 16 με 20).
Τέτοια κατανομή εμφανίζει μονάχα το μάθημα της Έκθεσης, όπως μπορούμε να παρατηρήσουμε από τα διαγράμματα (Εικ.1).
Η κανονική κατανομή, όπως εύκολα γίνεται αντιληπτό, άλλα και όπως είναι γνωστό από τις ποσοτικές επιστήμες (π.χ. Γενετική: Ποσοτικοί χαρακτήρες), ανταποκρίνεται στη φυσική κατανομή των ατόμων ενός πληθυσμού (όπως ο πληθυσμός των υποψηφίων εδώ) για ιδιότητές του, που επηρεάζονται από μεγάλη αλλά και κατά το δυνατόν μετρήσιμη ποικιλία παραγόντων, τόσο γενετικών όσο και περιβαλλοντικών.
Βεβαίως, για τα μαθήματα που εξετάζονται στις πανελλαδικές εξετάσεις θα μπορούσε, υπό μια έννοια, να θεωρηθεί θεμιτό και οι βαθμολογίες των υποψηφίων, πέρα από την κανονική κατανομή, να εμφανίζουν τουλάχιστον δεξιά ασυμμετρία, όπως αυτή των Μαθηματικών (Εικ. 1).
Ωστόσο, δεν πρέπει να ξεχνάμε, ότι οι πανελλαδικές εξετάσεις αφορούν ένα ορισμένο σχολικό εγχειρίδιο για κάθε μάθημα, το οποίο έχει πεπερασμένη και εντελώς καθορισμένη ύλη το ίδιο, αλλά και τα σχολικά εγχειρίδια των προηγούμενων σχολικών τάξεων, τα οποία θεωρητικά αποτελούν το γνωστικό υπόβαθρο για το εγχειρίδιο της Γ’ Λυκείου, που εξετάζεται στις εισαγωγικές εξετάσεις (βλέπε εγκύκλιος Αρ.Πρωτ.222487/Δ2/18-12-2017/ΥΠΠΕΘ) και συνεπώς είναι αυτά τα σχολικά εγχειρίδια, από τα οποία επιτρέπεται να αντληθούν θέματα.
Επίσης, δεν πρέπει να ξεχνάμε πως η μορφή των θεμάτων είναι εντελώς προσδιορισμένη και (θεωρητικώς) περιορίζεται ακόμη περισσότερο η επιλογή τους, από το γεγονός ότι πρέπει να αποφεύγονται θέματα από εκπαιδευτικά βοηθήματα που κυκλοφορούν στην αγορά καθώς και σχετικές ιστοσελίδες (κανόνας που δεν τηρείται φυσικά, για διάφορους λόγους).
Όλοι λοιπόν αυτοί οι λόγοι, δεν αφήνουν πολλά περιθώρια για μεγάλο βαθμό ελεύθερης σκέψης και απόδοσής της, από τους υποψηφίους και φυσικά καθιστά πρακτικώς ανεφάρμοστη τη φράση που βρίσκεται στο τέλος των οδηγιών προς τους εξεταζόμενους και συνοδεύει πάντα τα θέματα: «κάθε απάντηση επιστημονικώς τεκμηριωμένη θεωρείται σωστή».
Για να μπορεί να εφαρμοστεί αυτή η φράση, θα πρέπει να συμβαίνουν τα εξής:
α. Για να μπορέσει να βαθμολογηθεί ορθά το γραπτό ενός μαθητή, που ξεφεύγει από το απόλυτα ορισμένο πλαίσιο της σχολικής ύλης και των λεγομένων του σχολικού εγχειριδίου, δεν αρκεί δυστυχώς ο μαθητής να έχει γράψει και να έχει τεκμηριώσει ορθά τη λύση του, αλλά θα πρέπει β. Και οι βαθμολογητές του να γνωρίζουν την γνώση αυτή, την οποία έχει διατυπώσει ο μαθητής, γεγονός που δεν είναι δυστυχώς απαραίτητο ότι συμβαίνει. γ. Πρέπει επίσης, οι βαθμολογητές για να μπορέσουν να την αξιολογήσουν ορθά μια τέτοια απάντηση ενός μαθητή, να δεχθούν να «παρεκκλίνουν» από τις έτοιμες λύσεις, που έχει δώσει η Κεντρική Επιτροπή Εξετάσεων (ΚΕΕ). δ. Να είναι πρόθυμοι να διαβάσουν ολόκληρο το γραπτό, με περίσσεια προσοχή για το πενιχρό ποσό που πληρώνονται ανά γραπτό, ασχέτως του ελάχιστου χρόνου που διαθέτουν (ειδικότερα όταν το μάθημα που διορθώνουν είναι το τελευταίο που εξετάστηκε στις εξετάσεις) και πέρα των πιέσεων για αύξηση της ταχύτητας των διορθώσεων, ώστε να ανακοινωθούν «εγκαίρως» τα αποτελέσματα από το Υπουργείο Παιδείας, με συνακόλουθη βεβαίως, μείωση της ποιότητας διόρθωσης.
Ακόμη, ειδικότερα για το μάθημα της Βιολογίας που αντιμετωπίζει έντονα αυτό το πρόβλημα (εξαιτίας των λιγοστών βιοεπιστημόνων που βρίσκονται στα σχολεία) σε αντίθεση με τα υπόλοιπα τέσσερα μαθήματα που εξετάζει η παρούσα μελέτη, θα πρέπει για να βαθμολογηθεί αντικειμενικά ο μαθητής που έγραψε κάτι διαφορετικό από τις έτοιμες λύσεις τις ΚΕΕ, άλλα ωστόσο εντελώς σωστό, τόσο επιστημονικά όσο και σύμφωνα με το σχολικό εγχειρίδιο στο οποίο εξετάζεται, οι βαθμολογητές που πρόκειται να το διορθώνουν, θα πρέπει να είναι ειδικοί στο αντικείμενο, δηλαδή βιοεπιστήμονες (με πρόσφατες βασικές σπουδές στις επιστήμες ζωής) και όχι κατά κύριο λόγο επιστήμονες άλλων ειδικοτήτων, όπως χημικοί, φυσικοί ή γεωλόγοι (Π.Ε. 04) που απλώς έχουν «διδάξει» το μάθημα για μερικά χρόνια στο σχολείο, ενώ δεν έχουν διδαχθεί οι ίδιοι στο πανεπιστήμιο επαρκώς ή ακόμη και καθόλου το αντικείμενο που πραγματεύεται το σχολικό βιβλίο της Γ΄ Λυκείου Θετικού Προσανατολισμού.
Και αυτό διότι, αν και το σχολικό εγχειρίδιο της Βιολογίας έχει γραφτεί προ 20ετίας, εντούτοις πραγματεύεται βιολογικά θέματα, που βρίσκονται ακόμη και τώρα στην αιχμή της πλέον ταχύτερα εξελισσόμενης επιστήμης σε ολόκληρο τον επιστημονικό κόσμο (όπως είναι γνωστό η Βιολογία απορροφά την πλειονότητα των κονδυλίων της παγκόσμιας χρηματοδότησης για την έρευνα). Τέτοια θέματα είναι για παράδειγμα, η γονιδιακή θεραπεία, η βιοτεχνολογία μικροοργανισμών, φυτών και ζώων, η κλωνοποίηση θηλαστικών κ.ά.
Πέρα όμως από όλα τα παραπάνω προβλήματα και πολλές ακόμη παθογένειες των πανελλαδικών εξετάσεων, οι εξετάσεις αυτές παραμένουν εν πολλοίς ένας αδιάβλητος θεσμός, μπορεί όχι δίκαιος απαραιτήτως, όμως αδιάβλητος θεσμός και γι’ αυτό το λόγο καταξιωμένος στη συνείδηση της ελληνικής κοινωνίας από τότε που εφαρμόστηκαν.
Με βάση όσα ήδη αναφέρθηκαν και παρατηρώντας τα διαγράμματα της Εικόνας 1, διακρίνεται μία τάση για βελτίωση της ικανότητας διαχωρισμού των υποψηφίων από έτος σε έτος.
Ειδικότερα, για το μάθημα της Βιολογίας, το οποίο έχει, από όλα τα μαθήματα τον μεγαλύτερο συντελεστή (1,3) για το 3ο πεδίο (Επιστήμες Υγείας), που οδηγεί στις Ιατρικές σχόλες και με δεδομένο ότι στη Βιολογία Θετικού Προσανατολισμού εξετάζονται περίπου 13.000-16.000 μαθητές κάθε χρόνο,
γίνεται ορατό ότι:
Κυμαίνονται οι άριστοι (19-20) από ~ 7% με 9% (τα ποσοστά (%) αυτά αντιστοιχούν περίπου σε 1200 άτομα σε όλη την Ελλάδα, σημειώνεται ότι στις Ιατρικές – Οδοντιατρικές και φαρμακευτικές σχόλες της χώρας εισάγονται κάθε χρόνο περίπου 1400 άτομα) και παράλληλα φέτος, εν αντιθέσει με τις προηγούμενες χρονιές το μεγαλύτερο ποσοστό των υποψηφίων που έγραψαν μεγαλύτερη βαθμολογία από 10, κυμάνθηκαν σε βαθμολογίες μεταξύ 17-18 και όχι 18-19 όπως τα δύο προηγούμενα χρόνια. Αυτό μας δείχνει ότι υπάρχει τάση, για μία κατανομή βαθμολογιών πιο κοντά στην κανονική κατανομή, στην οποία υπακούει ο πληθυσμός; Σίγουρα κάτι τέτοιο μόνο θετικό μπορεί να θεωρηθεί, εφόσον βεβαίως, αυτό επιτυγχάνεται με θέματα που διατυπώνονται με επιστημονική και παιδαγωγική ορθότητα και όχι με ασάφειες επιστημονικές και παιδαγωγικές, όπως ήταν για παράδειγμα τα φετινά θέματα, τα οποία μπορούν ενδεχομένως να χαρακτηριστούν μαζί με τα θέματα του 2015** ως τα χειρότερα που έχουν τεθεί ποτέ στο μάθημα, από το 2000 μέχρι τώρα.
Τα θέματα πριν από το 2011 μπορεί κάνεις να πει, ότι ήταν διαφορετικής φιλοσοφίας, περισσότερο προσανατολισμένα στην παράθεση αυτούσιων τμημάτων του σχολικού εγχειρίδιου και με ασκήσεις πολύ μικρού βαθμού δυσκολίας, χωρίς την απαίτηση ιδιαίτερης κριτικής σκέψης, αλλά και χωρίς να στερούνται και προβλημάτων διατύπωσης. Από το 2011 και μετά, η παράθεση των αυτούσιων αποσπάσματων του σχολικού βιβλίου δεν έχει μειωθεί, αντίθετα μάλιστα. Όμως αυτό ζητείται μέσω περισσοτέρων ερωτήσεων συνδυαστικής σκέψης και κριτικής ικανότητας. Εντούτοις αυτές οι ερωτήσεις και οι ασκήσεις πολύ συχνά μετά το 2011, χαρακτηρίζονται από ασάφειες (θέματα: γ2 2018, β και δ 2016, 2015, δ 2014 κ.α.), από ερωτήματα που δεν υπάρχουν απαντήσεις εντός του σχολικού βιβλίου, ούτε και προηγουμένων τάξεων σχολικών εγχειρίδιων Βιολογίας ή είναι ρητώς εκτός εξεταστέας ύλης (π.χ. τα θέματα: η δράση του ενζύμου DNA δέσμαση 2015 και 2016, γ3 2018 κ.α.) και από επιστημονικές ανακρίβειες (θέματα: επαναληπτικά δ 2012, δ2014, δ2015, εσπερινά γ2017 κ.α.) ή έρχονται σε σύγκρουση με γνώσεις προηγουμένων τάξεων στην Βιολογία (θέματα: α2016) ή δίνονται πολλαπλής επιλογής με περισσότερες από μια σωστές επιλογές (α 2018) ή η απάντηση τους ενώ υπάρχει εντός του σχολικού βιβλίου της Γ΄ Λυκείου και εντός εξεταστέας ύλης, αυτή δεν λαμβάνεται υπόψη (θέματα: επαναληπτικά δ2016, γ2018).
Το πρόβλημα βεβαίως δεν έγκειται μόνο στις λανθασμένες εκφωνήσεις, αλλά ακόμη περισσότερο στις λανθασμένες απαντήσεις που δόθηκαν από την ΚΕΕ και θεωρήθηκαν αυτές ως «Σωστές» και όχι οι επιστημονικώς σωστές, που πηγάζουν άλλωστε και από το σχολικό εγχειρίδιο, και που προτάθηκαν από τους συντονιστές των εξεταστικών κέντρων, όπως φέτος (βλέπε άρθρο της Βιολόγου – συντονίστριας των πανελλαδικών εξετάσεων Δρ. Ευγενίας Μπολανάκη στο διαδικτυακό τόπο www. e-sos.gr στις 21-7-2018).
Ειδικότερα για την Βιολογία που αναφέρουμε εδώ, τα θέματα που επιλέγονται για τις πανελλαδικές εξετάσεις από το 2016, είναι ορθά διατυπωμένα και απαντημένα στην αγγλική γλωσσά, αφού αποτελούν συχνά αντιγραφές έτοιμων (εξαιρετικών αναμφίβολα, αν αποδιδόταν ως έχουν) θεμάτων από πανεπιστήμια της αλλοδαπής. Εντούτοις, στις εξετάσεις παρουσιάζεται αδυναμία να αποδοθούν σωστά στην ελληνική γλώσσα αυτά τα θέματα καθώς και οι απαντήσεις που τα συνοδεύουν, αποδίδοντας εντέλει θέματα ασαφή, που επιδέχονται περισσότερες της μιας ερμηνείες, ενώ ταυτόχρονα εμφανίζεται αδυναμία να προσαρμοστούν με ορθό επιστημονικό και παιδαγωγικό τρόπο εντός των ορίων της περιορισμένης και εντελώς καθορισμένης εξεταστέας ύλης των πανελληνίων εξετάσεων. Έτσι, δυστυχώς, ο στόχος της κατανομής των βαθμολογίων των υποψηφίων σε κανονική κατανομή για βαθμολογίες μεγαλύτερες της βάσης του 10, επιτυγχάνεται μόνο αριθμητικά όχι όμως ουσιαστικά, αφού είναι πολύ πιθανό, άριστα προετοιμασμένοι μαθητές να μην γράψουν καλά και να μην επιτύχουν το στόχο τους, οπότε υποχρεώνονται να ξαναδώσουν εξετάσεις ή να μεταναστεύσουν στο εξωτερικό, και αυτό όχι γιατί δεν γνωρίζουν την επιστημονικώς ορθή απάντηση σε αυτά τα ερωτήματα, αλλά διότι δεν είναι φυσικά μάντης, για να μαντέψουν ποια από τις αναρίθμητες λανθασμένες απαντήσεις, θα θεωρηθεί σωστή από την ΚΕΕ!
Από την άλλη πλευρά, είναι πολύ πιθανό μέτρια προετοιμασμένοι μαθητές, που αδυνατούν να απαντήσουν επιστημονικώς ορθά σε αυτά τα ερωτήματα, πέτυχαν κατά τύχη ή λόγω πραγματικός άγνοιας, την λανθασμένη απάντηση που θεωρεί ως σωστή η ΚΕΕ, ακόμη και αν αυτή η ¨σωστή” απάντηση έρχεται σε πλήρη αντίθεση με την εξεταζόμενη ύλη για τις εξετάσεις (βλέπε ερώτημα γ3 και απάντηση του 2018 αλλά και θέμα Δ 2015, όπως και θέμα Γ Εσπερινών Λυκείων 2017, Θέμα Α 2016 και 2018 κ.α)!
Το πρόβλημα ωστόσο, είναι ακόμα βαθύτερο στο συγκεκριμένο μάθημα, καθώς διδάσκεται, κατά κύριο λόγο, όπως αναφέρθηκε και προηγουμένως, από καθηγητές τόσο εντός των σχολείων αλλά όσο και εκτός (φροντιστήρια) που δεν έχουν βασικές σπουδές στις Επιστήμες Ζωής ώστε να είναι γνώστες της επιστήμης της Βιολογίας και των εφαρμογών της, αλλά αντίθετα διδάσκεται από φυσικούς (η πολυπληθέστερη ειδικότητα από τους καθηγητές, μετά τους φιλόλογους και τους μαθηματικούς), χημικούς (η αμέσως λιγότερο πολυπληθέστερη κατηγορία καθηγητών μετά τους φυσικούς, όμως αρκετά κοντά σε πλήθος με τους φυσικούς) και γεωλόγους. Οι ειδικότητες αυτές, είτε δεν διδάχθηκαν καθόλου είτε δεν διδάχθηκαν επαρκώς, στο πρόγραμμα σπουδών του τμήματος που παρακολουθήσαν (μικρό ποσοστό μαθημάτων Βιολογίας, στο σύνολο του προγράμματος σπουδών τους και όχι πάντα υποχρεωτικά) το μοντέρνο και ταχέως εξελισσόμενο αντικείμενο της Βιολογίας. Να σημειωθεί βεβαίως ότι, σημαντικό ρόλο σε αυτό (πρόγραμμα σπουδών των πανεπιστημιακών τμημάτων των ειδικοτήτων που διδάσκουν Βιολογία, εκτός των βιοεπιστημόνων) έχει και η χρονική περίοδος που φοίτησαν στο πανεπιστήμιο ή οι μετέπειτα σπουδές στους, τόσο σε επίπεδο χρονικής περιόδου, όσο και σε επίπεδο αντικειμένου σχετικού ή όχι με τις επιστήμες ζωής και ειδικότερα την Μοριακή Βιολογία-Βιοτεχνολογία και τη Γενετική, που είναι τα αντικείμενα που πραγματεύεται το σχολικό εγχειρίδιο της Γ΄ Λυκείου Θετικού Προσανατολισμού.
Επιπλέον, και πάλι αναφερόμενοι στο μάθημα της Βιολογίας που είναι αυτό που κρίνει την εισαγωγή των υποψηφίων στις περιζήτητες Ιατρικές σχόλες, έχοντας τον υψηλότερο συντελεστή βαρύτητας 1,3 (για κάθε επιπλέον βαθμό στην κλίμακα του 1-20, ο υποψήφιος κερδίζει 330 μόρια!) οφείλουμε να σημειώσουμε ότι από την μια, η εξαιρετικά μεγάλη ζήτηση στις σχόλες αυτές είναι σταθερά ανελαστική από υπάρξεως των πανεπιστημίων στην Ελλάδα και από την άλλη, το μάθημα της Βιολογίας προβλέπεται να διδάσκεται μόνο 2 ώρες την εβδομάδα στην Γ΄ Λυκείου όσο δηλαδή και η Έκθεση με συντελεστή βαρύτητας 0,3 (κάθε επιπλέον βαθμός στην κλίμακα 1-20 δίνει 200 μόρια) και λιγότερο από την Φυσική (συντελεστής 0,3 στο 3ο πεδίο και 0,7 στο 2ο, δηλαδή 270 μόρια για κάθε επιπλέον βαθμό) και την Χημεία (συντελεστής βαρύτητας 0,3 στο 2ο πεδίο και 0,7 στο 3ο πεδίο) που διδάσκονται 3 ώρες! Τέλος, από τα θετικά μαθήματα, τα μαθηματικά που αποτελούν το μάθημα βαρύτητας (1,3 στο 2ο πεδίο) για την εισαγωγή στα πολυτεχνεία διδάσκονται 5 ώρες την εβδομάδα!
Αξίζει δε να παρατηρηθεί ότι, το γνωστικό αντικείμενο της Βιολογίας είναι το μόνο από όλα τα παραπάνω (Μαθηματικά, Νέα Ελληνικά, Φυσική και Χημεία) που δεν εμφανίζει συνοχή στην ύλη ούτε συνέχεια στην διδασκαλία του, στα πλαίσια ολόκληρης της α΄ βαθμιας και β΄ βαθμιας εκπαίδευσης της χώρας μας. Με εξαίρεση ελάχιστα ψήγματα περί νόμων του Μέντελ, μοριακού δόγματος, μίτωση και μείωση στο 5ο κεφάλαιο του βιβλίου της γ΄ γυμνάσιου και μια επαναπροσέγγιση του δόγματος, της μίτωσης και της μείωσης στο 4ο κεφάλαιο του βιβλίου της β’ λυκείου (το οποίο μέχρι το 2015 ήταν εκτός ύλης), όλο το υπόλοιπο περιεχόμενο που πραγματεύεται το βιβλίο της Γ΄ Λυκείου της Βιολογίας Θετικής Ομάδας Προσανατολισμού, είναι εντελώς νέο και άγνωστο, χωρίς συνοχή και συνέχεια με την ύλη της Βιολογίας στις προηγούμενες τάξεις του Λυκείου και του Γυμνασίου.
Ωστόσο, αν όλα αυτά συμβαίνουν στα πλαίσια των συντεχνιών των διαφόρων ειδικοτήτων των εκπαιδευτικών και φυσικά, εάν υπάρχει η συναίνεση του Υπουργείου Παιδείας σε αυτές, προκείμενου μεταξύ άλλων, αφενός μεν να ικανοποιήσει τις συντεχνίες και αφετέρου να περιορίσει τους διορισμούς εκπαιδευτικών, στα γενικότερα πλαίσια των περικοπών, τότε το σύνολο αυτών των αποφάσεων ας ληφθεί από όλες τις πλευρές υπόψη, ότι βαραίνει την ελληνική νεολαία, ψυχικά, σωματικά και πιθανόν χρονικά, αλλά και τους γονείς αυτών, ενώ ωθεί με μαθηματική ακρίβεια στην αρωγή βοήθειας εξωσχολικά, για την εισαγωγή στην σχολή επιθυμίας και σε περίπτωση αποτυχίας, οδηγεί στην μετανάστευση των νεοελλήνων στο εξωτερικό, με δυσάρεστες συνέπειες για την ελληνική κοινωνία.

Η Έκθεση είναι το μάθημα στο οποίο, εξετάζονται όλοι ανεξαιρέτως οι υποψήφιοι κάθε χρόνο (περίπου 80.000) και το μάθημα με τον χαμηλότερο συντελεστή σε κάθε επιστημονικό πεδίο, με μοναδική εξαίρεση όταν ο μαθητής έχει δηλώσει πως θα εξεταστεί και σε πέμπτο μάθημα, είτε την Βιολογία Γενικής παιδείας είτε τα μαθηματικά Γενικής παιδείας και “ανοίγει” έτσι και δεύτερο επιστημονικό πεδίο στο μηχανογραφικό του, όποτε έχει συντελεστή βαρύτητας 0,6 για το επιπλέον επιστημονικό πεδίο. Όμως, είναι και το μάθημα με τις περισσότερες αναβαθμολογήσεις γραπτών (περίπου 12%), σε σχέση με οποιοδήποτε άλλο εξεταζόμενο μάθημα στις πανελλαδικές εξετάσεις. Βεβαίως το μάθημα της Έκθεσης διδάσκεται αποκλειστικά από φιλόλογους (2 ώρες την εβδομάδα στην Γ’ Λυκείου), με συνοχή και συνεχεία της ύλης, σε όλες τις βαθμίδες της εκπαίδευσης.
Η εικόνα της Έκθεσης, όπως προκύπτει από τα διαγράμματα (Εικ. 1), λόγω όλων των παραπάνω χαρακτηριστικών του μαθήματος προσεγγίζει την ιδεατή, και αυτή που οφείλουν να εμφανίζουν όλα τα μαθήματα που εξετάζονται πανελλαδικώς, ώστε να μπορούν να χαρακτηριστούν τα θέματα ικανά να προσεγγίζουν τις πραγματικές ανθρώπινες δυνατότητες ενός πληθυσμού (εδώ του πληθυσμού των υποψηφίων) για ορισμένες δεξιότητες (εδώ αυτές που εξετάζουν οι συγκεκριμένες εξετάσεις). Η Έκθεση, είναι το μόνο από τα μαθήματα που εμφανίζει κανονική κατανομή, δηλαδή οι πολλοί είναι μέτριοι, οι άριστοι ελάχιστοι και οι «κακοί μαθητές» λίγοι, αλλά περισσότεροι από τους άριστους.

Η Φυσική είναι το μάθημα με συντελεστή 0,3 για το 3ο πεδίο και 0,7 για το 2ο πεδίο. Το σύνολο των υποψηφίων κάθε χρόνο που εξετάζεται στο μάθημα της Φυσικής είναι περίπου 30.000 υποψήφιοι από τους οποίους οι ~ 13.000-16.000 ανήκουν στο 3ο πεδίο και οι υπόλοιποι στο 2ο πεδίο. Διδάσκεται σχεδόν αποκλειστικά από Φυσικούς, για 3 ώρες κάθε εβδομάδα στην Γ’ Λυκείου, με συνοχή και συνέχεια της ύλης σε όλες τις εκπαιδευτικές βαθμίδες.
Στα διαγράμματα (Εικ. 1) παρατηρούμε ότι από τότε που τα μαθήματα έγιναν 4 +1 αντί για 6 (μέχρι το 2015), το μεγαλύτερο ποσοστό των υποψηφίων συνωστίζεται στο 19-20. Εξαίρεση, η φετινή χρονιά, που αν και οι περισσότεροι από τους υποψηφίους κατά τη διάκρισή τους από 10-20 ανά 1 μονάδα εμφανίζονται και πάλι μεταξύ 19-20, σε ποσοστό δηλαδή περίπου 10%, αυτό το ποσοστό έχει εμφανώς περιοριστεί, σε αντίθεση με τις δυο προηγούμενες χρονιές. Το υψηλό ποσοστό των αριστούχων, είναι γεγονός αναντίρρητα προβληματικό για ένα μάθημα όπως η Φυσική, το οποίο προσφέρεται για αντικειμενική και επιτυχημένη διάκριση των υποψηφίων. Άρα τα δύο προηγούμενα χρόνια, μπορούμε να πούμε ότι τα θέματα της Φυσικής ήταν πολύ εύκολα, αλλά φέτος (2018), αν και παρέμειναν εύκολα, θα μπορούσαν να χαρακτηριστούν από καλύτερη διακριτική ικανότητα, αφού πέτυχαν την μείωση των αριστούχων, αισθητά σε σχέση με τα δυο προηγούμενα χρόνια.
΄Ας ελπίσουμε ότι τις αμέσως επόμενες χρονιές, η εικόνα της Φυσικής θα προσεγγίσει την εικόνα της Έκθεσης, δηλαδή θα αντιπροσωπεύει πραγματικά την κατανομή του πλήθους των μαθητών για ορισμένες δυνατότητές τους (όπως αυτές ζητούνται και εξετάζονται στις συγκεκριμένες εξετάσεις) σύμφωνα με τα δεδομένα της ανθρώπινης φύσης.

Το μάθημα της Χημείας είναι και αυτό με συντελεστή 0,3 όμως για το 2ο πεδίο σε αντίθεση με τη Φυσική και 0,7 για το 3ο πεδίο. Το σύνολο των υποψηφίων που εξετάζονται στο μάθημα είναι ακριβώς όμοιο με αυτό της Φυσικής ~ 30.000 κάθε χρόνο. Διδάσκεται σχεδόν αποκλειστικά από χημικούς, 3 ώρες την εβδομάδα στην Γ’ Λυκείου και χαρακτηρίζεται από συνοχή και συνεχεία της ύλης σε όλο το εύρος της β΄ βαθμιας εκπαίδευσης.
Η Χημεία διαχρονικά ήταν (από την εποχή των δεσμών ακόμα) και συνεχίζει να παραμένει το ευκολότερο από όλα τα εξεταζόμενα μαθήματα των θετικών σπουδών. Έτσι, δεν είναι τυχαίο που πάντα ήταν και εξακολουθεί να είναι το μάθημα με τους περισσότερους αριστούχους.
Ειδικότερα τα χρόνια πριν το 2016, αλλά και το 2016 με ποσοστό μαθητών που έγραψε μεταξύ 19-20 να είναι πάνω από 13% των υποψηφίων, το 2017 το ποσοστό αυτό έπεσε στο 12% περίπου, αλλά η γενική εικόνα δεν άλλαξε, καθώς τα ποσοστά των μαθητών που έγραψαν μεταξύ 10-20 κατανεμημένα ανά 1 μονάδα εμφανίζουν σταθερή βαθμιαία αύξηση τόσο το 2016 όσο και το 2017 (δεξιά ασυμμετρία), γεγονός που δηλώνει ότι τα θέματα είναι εύκολα στη Χημεία, η οποία δεν καταφέρνει να διαχωρίσει επιτυχημένα τους υποψηφίους σε άριστους, καλούς, μέτριους κ.ο.κ.
Φέτος βεβαίως είναι η πρώτη φορά που οι άριστοι 19-20 είναι λιγότεροι από μία άλλη κατηγορία, αυτή όμως είναι όσοι μαθητές έγραψαν 18-19 ενώ οι άριστοι, είναι η δεύτερη πολυπληθέστερη κατηγορία υποψηφίων με ποσοστό ~ 11 % και η τρίτη πολυπληθέστερη είναι αυτή των μαθητών που έγραψαν μεταξύ 17-18. Δηλαδή και πάλι η συσσώρευση των υποψηφίων γίνεται γύρω από τις υψηλές και όχι γύρω από τις μεσαίες βαθμολογίες, όπως θα ήταν το σωστό.
Οι εξετάσεις στη Χημεία λοιπόν φαίνεται ακόμη ότι αποτυγχάνουν να κατατάξουν τους μαθητές σε κανονική κατανομή.

Τα Μαθηματικά είναι το μάθημα με συντελεστή 1,3 στο 2ο πεδίο, το σύνολο των μαθητών που εξετάζονται στα μαθηματικά κάθε χρόνο είναι ~ 20,000 μαθητές για την θετική κατεύθυνση και άλλοι τόσοι περίπου, για την κατεύθυνση των οικονομικών σπουδών. Τα μαθηματικά διδάσκονται αποκλειστικά από μαθηματικούς, 5 ώρες την εβδομάδα στην Γ΄ Λυκείου και χαρακτηρίζονται από συνοχή και συνέχεια της ύλη τους, σε όλο το φάσμα της εκπαίδευσης στην Ελλάδα.
Το μάθημα των Μαθηματικών ήταν, και φαίνεται ότι εξακολουθεί να ξέρει πώς να συνεχίζει να είναι το πραγματικά δύσκολο μάθημα των πανελληνίων εξετάσεων από τα θετικά μαθήματα. Είναι αυτό, που εμφανίζει σταθερά αριστερή ασυμμετρία με τα ποσοστά των μαθητών που γράφουν 10-20 χωρισμένα μεταξύ τους ανά 1 μονάδα, να μειώνονται βαθμιαία από το 10 έως 20.
Σίγουρα, τα Μαθηματικά σε αντίθετη με τη Φυσική, τη Χημεία και τη Βιολογία κατορθώνουν μία πιο ορθολογική διάκριση μεταξύ των μαθητών υποψηφίων, διατηρώντας το επίπεδο των θεμάτων και τον τρόπο διόρθωσής τους υψηλό.
Είναι δε αξιοπρόσεκτο, πως η κατανομή των βαθμολογίων των υποψήφιων εμφανίζει έντονη δεξιά ασυμμετρία στα μαθήματα της Φυσικής και της Χημείας, που από τη φύση τους απαιτούν μαθηματική γνώση, ενώ από την άλλη πλευρά η κατανομή των βαθμολογίων των υποψηφίων στα μαθηματικά εμφανίζει έντονη αριστερή ασυμμετρία! Θα ήταν βεβαίως πιο αντικειμενική η εικόνα των διαγραμμάτων που εμφανίζονται στην εικόνα 1, αν το Υπουργείο Παιδείας έδινε τα στατιστικά στοιχεία με τρόπο που να διακρίνονται οι βαθμολογίες των υποψηφίων που ανήκουν στο 2ο επιστημονικό πεδίο σε όλα τα μαθήματα στα οποία αυτοί εξετάστηκαν και το ίδιο και για τις βαθμολογίες των μαθητών που ανήκουν στο 3ο επιστημονικό πεδίο.
Να επισημάνουμε ακόμη, ότι το 3ο πεδίο δεν επιλέγεται πλέον μόνο από άριστους μαθητές, αλλά και από πολλά παιδιά που ενδιαφέρονται για τα παραϊατρικά επαγγέλματα, τα οποία χαρακτηρίζονται από σχετικά υψηλό βαθμό επαγγελματικής αποκατάστασης, σε σχέση με πολλές άλλες ειδικότητες άλλων πεδίων. Επίσης το δεύτερο επιστημονικό πεδίο επιλέγεται όχι μόνο από αρίστους μαθητές, με στόχο τις υψηλόβαθμες πολυτεχνικές σχολές της μηχανικής, αλλά και από πολλούς άλλους μαθητές, εξαιτίας της μεγάλης ποικιλίας χαμηλόβαθμων, κυρίως περιφερικών, ΑΕΙ και ΑΤΕΙ, προκειμένου να εξασφαλίσουν την εισαγωγή τους σε κάποια σχολή

Αξίζει ωστόσο να σημειωθεί ότι λίγοι είναι οι μαθητές που εξετάζονται με αξιώσεις τόσο στο μάθημα των μαθηματικών όσο και στο μάθημα της Βιολογίας, οι μαθητές αυτοί είναι κατά κανόνα πολύ υψηλού επιπέδου μαθητές, οι οποίοι δεν έχουν αποφασίσει κατά την διάρκεια του έτους, αν θα ήθελαν να σπουδάσουν στο πολυτεχνείο ή στην ιατρική και έτσι θέλοντας να έχουν το δικαίωμα της επιλογής και όντας μαθητές πολύ υψηλού επιπέδου, αποφασίζουν να εξεταστούν και στα δυο αυτά πολύ απαιτητικά μαθήματα, οπού συνήθως τα καταφέρνουν εξίσου καλά και στα δυο.
Από την άλλη πλευρά, οι λιγότερο «δυνατοί» μαθητές που επιλεγούν και τα δυο αυτά μαθήματα, έχουν ως γνώμονα, ότι στο ένα από τα δυο μαθήματα δεν θα επενδύσουν ιδιαίτερη προσπάθεια και κόπο, άλλα θέλουν με αυτό τον τρόπο να “ανοίξουν” τις χαμηλόβαθμες σχόλες και των δυο επιστημονικών πεδίων, ώστε να εξασφαλίσουν την εισαγωγή τους σε κάποια από αυτές, χωρίς απαραίτητα να είναι η σχολή αυτή ο πραγματικός στόχος τους.
Πάντως οι μαθητές που δεν ανήκουν στην κατηγορία των άριστων, και αποφασίζουν να εξεταστούν τόσο στο μάθημα της Βιολογίας όσο και στο μάθημα των Μαθηματικών και επενδύουν ισάξια προσπάθεια και κόπο και στα δυο αυτά μαθήματα, συνήθως βγαίνουν χαμένοι τόσο σε επίπεδο κόπου όσο και σε τελικό αποτέλεσμα, καθώς είναι πραγματικά δύσκολο να επιτύχουν άριστες ή έστω πολύ υψηλές βαθμολογίες και στα δυο αυτά μαθήματα, που είναι τα πλέον απαιτητικά όπως προκύπτει πολύ εύκολα και από το παραπάνω διάγραμμα (Εικ. 1), από όλα τα θετικά μαθήματα των πανελλαδικών εξετάσεων.

Πέρα όμως από τα θετικά μαθήματα, αν επεκτείνουμε την έρευνά μας και για τα υπόλοιπα μαθήματα που εξετάζονται στις εισαγωγικές εξετάσεις μόνο για το έτος 2018, βλέπουμε ότι φέτος στο μάθημα των λατινικών και στο μάθημα Αρχές οικονομικής θεωρίας, η εικόνα είναι όπως φαίνεται, παρόμοια με την εικόνα της χημείας και της φυσικής των δυο προηγούμενων ετών, που όπως αναλύθηκε, δεν μπορούσαν πάρα να θεωρηθούν αποτυχημένα θέματα, μιας και δεν επιτυγχάνουν ικανοποιητική διάκριση μεταξύ των υποψηφίων, αφού το μεγαλύτερο ποσοστό των μαθητών επιτυγχάνουν βαθμολογίες μεταξύ 19-20! Σίγουρα και ο δρόμος των φιλολόγων και των οικονομολόγων είναι ακόμη μακρύς, για να επιτύχουν σωστή και αξιοκρατική κατανομή υποψηφίων στο μάθημα των λατινικών και των οικονομικών αντιστοίχως.

2018

Εικόνα 2: Κατανομή βαθμολογιών όλων των μαθημάτων έτους 2018

Ανακεφαλαιώνοντας λοιπόν, όπως προκύπτει από τη διαγραμματική ανάλυση των στατιστικών στοιχείων των πανελλαδικών εξετάσεων που δημοσιεύει κάθε χρόνο από το 2016 το Υπουργείο Παιδείας και αφορούν τις βαθμολογίες των υποψηφίων στην κλίμακα 10-20 ανά μία μονάδα, για τα μαθήματα που αφορούν τη θετική κατεύθυνση, φαίνεται πως υπάρχει μία βελτίωση από έτος σε έτος ώστε να προσεγγίσουν τα αποτελέσματα κατά ένα τρόπο την κανονική κατανομή σε όλα τα μαθήματα εκτός βεβαίως της Έκθεσης που το επιτυγχάνει κάθε χρόνο (παρόλο που φέτος ήταν περισσότεροι όσοι έγραψαν μεταξύ 10-14 από ότι 16-20). Η Βιολογία δείχνει να κινείται με ταχύτερο ρυθμό προς αυτόν τον στόχο, χωρίς όμως να βελτιώνονται οι προβληματικές παράμετροι που αναφέρθηκαν προηγουμένως (κάθε χρόνο: ασάφειες στις εκφωνήσεις και λανθασμένα τόσο επιστημονικώς όσο και παιδαγωγικός ερωτήματα των θεμάτων των πανελλαδικών εξετάσεων, συνοδευόμενα από λανθασμένες επιστημονικώς απαντήσεις, αλλά και πολύ μεγάλο ποσοστό διορθωτών που δεν είναι απαραίτητα γνώστες της επιστήμης της Βιολογίας), σε συνεπεία ο στόχος αυτός να επιτυγχάνεται πλασματικά. Αμέσως μετά έρχεται η Χημεία και τελευταία η Φυσική, που φαίνεται να κινείται πιο αργά από όλα τα θετικά μαθήματα προς αυτό τον στόχο. Τα Μαθηματικά είναι το μόνο μάθημα από τα θετικά, που εμφανίζει σταθερά ικανό τρόπο διάκρισης των μαθητών υποψηφίων, μιας και εμφανίζει και τα τρία χρόνια που μελετάμε αριστερή κατανομή ποσοστών.
Συνοψίζοντας επομένως, όπως διαμορφώνεται η εικόνα στη διαγραμματική παρουσίαση των βαθμολογίων των υποψηφίων για τις θετικές σπουδές κατά τα έτη 2016, 2017 και 2018 (Εικ.1), μπορούμε να εξάγουμε, πως έγιναν βήματα, αλλά χρειάζονται ακόμη και άλλα, κυρίως όμως προς την ποιοτική και όχι μόνο προς την ποσοτική βελτίωση της κατανομής, έτσι ώστε να φτάσουν τα θέματα και ο τρόπος διόρθωσής τους στα θετικά μαθήματα, να προσεγγίζουν την εικόνα της κανονικής κατανομής, η οποία αντιπροσωπεύει τον ανθρώπινο πληθυσμό σε χαρακτήρες όπως αυτούς που εξετάζονται σε αυτές τις εξετάσεις, για τους υποψηφίους..
Όμως πέρα από την στατιστική, δεν πρέπει να παραβλέπουμε και όσα αναφέρθηκαν προηγουμένως στην αρχή του άρθρου, για τους περιορισμούς και τις ισχυρές παθογένειες και στρεβλώσεις των πανελλαδικών εξετάσεων, με κύριο χαρακτηριστικό εδώ, το γεγονός ότι αυτοί οι αριθμοί που παρουσιάζονται στο παρόν άρθρο, δείχνουν μόνο την τάση για την κατανομή του πλήθους των υποψηφίων σε βαθμολογίες, δεν εξετάζεται όμως ο τρόπος που επιτυγχάνεται αυτό.
Μη ξεχνάμε για όλα τα μαθήματα την πολύ σημαντική παθογένεια της αποστήθισης των λεγομένων κατά γράμμα, των εντός εξεταστέας ύλης εδαφίων των σχολικών εγχειριδίων, με τα όσα λάθη τους και την περιορισμένη ύλη τους, χώρια από την παλαιότητα (τουλάχιστον για την βιολογία που η εξέλιξη της γίνεται με ταχύτατους ρυθμούς) της πληροφορίας που περιέχουν. Η στρέβλωση αυτή είναι αρκετή, για να είναι αδύναμη η οποία διακριτική ικανότητα των θεμάτων των πανελλαδικών εξετάσεων όσο επιτυχημένα και αν είναι αυτά.
Στόχος λοιπόν θα πρέπει να είναι οι πανελλαδικές εξετάσεις πέρα από αδιάβλητες να είναι και αξιοκρατικές, επιλέγοντας τους αυριανούς επιστήμονες της Χώρας μας, με κριτήρια που πραγματικά κατορθώνουν να κατανέμουν τους υποψηφίους όχι εκεί που έτυχε, άλλα εκεί που πέτυχαν με βάση τον κόπο και τα προσόντα τους.

Αξίζει να αναφερθεί ότι φέτος είναι η πρώτη χρονιά που γίνεται δυνατή η εισαγωγή παιδιών από τα ΕΠΑΛ σε όλα τα Εκπαιδευτικά Ιδρύματα της Τριτοβάθμιας Εκπαίδευσης της Χώρας, μεταξύ αυτών και σχολών όπως οι περιζήτητες Ιατρικές και οι Πολυτεχνικές (εδώ εξετάζονται μόνο τα θέματα των ΓΕΛ).

1Η διαγραμματική παρουσίαση των αποτελεσμάτων έγινε από τον οικονομολόγο Msc. Γ. Καρακατσάνη.
Πηγή δεδομένων: Επίσημα πίνακες του Υπουργείου Παιδείας για τα έτη 2016-2018 όπως αυτοί δημοσιεύθηκαν στο διαδίκτυο από τον ιστότοπο του Υπουργείου Παιδείας http://www.minedu.gr.

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 9ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗ ΓΕΩΡΓΙΑ ΚΑΙ ΤΗΝ ΚΤΗΝΟΤΡΟΦΙΑ

ΘΕΜΑ Α

 2000 ΗΜΕΡΗΣΙΟ

  1. Το πλασμίδιο Tiχρησιμοποιείται στη διαδικασία:

α.δημιουργίας διαγονιδιακών ζώων

β.δημιουργίας διαγονιδιακών φυτών

γ.παραγωγής ιντερφερόνης

δ.παραγωγής ινσουλίνης

Μονάδες 5

2001 ΗΜΕΡΗΣΙΟ

  1. Για να δημιουργήσουμε διαγονιδιακά φυτά χρησιμοποιούμε:

α.τη μέθοδο της μικροέγχυσης

β.τη μέθοδο της διαμόλυνσης

γ.το πλασμίδιο Ti.

Μονάδες 2

Να αιτιολογήσετε την επιλογή σας.

Μονάδες 3

2002 ΟΜΟΓΕΝΕΙΣ

Β.1.Τι είναι τα διαγονιδιακά ζώα;

Μονάδες 5

2003 ΕΣΠΕΡΙΝΟ

4.Το πλασμίδιο Ti

α.υπάρχουν σε όλα τα βακτήρια.

β.χρησιμοποιείται στη μικροέγχυση.

γ.χρησιμοποιείται στη γενετική τροποποίηση φυτών.

δ.υπάρχειστοBacillus thuringiensis.

Μονάδες 5

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

3.Το πλασμίδιο Tiχρησιμοποιείται στη γονιδιακή θεραπεία της κυστικής ίνωσης. (Σ-Λ)

Μονάδες 2

2003 ΟΜΟΓΕΝΕΙΣ

1.Διαγονιδιακά φυτά ονομάζονται αυτά τα οποία

α.έχουν υποστεί την επίδραση φυτοφαρμάκων.

β.προέκυψαν μετά από χρήση αντιβιοτικών.

γ.δε δίνουν απογόνους.

δ.έχουν υποστεί γενετική αλλαγή με τη χρήση τεχνικών γενετικής μηχανικής.

Μονάδες 5

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

4.Το πλασμίδιο Tiαπομονώνεται από …

α.τα βακτήρια του γένους Lactobacillus.

β.τοβακτήριοBacillus thuringiensis.

γ.τοβακτήριοAgrobacterium tumefaciens.

δ.τα βακτήρια του γένους Clostridium.

Μονάδες 5

2006 ΗΜΕΡΗΣΙΟ

  1. Η μικροέγχυση είναι μέθοδος

α.παραγωγής διαγονιδιακών ζώων.

β.εισαγωγής ξένου DNAσε ιούς.

γ.παραγωγής διαγονιδιακών φυτών.

δ.παραγωγής μονοκλωνικών αντισωμάτων.

Μονάδες 5

2007 ΕΣΠΕΡΙΝΟ

5.Το βακτήριο Bacillusthuringiensis

α. προκαλεί καρκίνο στα φυτά.

               β.χρησιμοποιείται για τη δημιουργία διαγονιδιακών ζώων.

               γ.παράγει μια τοξίνη με εντομοκτόνο δράση.

               δ.προκαλεί το μετασχηματισμό των κυττάρων.

Μονάδες 3

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

  1. Το πλασμίδιο Ti

α.απομονώνεται από το βακτήριοBacillusthuringiensis.

β.απομονώνεται από το βακτήριο Escherichiacoli.

γ.ενσωματώνεται στο γενετικό υλικό των φυτικών κυττάρων.

δ.ενσωματώνεται στο γενετικό υλικό των ζωικών κυττάρων.

Μονάδες 5

2007 ΟΜΟΓΕΝΕΙΣ

5.Στη μέθοδο της μικροέγχυσης χρησιμοποιούνται

α.Β-λεμφοκύτταρα.

β.πλασμίδια.

γ.καρκινικά κύτταρα.

δ.γονιμοποιημένα ωάρια ζώων.

Μονάδες 5

2008 ΗΜΕΡΗΣΙΟ

5.Τα ζώα, που έχουν υποστεί γενετική τροποποίηση λέγονται:

α.πολυγενετικά.

β.διαγονιδιακά.

γ.πολυπλοειδικά.

δ.πολυγονικά.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

3.Το βακτήριο Bacillusthuringiensisπου ζει στο έδαφος

α.παράγει μια ισχυρή τοξίνη.

β.εκκρίνει μια χρήσιμη ορμόνη.

γ.επιβιώνει για πολύ χρόνο.

δ.μολύνει τα διαγονιδιακά ζώα.

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

5.Το πλασμίδιο Tiαπομονώνεται από τα βακτήρια

α. Agrobacterium tumefaciens.

β.Bacillus thuringiensis.

γ.τουγένουςClostridium.

δ.τουγένουςLactobacillus.

Μονάδες 5

2009 ΗΜΕΡΗΣΙΟ

  1. Σε άτομα που πάσχουν από μια μορφή εμφυσήματος χορηγείται

α.παράγοντας ΙΧ.

β.αυξητική ορμόνη.

γ.ινσουλίνη.

δ.α1-αντιθρυψίνη.

Μονάδες 5

  1. Διαγονιδιακά είναι φυτά

α.τα οποία έχουν υποστεί γενετική αλλαγή.

β.στα οποία έχουν εισαχθεί ορμόνες.

γ.τα οποία έχουν εμβολιαστεί με αντιγόνα invitro.

δ.στα οποία έχουν εισαχθεί αντιβιοτικά.

Μονάδες 5

2009 ΕΣΠΕΡΙΝΟ

1.Το πλασμίδιο Tiεντοπίζεται στο βακτήριο

α. πνευμονιόκοκκος(Diplococcus pneumoniae).

β.Escherichia coli.

γ.Bacillus thuringiensis.

δ.Agrobacterium tumefaciens.

Μονάδες5

2009 ΕΠΑΝΑΛΗΠΤΙΚΑΗΜΕΡΗΣΙΟΥ

  1. Το πλασμίδιο Ti

α.προέρχεται από το βακτήριο Escherichiacoli.

β.προκαλεί καθυστέρηση στην αύξηση του φυτού.

γ.εισάγεται με μικροέγχυση στα φυτικά κύτταρα.

δ.προκαλεί όγκους στα φυτά στα οποία εισέρχεται.

Μονάδες 5

2010 ΕΣΠΕΡΙΝΟ

Α3. Τα διαγονιδιακά ζώα χρησιμοποιούνται για την παραγωγή

α.αυξητικής ορμόνης.

β.μικροβιακής βιομάζας.

γ.νουκλεϊκών οξέων.

δ.σακχάρων.

Μονάδες 5

Α5. Το πλασμίδιο Ti

α.υπάρχει σε πολλά είδη βακτηρίων.

β.βρίσκεται στο βακτήριοAgrobacteriumtumefaciens.

γ.ενσωματώνεται στο γενετικό υλικό των ζωικών κυττάρων.

δ.απομονώνεται από τους ιούς.

Μονάδες 5

2011 ΗΜΕΡΗΣΙΟ

Α3. Το πλασμίδιο Tiχρησιμοποιείται στη διαδικασία

α.της μικροέγχυσης.

β.δημιουργίας διαγονιδιακών ζώων.

γ.δημιουργίας διαγονιδιακών φυτών.

δ.παραγωγής υβριδωμάτων.

Μονάδες 5

2011 ΟΜΟΓΕΝΕΙΣ

Α3. Το πλασμίδιο Ti

α. υπάρχειστοBacillus thuringiensis.

β.χρησιμοποιείται στη μικροέγχυση.

γ.χρησιμοποιείται για τη γενετική τροποποίηση φυτών.

δ.χρησιμοποιείται για τη γενετική τροποποίηση ζώων.

Μονάδες 5

2012 ΕΣΠΕΡΙΝΟ

Α5. Στα άτομα που πάσχουν από σακχαρώδη διαβήτη χορηγείται

α.α1-αντιθρυψίνη

β.παράγοντας ΙΧ

γ.ινσουλίνη

δ.αυξητική ορμόνη.

Μονάδες 5

2012 ΟΜΟΓΕΝΕΙΣ

Α5. Γενετικά τροποποιημένα ονομάζονται τα φυτά, τα οποία έχουν

α.υποστεί γενετική αλλαγή με τη χρήση των τεχνικών της Γενετικής Μηχανικής.

β.προσλάβει αντιβιοτικά.

γ.προσλάβει ορμόνες.

δ.προκύψει από επιλεγμένες διασταυρώσεις.

Μονάδες 5

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α5. Το Agrobacteriumtumefaciens

α.παράγει μια ισχυρή τοξίνη δραστική στα έντομα

β.χρησιμοποιείται για τη δημιουργία διαγονιδιακών φυτών

γ.χρησιμοποιείται στη μέθοδο της μικροέγχυσης

δ.χρησιμοποιείται στη γονιδιακή θεραπεία.

Μονάδες 5

2014 ΟΜΟΓΕΝΕΙΣ

Α5. Το πλασμίδιο Tiπροέρχεται από

α. τοBacillus thuringiensis

β.τοAgrobacterium tumefaciens

γ.τοEscherichia coli

δ.βακτήριατουγένουςClostridium.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ

Α3.Για τη θεραπεία του εμφυσήματος χρησιμοποιείται

α.η α1-αντιθρυψίνη

β.η ινσουλίνη

γ.ο παράγοντας VIII

δ.η αυξητική ορμόνη.

Μονάδες 5 

2015 ΕΣΠΕΡΙΝΟ

Α4. Το πλασμίδιο Tiβρίσκεται στο βακτήριο

α. E. coli

β.Bacillus thuringiensis

γ. Lactobacillus

δ. Agrobacterium tumefaciens.

Μονάδες5

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α4. Για τη θεραπεία του διαβήτη χρησιμοποιούμε

α.α1-αντιθρυψίνη

β.ιντερφερόνες

γ.ινσουλίνη

δ.παράγοντα ΙΧ.

Μονάδες 5

Α5.Τα γενετικά τροποποιημένα φυτά ποικιλίας Btείναι ανθεκτικά σε

α.εντομοκτόνα

β.ζιζανιοκτόνα

γ.παγετό

δ.έντομα και σκώληκες.

Μονάδες 5

2015 ΟΜΟΓΕΝΕΙΣ

Α5. Η μικροέγχυση χρησιμοποιείται για τη δημιουργία

α.διαγονιδιακών φυτών

β.διαγονιδιακών ζώων

γ.γονιδιωματικής βιβλιοθήκης

δ.cDNAβιβλιοθήκης.

Μονάδες 5

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α3. Τα σωματικά κύτταρα του προβάτου Dollyπεριείχαν

α.ανασυνδυασμένο DNA

β.το σύνολο του γενετικού υλικού του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου που χρησιμοποιήθηκε στη διαδικασία της κλωνοποίησης

γ.το γονίδιο που είναι υπεύθυνο για τη σύνθεση της ανθρώπινης α1-αντιθρυψίνης

δ.το μιτοχονδριακό DNAτου ωαρίου στο οποίο τοποθετήθηκε ο πυρήνας του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου.

Μονάδες 5

Α5. Το πλασμίδιο Ti

α.δημιουργεί εξογκώματα στο βακτήριο Agrobacteriumtumefaciens

β.απομονώθηκε από τον βακτηριοφάγο Τ2

γ.είναι κυκλικό δίκλωνο μόριο DNA

δ.χρησιμοποιείται στη γονιδιακή θεραπεία της κυστικής ίνωσης.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α5. Η κλωνοποίηση είναι τεχνική που

α.δεν μπορεί να εφαρμοστεί σε μια καλλιέργεια μικροοργανισμών

β.εφαρμόζεται μόνο στους μικροοργανισμούς

γ.οδηγείται σε ένα σύνολο από διαφορετικούς οργανισμούς

δ.μπορεί να συνεισφέρει στην προστασία από την εξαφάνιση διαφόρων ζώων του πλανήτη μας.

Μονάδες 5

2016 ΟΜΟΓΕΝΕΙΣ

Α5. Τα γενετικά τροποποιημένα φυτά ποικιλίας Btείναι ανθεκτικά

α.στον παγετό

β.στα έντομα

γ.στην ξηρασία

δ.στα ζιζανιοκτόνα.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ) 

Α2. Το πλασμίδιο Ti

α.απομονώνεται από τους χλωροπλάστες φυτικών κυττάρων

β.απομονώνεται από τα μιτοχόνδρια φυτικών κυττάρων

γ.περιέχει γονίδια που δημιουργούν όγκους

δ.είναι γραμμικό δίκλωνο μόριο DNAπου απομονώνεται από βακτήρια.

Μονάδες 5 

2018 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α2. Σε άτομα που πάσχουν από αιμορροφιλία Β χορηγείται:

α. αυξητική ορμόνη

β. παράγοντας ΙΧ

γ. α1-αντιθρυψίνη

δ. παράγοντας VIII.

Μονάδες 5

2018 ΗΜΕΡΗΣΙΟ

Α5. Την πρωτεΐνη α1-αντιθρυψίνη θα την εντοπίσουμε σε βακτηριακό κλώνο cDNA βιβλιοθήκης που έχει κατασκευαστεί από ώριμο mRNA κυττάρων

α. παγκρέατος

β. ήπατος

γ. στομάχου

δ. μυελού των οστών.

Μονάδες 5

2018 ΕΣΠΕΡΙΝΟ

Α4. Η γενετική τροποποίηση αγελάδων γίνεται με την εισαγωγή ξένου DNA στον πυρήνα:

α.ενός ωαρίου

β.ενός σπερματοζωαρίου

γ.ενός ζυγωτού

δ.ενός μαστικού κυττάρου.

Μονάδες 5

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ

Α1. Η πρωτεΐνη παράγοντας ΙΧχρησιμοποιείται

α. στη θεραπεία του εμφυσήματος.

β. στον μεταβολισμό των υδατανθράκων.

γ. στη θεραπεία της κυστικής ίνωσης.

δ. στον μηχανισμό πήξης του αίματος.

Μονάδες 5

Α2. Από την αυτογονιμοποίηση ενός διαγονιδιακού φυτού Bt που δημιουργήθηκε μετά από τον μετασχηματισμό του με Agrobacterium, το ποσοστό των ομόζυγων ανθεκτικών απογόνων είναι

α. 0%

β. 25%

γ. 50%

δ. 75%

Μονάδες 5

ΘΕΜΑ Β

2001 ΕΣΠΕΡΙΝΟ

  1. Με τη Βιοτεχνολογία, η παραγωγή φαρμακευτικών πρωτεϊνών μπορεί να γίνει από ____________ ζώα.

Μονάδες 2

ΗΜΕΡΗΣΙΟ 2002

1.Να περιγράψετε τη διαδικασία για την παραγωγή στελέχους καλαμποκιού, ποικιλίας Bt.

Μονάδες 10 

2003 ΗΜΕΡΗΣΙΟ

2.Το 1997 οι ερευνητές του Ινστιτούτου Roselinτης Σκωτίας ανακοίνωσαν ότι κλωνοποίησαν ένα πρόβατο (Dolly). Ποια διαδικασία ακολούθησαν;

Μονάδες 10

2004 ΗΜΕΡΗΣΙΟ

Να απαντήσετε στις παρακάτω ερωτήσεις:

  1. Ποια βήματα απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο;

Μονάδες 9

2004 ΟΜΟΓΕΝΕΙΣ

Αα. Να αναφέρετε τα βήματα που απαιτούνται για την παραγωγή φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 12

β.Τι είναι η μικροέγχυση;

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

Να απαντήσετε στις παρακάτω ερωτήσεις:

1.Ποια είναι τα πλεονεκτήματα της χρησιμοποίησης διαγονιδιακών ζώων και φυτών για την αύξηση της ζωικής και φυτικής παραγωγής έναντι της κλασικής μεθόδου των διασταυρώσεων;

Μονάδες 7

2005 ΕΣΠΕΡΙΝΟ

Α.Να γράψετε στο τετράδιό σας τον αριθμό κάθε στοιχείου της Στήλης Ι και δίπλα στον αριθμό αυτό το γράμμα από στοιχείο της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                         Στήλη Ι                                                      Στήλη ΙΙ

  1. αντικωδικόνιο                                             α.αδελφές χρωματίδες

                   2.κεντρομερίδιο                                        β. ορμόνη

                   3.βιοαντιδραστήρας                                  γ. υβρίδωμα

                   4.διαγονιδιακά ζώα                                  δ. tRNA

                   5.ινσουλίνη                                              ε. μικροέγχυση

                                                                                     ζ. ιντερφερόνη

                                                                                     η.ζύμωση

Μονάδες 10

  1. Το πλασμίδιο Tiυπάρχει σε όλα τα διαγονιδιακά ζώα.(Σ-Λ)

Μονάδες 3 

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Να απαντήσετε στις παρακάτω ερωτήσεις:

1.Τι δυνατότητες δίνουν στους αγρότες τα γενετικά τροποποιημένα φυτά  (Μονάδες 4) και ποια είναι τα κυριότερα φυτά που έχουν τροποποιηθεί γενετικά (Μονάδες 5);

Μονάδες 9

2005 ΟΜΟΓΕΝΕΙΣ

  1. Τι είναι το πλασμίδιο Tiκαι πώς χρησιμοποιείται για τη δημιουργία των διαγονιδιακών φυτών;

Μονάδες 9 

2006 ΕΣΠΕΡΙΝΟ

  1. Οι γενετικά τροποποιημένες τομάτες δημιουργούνται με ελεγχόμενες διασταυρώσεις. (Σ-Λ)

Μονάδες 3

2006 ΟΜΟΓΕΝΕΙΣ

2.Ποια ονομάζουμε διαγονιδιακά ζώα και με ποιο τρόπο δημιουργούνται;

Μονάδες 9

2007 ΕΣΠΕΡΙΝΟ

Β.Να γράψετε στο τετράδιό σας το γράμμα κάθε στοιχείου της Στήλης Ι και δίπλα στο γράμμα αυτό τον αριθμό ενός στοιχείου της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                   Στήλη Ι                                                      Στήλη ΙΙ

(ασθένεια)                                   (φαρμακευτική ουσία που ενδείκνυται)

α. διαβήτης                                                1.α1-αντιθρυψίνη

                   β.καρκίνος                                               2. απαμινάση της αδενοσίνης

                   γ.εμφύσημα                                              3. ιντερφερόνες

                   δ.κληρονομική ανεπάρκεια                      4. παράγοντας ΙΧ

                   ανοσοποιητικού συστήματος                    5. φαινυλαλανίνη

                   ε.αιμορροφιλία Β                                      6.αυξητική ορμόνη

                                                                                     7.ινσουλίνη

Μονάδες 10

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

4.Ποια διαδικασία ακολούθησαν οι ερευνητές του Ινστιτούτου Roselinτης Σκωτίας για τη δημιουργία ενός κλωνοποιημένου προβάτου;

Μονάδες 6

2008 ΟΜΟΓΕΝΕΙΣ

3.Ποια ζώα ονομάζονται διαγονιδιακά και πού χρησιμοποιούνται;

Μονάδες 6

2009 ΕΣΠΕΡΙΝΟ

Α.Να γράψετε στο τετράδιό σας τον αριθμό κάθε στοιχείου της Στήλης Ικαι, δίπλα σε κάθε αριθμό, το γράμμα από στοιχείο της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν:

                         Στήλη Ι                                                      Στήλη ΙΙ

  1. διαβήτης                                                    α.αδελφές χρωματίδες

                   2.διαγονιδιακά ζώα                        β. ριβονουκλεοπρωτεϊνικά “σωματίδια”

                   3.κεντρομερίδιο                               γ. ινσουλίνη

                   4.ωρίμανση mRNA                         δ. μικροέγχυση

                   5.βιοαντιδραστήρας                         ε. ιντερφερόνη

                                                                            ζ.ζύμωση

                                                                            η.περιοριστικές ενδονουκλεάσες

Μονάδες 10

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

  1. Να περιγράψετε τη διαδικασία της κλωνοποίησης με την οποία δημιουργήθηκε το πρόβατο «Dolly».

Μονάδες 6

2009 ΟΜΟΓΕΝΕΙΣ

  1. Να αναφέρετε τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 9

2010 ΕΣΠΕΡΙΝΟ

Β1.Να γράψετε στο τετράδιό σας τα γράμματα της Στήλης Ι και δίπλα σε κάθε γράμμα, τον αριθμό της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                       Στήλη Ι                                                            Στήλη ΙΙ

α.πριμόσωμα                                                       1.ημιαυτόνομο οργανίδιο

       β.πολύσωμα                                                        2. πλασμίδιο

       γ.χλωροπλάστης                                                 3. μεταγραφή

       δ.φορέας κλωνοποίησης                                    4. ζύμωση

       ε.καρυότυπος                                                       5. μετάφραση

                                                                                     6.αντιγραφή

                                                                                     7.μεταφασικά χρωμοσώματα

Μονάδες 10

  1. Η εισαγωγή ξένου DNAσε γονιμοποιημένο ωάριο γίνεται με τη μέθοδο της ……. .

Μονάδες 2

2011 ΕΣΠΕΡΙΝΟ

Β1.Να γράψετε στο τετράδιό σας τα γράμματα της Στήλης Ι και δίπλα σε κάθε γράμμα, τον αριθμό της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία τηςΣτήλης ΙΙ περισσεύουν.

                       Στήλη Ι                                                            Στήλη ΙΙ

α.invivoγονιδιακή θεραπεία                               1.μικροέγχυση

       β.γενετική τροποποίηση ζώων                           2. περιοριστική ενδονουκλεάση

       γ.ημιαυτόνομα οργανίδια                                     3. ριβοσώματα

       δ.ένζυμο που συνδέει τμήματα DNA                   4. RNAπολυμεράση

       ε.πλασμίδιο Ti                                                      5. DNAδεσμάση

       στ. σύνθεση κυτταροπλασματικών πρωτεϊνών   6.μιτοχόνδρια

                                                                                     7.Agrobacteriumtumefaciens

                                                                                     8.κυστική ίνωση

Μονάδες 12

2012 ΗΜΕΡΗΣΙΟ

Β2. Να περιγράψετε τη διαδικασία κλωνοποίησης με την οποία δημιουργήθηκε το πρόβατο Dolly.

Μονάδες 7

2013 ΗΜΕΡΗΣΙΟ 

Β2. Να περιγράψετε τη μέθοδο της μικροέγχυσης.

Μονάδες 6

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ 

Β1. Ποια μειονεκτήματα παρουσιάζει η καταπολέμηση παρασίτων και εντόμων με χημικά εντομοκτόνα (μονάδες 2); Να αναφέρετε τους εναλλακτικούς τρόπους που βρέθηκαν για την αντιμετώπιση του προβλήματος αυτού (μονάδες 6).

Μονάδες 8

2013 ΟΜΟΓΕΝΕΙΣ

Β4. Ποια είναι τα πλεονεκτήματα από τη χρησιμοποίηση διαγονιδιακών φυτών και ζώων, έναντι της κλασικής μεθόδου των διασταυρώσεων, για την αύξηση της φυτικής και ζωικής παραγωγής;

Μονάδες 6

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Β4. Ποια ζώα ονομάζονται διαγονιδιακά;

Μονάδες 2

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β4. Να εξηγήσετε με ποιον τρόπο μπορεί να επιτευχθεί η βελτίωση της φυτικής και ζωικής παραγωγής εκτός από τη χρήση μεθοδολογιών Γενετικής Μηχανικής.  (μονάδες 4) Ποια είναι τα μειονεκτήματα από την εφαρμογή αυτής της μεθόδου; (μονάδες 3)

Μονάδες 7

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β2. α. Κατά τη δημιουργία των διαγονιδιακών ζώων χρησιμοποιούνται ωάρια που έχουν γονιμοποιηθεί στο εργαστήριο. Σωστό ή Λάθος

Μονάδα 1

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ 

Β4. Μια φαρμακευτική πρωτεΐνη που προορίζεται για ανθρώπινη χρήση, μπορεί να παραχθεί από το γάλα γενετικά τροποποιημένων θηλαστικών, από βακτήρια και από όργανα θηλαστικών που δεν είναι γενετικά τροποποιημένα.

Να αναφέρετε τους λόγους, για τους οποίους προτιμούμε να παράγουμε αυτή την πρωτεΐνη όχι από βακτήρια (μονάδες 2) ή από όργανα θηλαστικών (μονάδες 4), αλλά από το γάλα γενετικά τροποποιημένων θηλαστικών.

Μονάδες 6

2016 ΕΣΠΕΡΙΝΟ

Β5. Σε τι αναφέρονται οι όροι «κλώνος» και «κλωνοποίηση»;

Μονάδες 4

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β1. Στα φυτικά κύτταρα δεν αναμένουμε να υπάρχουν πλασμίδια. Πώς εξηγείται το γεγονός ότι σε ορισμένα φυτικά κύτταρα εντοπίζονται πλασμίδια;

Μονάδες 6

2016 ΟΜΟΓΕΝΕΙΣ

Β1. Να αντιστοιχίσετε σωστά τον αριθμό (1, 2, 3, 4και 5) καθεμιάς από τις πρωτεΐνες της στήλης Ιμε το γράμμα της εφαρμογής (Α, Β, Γ, Δκαι Ε) που αναφέρεται στη στήλη ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. α1αντιθρυψίνη Α: Αντιιικός παράγοντας
2. Παράγοντας VIII B:Αιμορροφιλία Α
3. Παράγοντας ΙΧ Γ: Εμφύσημα
4. Ιντερφερόνες Δ: Τεστ κύησης
5. Μονοκλωνικά αντισώματα Ε: Αιμορροφιλία Β

 

Μονάδες 5

2018 ΕΣΠΕΡΙΝΟ

Β1. Να αντιστοιχίσετε τον κάθε αριθμό της στήλης Ι με ένα μόνο γράμμα της στήλης ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. Περιοριστική ενδονουκλεάση α. Πολυσακχαρίτης
2. Πρωταρχικό τμήμα
3. Πριμόσωμα β. Νουκλεϊκό οξύ
4. Άγαρ
5. Αντίσωμα γ. Πρωτεΐνη
6. Απαμινάση της αδενοσίνης
7. Πλασμίδιο

 

Μονάδες 7

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ

Β2. Να διατάξετε με τη σωστή χρονική σειρά τα παρακάτω στάδια που αφορούν στην κλωνοποίηση του προβάτου Dolly. Αποτυπώστε στο τετράδιό σας τη σωστή σειρά χρησιμοποιώντας μόνο τα γράμματα α έως στ.

α. εισαγωγή ενός πυρήνα από κύτταρο του μαστικού αδένα σε απύρηνο ωάριο.

β.μεταφορά του εμβρύου σε θετή μητέρα.

γ.διαίρεση του κυττάρου που προέκυψε με τη βοήθεια ηλεκτρικής διέγερσης.

δ.λήψη κυττάρων από τον μαστικό αδένα ενός προβάτου και αφαίρεση του πυρήνα τους.

ε.κυοφορία και γέννηση του προβάτου Dolly.

στ.απομόνωση ωαρίου από άλλο πρόβατο και απομάκρυνση του πυρήνα.

Μονάδες 6

ΘΕΜΑ Γ

Β. Να γράψετε τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 9

2001 ΕΣΠΕΡΙΝΟ 

Να απαντήσετε στις δύο ερωτήσεις που ακολουθούν:

  1. Τα έντομα δημιουργούν μεγάλα προβλήματα στη γεωργία και οδηγούν σε σημαντική μείωση της παραγωγής. Γνωρίζετε αν η Βιοτεχνολογία μπορεί να βοηθήσει στην καταπολέμηση των εντόμων και με ποιο τρόπο μπορεί να γίνει αυτό;

Μονάδες 10

  1. Η ινσουλίνη είναι μία πρωτεΐνη που παράγεται από τον ανθρώπινο οργανισμό όπως και η αντιθρυψίνη (ΑΤΤ). Με ποιο τρόπο θα μπορούσε να παραχθεί η ινσουλίνη αν αξιοποιούσαμε τις δυνατότητες της γενετικής μηχανικής και τις ιδιότητες που έχουν τα διαγονιδιακά ζώα;

Μονάδες 15

2002 ΕΣΠΕΡΙΝΟ

Β.Να περιγράψετε από μία μέθοδο μεταφοράς γονιδίων

1.σε φυτά.

2.σε ζώα.

Μονάδες 12

2003 ΕΣΠΕΡΙΝΟ

Α.Το βακτήριοBacillusthuringiensisπου ζει στο έδαφος, παράγει μια τοξίνη η οποία είναι ισχυρότατο εντομοκτόνο. Ποια είναι τα στάδια της διαδικασίας παραγωγής ενός γενετικά τροποποιημένου φυτού που παρουσιάζει αντοχή στα έντομα αξιοποιώντας την παραπάνω ιδιότητα του βακτηρίου αυτού;

Μονάδες 10

Β.Τι είναι τα διαγονιδιακά ζώα;

Μονάδες 5

Ποια πλεονεκτήματα έχει η χρήση των ζώων αυτών για την αύξηση της ζωικής παραγωγής έναντι της κλασικής μεθόδου των διασταυρώσεων;

Μονάδες 10

2004 ΕΣΠΕΡΙΝΟ 

Α. Τι είναι τα διαγονιδιακά ή γενετικά τροποποιημένα φυτά;

Μονάδες 5

Β. Να περιγράψετε τη μέθοδο δημιουργίας των διαγονιδιακών φυτών.

Μονάδες 15

Γ. Να αναφέρετε δύο δυνατότητες που μπορούν να προσφέρουν στους αγρότες τα γενετικά τροποποιημένα φυτά.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

Η παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης μπορεί να γίνει και από τα διαγονιδιακά ζώα.

  1. Ποια είναι τα βήματα της διαδικασίας που προηγούνται της γέννησης ενός διαγονιδιακού ζώου;

Μονάδες 6

  1. Εκτός από τα διαγονιδιακά ζώα, από ποιους άλλους οργανισμούς είναι δυνατή η παραγωγή ανθρώπινης φαρμακευτικής πρωτεΐνης και σε ποιο χαρακτηριστικό του γενετικού κώδικα στηρίζεται η δυνατότητα αυτή;

Μονάδες 10

  1. Γιατί η κλωνοποίηση είναι χρήσιμη για τον πολλαπλασιασμό των διαγονιδιακών ζώων;

Μονάδες 9

2007 ΗΜΕΡΗΣΙΟ

Η Βιοτεχνολογία με την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA, τη χρήση της τεχνικής PCRκαι την παραγωγή μονοκλωνικών αντισωμάτων συνεισφέρει σε τομείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική.

3.Να περιγράψετε τη διαδικασία παραγωγής διαγονιδιακών φυτών, ανθεκτικών στα έντομα, με τη χρήση της τεχνολογίας του ανασυνδυασμένου DNAκαι του βακτηρίου Bacillusthuringiensis.

Μονάδες 10

2007 ΕΣΠΕΡΙΝΟ

Για τη δημιουργία ενός κλωνοποιημένου προβάτου – όπως ήταν η Dolly– χρησιμοποιούνται τρία πρόβατα Α, Β, Γ. Από το πρόβατο Α απομονώνεται ο πυρήνας από κύτταρο των μαστικών αδένων. Από ένα ωάριο του προβάτου Β αφαιρείται ο πυρήνας και στη θέση του εισάγεται ο πυρήνας του κυττάρου από το πρόβατο Α. Προκύπτει έτσι ένα νέο κύτταρο. Το κύτταρο αυτό υφίσταται λίγες διαιρέσεις και το έμβρυο που προκύπτει εμφυτεύεται στη μήτρα του προβάτου Γ. Μετά από λίγους μήνες γεννιέται το νέο πρόβατο (πρόβατο Δ).

2019-02-19, 22.26.37

1.Ποιο από τα πρόβατα Α, Β, Γ έχει ταυτόσημο πυρηνικό DNAμε το πρόβατο Δ και γιατί;

Μονάδες 8

2.Ποιο από τα πρόβατα Α, Β, Γ έχει ταυτόσημο μιτοχονδριακό DNAμε το πρόβατο Δ και γιατί;

Μονάδες 8

3.Με ποιο τρόπο η κλωνοποίηση μπορεί να συνεισφέρει στην προστασία από την εξαφάνιση διαφόρων ζωικών οργανισμών του πλανήτη μας;

Μονάδες 9

2010 ΗΜΕΡΗΣΙΟ 

Γ2. Να αναφέρετε ποιους τύπους αιμορροφιλίας γνωρίζετε και πού οφείλονται (μονάδες 2). Να περιγράψετε τη διαδικασία αντιμετώπισης μίας εξ αυτών, με βάση τη μέθοδο δημιουργίας διαγονιδιακών ζώων (μονάδες 6).

Μονάδες 8 

2016 ΕΣΠΕΡΙΝΟ

Γ3. «Στη μέθοδο αυτή χρησιμοποιούνται ωάρια του ζώου που έχουν γονιμοποιηθεί στο εργαστήριο. Σε αυτά γίνεται εισαγωγή του ξένου DNAμε ειδική μικροβελόνα. Το ξένο γενετικό υλικό ενσωματώνεται συνήθως σε κάποιο από τα χρωμοσώματα του πυρήνα του ζυγωτού».

Πώς ονομάζεται η μέθοδος που περιγράφεται στο παραπάνω κείμενο – απόσπασμα από το σχολικό βιβλίο (μονάδες 3) και πώς οι οργανισμοί που δημιουργούνται με αυτή τη μέθοδο (μονάδες 2);

Μονάδες 5

Γ4. Να αναφέρετε τα ονόματα δύο τουλάχιστον ειδών ζώων που δημιουργούνται αποκλειστικά με την παραπάνω μέθοδο.

Μονάδες 4

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ1. Το 1997 οι ερευνητές του Ινστιτούτου Roselinτης Σκωτίας ανακοίνωσαν ότι κλωνοποίησαν το πρόβατο Dolly. Τα γονίδια που έφεραν τα κύτταρα της Dollyπροέρχονταν από ένα ή περισσότερα πρόβατα; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 6)

Μονάδες 8

2018 ΗΜΕΡΗΣΙΟ

Δ3.Ένα είδος διπλοειδούς φυτού έχει δέκα χρωμοσώματα. Ένας ερευνητής έχει στη διάθεσή του δύο Βt διαγονιδιακά φυτά αυτού του είδους. Στο πρώτο, το γονίδιο της τοξίνης έχει ενσωματωθεί σε ένα από τα δύο ομόλογα χρωμοσώματα του πρώτου ζεύγους ενώ το δεύτερο σε ένα από τα δύο ομόλογα χρωμοσώματα του τέταρτου ζεύγους. Εάν τα δύο αυτά φυτά διασταυρωθούν μεταξύ τους, να γράψετε το ποσοστό των απογόνων της F1 γενιάς που θα είναι ανθεκτικά στα έντομα (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 3).

Μονάδες 5

Δεν απαιτείται η διατύπωση των νόμων του Mendel.

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 8ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ

ΘΕΜΑ Α

2003 ΕΣΠΕΡΙΝΟ

1.Οι ιντερφερόνες είναι

α.αντιικές πρωτεΐνες που παράγονται από κύτταρα που έχουν μολυνθεί από ιούς.

β.ένζυμα που ελέγχουν το μεταβολισμό των σακχάρων.

γ.πρωτεΐνες που προκαλούν σύντηξη των καρκινικών κυττάρων.

δ.χημικές ενώσεις που προκαλούν αλλαγές στα γονίδια.

Μονάδες 5

2003 ΟΜΟΓΕΝΕΙΣ

5.Τα μονοκλωνικά αντισώματα παράγονται από

α.καρκινικά κύτταρα.

β.έναν κλώνο Β-λεμφοκυττάρων.

γ.βακτήρια.

δ.ερυθρά αιμοσφαίρια.

Μονάδες 5

2004 ΗΜΕΡΗΣΙΟ

  1. Οι ιντερφερόνες που χρησιμοποιεί σήμερα ο άνθρωπος είναι δυνατόν να παράγονται σε μεγάλες ποσότητες από …

α.κύτταρα ανθρώπου.

β.κύτταρα ζώων.

γ.γενετικά τροποποιημένα βακτήρια.

δ.φυτικά κύτταρα.

Μονάδες 5

2004 ΕΣΠΕΡΙΝΟ

  1. Η ινσουλίνη είναι μια ορμόνη που ρυθμίζει

α.το μεταβολισμό των υδατανθράκων στο αίμα.

β.τη συγκέντρωση των πρωτεϊνών στο αίμα.

γ.τη συγκέντρωση των αλάτων στο αίμα.

δ.το μεταβολισμό της χοληστερόλης.

Μονάδες 5

2004 ΟΜΟΓΕΝΕΙΣ

  1. Οι ιντερφερόνες είναι πρωτεΐνες που παράγονται από κύτταρα

α.που μολύνθηκαν από ιούς.

β.που μολύνθηκαν από μύκητες.

γ.ατόμων με χρωμοσωμικές ανωμαλίες.

δ.μόνο φυτικών οργανισμών.

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

3.Exvivoονομάζεται η γονιδιακή θεραπεία κατά την οποία …

α. τα κύτταρα τροποποιούνται έξω από τον οργανισμό και εισάγονται πάλι σ’ αυτόν.

β.τα κύτταρα τροποποιούνται μέσα στον οργανισμό του ασθενούς.

γ.τα κύτταρα πολλαπλασιάζονται στο εργαστήριο.

δ.τα κύτταρα συντήκονται με αντισώματα.

Μονάδες 5 

2005 ΟΜΟΓΕΝΕΙΣ

  1. Κατά την invivoγονιδιακή θεραπεία

α.τα φυσιολογικά γονίδια εισάγονται κατ’ ευθείαν στον οργανισμό.

β.τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό.

γ.γίνεται πλήρης αντικατάσταση του μεταλλαγμένου γονιδίου.

δ.χρησιμοποιούνται ως φορείς βακτήρια ή πρωτόζωα.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

  1. Τα αντισώματα είναι

α.νουκλεϊκά οξέα.

β.πρωτεΐνες.

γ.υδατάνθρακες.

δ.λιπίδια.

Μονάδες 3

2006 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟΥ 

4.Στην exvivoγονιδιακή θεραπεία τα κύτταρα του ασθενούς

α.τροποποιούνται μέσα στον οργανισμό του.

β.τροποποιούνται έξω από τον οργανισμό του και εισάγονται πάλι σ’ αυτόν.

γ.συντήκονται με καρκινικά κύτταρα.

δ.ιχνηθετούνται με ραδιενεργό φώσφορο.

Μονάδες 5

2006 ΟΜΟΓΕΝΕΙΣ

5.Η γονιδιακή θεραπεία

α.εφαρμόζεται μόνο στα λεμφοκύτταρα.

β.έχει ως στόχο να διορθώσει μια γενετική βλάβη.

γ.αντικαθιστά πολλά μεταλλαγμένα γονίδια.

δ.μεταβιβάζεται πάντοτε στους απογόνους.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ

5.Η κυστική ίνωση κληρονομείται με

α.φυλοσύνδετο επικρατή τύπο κληρονομικότητας.

β.φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας.

γ.αυτοσωμικό επικρατή τύπο κληρονομικότητας.

δ.αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

5.Η ινσουλίνη είναι μια ορμόνη που

α.ρυθμίζει την παραγωγή αντιικών πρωτεϊνών.

β.ρυθμίζει το μεταβολισμό των υδατανθράκων.

γ.παράγεται από πρόδρομα ερυθροκύτταρα.

δ.παράγεται από Β-λεμφοκύτταρα.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

4.Κατά την invivoγονιδιακή θεραπεία

α.χρησιμοποιούνται μεταλλαγμένα βακτήρια ως φορείς.

β.τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό.

γ.γίνεται αντικατάσταση των μεταλλαγμένων γονιδίων.

δ.τα φυσιολογικά γονίδια εισάγονται κατευθείαν στον οργανισμό.

Μονάδες 5

2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

5.Οι ιντερφερόνες είναι πρωτεΐνες που

α.παράγονται από τα κύτταρα του παγκρέατος.

β.παράγονται από υβριδώματα.

γ.έχουν αντιιική δράση.

δ.φέρουν γενετικές πληροφορίες.

Μονάδες 5 

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

  1. Η γονιδιακή θεραπεία εφαρμόσθηκε για την αντιμετώπιση

α.της κυστικής ίνωσης.

β.του αλφισμού.

γ.της υπερχοληστερολαιμίας.

δ.του συνδρόμου Down.

Μονάδες 5

2009 ΟΜΟΓΕΝΕΙΣ

  1. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες

α.λιπιδίων.

β.DNA.

γ.RNA.

δ.μονοκλωνικών αντισωμάτων.

Μονάδες 5 

2010 ΕΣΠΕΡΙΝΟ

Α2. Η ινσουλίνη είναι μια ορμόνη που ρυθμίζει

α.τον μεταβολισμό των πρωτεϊνών.

β.τη συγκέντρωση των αλάτων στα ούρα.

γ.τον μεταβολισμό των υδατανθράκων στο αίμα.

δ.τη συγκέντρωση της χοληστερόλης στο αίμα.

Μονάδες 5

2011 ΗΜΕΡΗΣΙΟ

Α5. Τα υβριδώματα παράγονται ύστερα από

α.σύντηξη βακτηρίων με καρκινικά κύτταρα.

β.σύντηξη Β λεμφοκυττάρων με καρκινικά κύτταρα.

γ.σύντηξη Β λεμφοκυττάρων με ιούς.

δ.υβριδοποίηση δύο μονόκλωνων αλυσίδων DNA.

Μονάδες 5

2012 ΕΣΠΕΡΙΝΟ

Α3. Τα υβριδώματα παράγονται ύστερα από σύντηξη

α.β-λεμφοκυττάρων με ιούς

β.β-λεμφοκυττάρων με βακτήρια

γ.μονοκλωνικών αντισωμάτων με καρκινικά κύτταρα

δ.β-λεμφοκυττάρων με καρκινικά κύτταρα.

Μονάδες 5

2012 ΟΜΟΓΕΝΕΙΣ

Α1. Η ασθένεια που χαρακτηρίζεται από έλλειψη ή μείωση ινσουλίνης είναι

α.ο αλφισμός.

β.η φαινυλκετονουρία.

γ.ο διαβήτης.

δ.η αιμορροφιλία.

Μονάδες 5 

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α4. Τα υβριδώματα είναι

α.υβρίδια καλαμποκιού

β.καρκινικά κύτταρα

γ.υβριδικά μόρια DNA-RNA

δ.κύτταρα που προκύπτουν από σύντηξη Β-λεμφοκυττάρων με καρκινικά κύτταρα.

Μονάδες 5

2013 ΟΜΟΓΕΝΕΙΣ

Α4. Υβριδώματα ονομάζονται τα

α. κύτταρα που προκύπτουν από σύντηξη Β-λεμφοκυττάρων με καρκινικά κύτταρα.

β.κύτταρα που προκύπτουν μετά από βακτηριακή ζύμωση.

γ.υβρίδια καλαμποκιού.

δ.υβριδοποιημένα μόρια DNA.

Μονάδες 5

Α5. Τα αντισώματα είναι

α.νουκλεϊκά οξέα.

β.υδατάνθρακες.

γ.λιπίδια.

δ.πρωτεΐνες.

Μονάδες 5

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α5. Με τη γονιδιακή θεραπεία

α.παράγονται μονοκλωνικά αντισώματα

β.γίνεται εισαγωγή του φυσιολογικού αλληλόμορφου γονιδίου

γ.γίνεται αντικατάσταση του μεταλλαγμένου γονιδίου από το φυσιολογικό

δ.μεταβιβάζεται στους απογόνους το φυσιολογικό γονίδιο.

Μονάδες 5

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ 

Α5. Ο τύπος γονιδιακής θεραπείας κατά τον οποίο τα κύτταρα τροποποιούνται έξω από τον οργανισμό ονομάζεται

α.exvivo

β.ιχνηθέτηση

γ.invivo

δ.χαρτογράφηση.

Μονάδες 5

2014 ΟΜΟΓΕΝΕΙΣ

Α3. Η ινσουλίνη χρησιμοποιείται για τη θεραπεία

α.της αιμορροφιλίας

β.του εμφυσήματος

γ.της κυστικής ίνωσης

δ.του διαβήτη.

Μονάδες 5

Α4. Στόχος της γονιδιακής θεραπείας είναι η

α.παραγωγή μονοκλωνικών αντισωμάτων

β.αντικατάσταση του μεταλλαγμένου γονιδίου

γ.«διόρθωση» της γενετικής βλάβης

δ.παραγωγή φαρμακευτικών πρωτεϊνών.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ

Α4.Η κυστική ίνωση κληρονομείται ως

α.αυτοσωμικός επικρατής χαρακτήρας

β.φυλοσύνδετος υπολειπόμενος χαρακτήρας

γ.φυλοσύνδετος επικρατής χαρακτήρας

δ.αυτοσωμικός υπολειπόμενος χαρακτήρας.

Μονάδες 5

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α3. Οι ιντερφερόνες είναι

α.πρωτεΐνες

β.αντιβιοτικά

γ.εμβόλια

δ.αντισώματα.

Μονάδες 5

Α4. Για τη θεραπεία του διαβήτη χρησιμοποιούμε

α.α1-αντιθρυψίνη

β.ιντερφερόνες

γ.ινσουλίνη

δ.παράγοντα ΙΧ

Μονάδες 5

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α4. Η ανεπάρκεια του ανοσοποιητικού συστήματος λόγω έλλειψης του ενζύμου απαμινάση της αδενοσίνης (ADA)

α.οφείλεται στον ιό του AIDS

β.δεν μπορεί να αντιμετωπιστεί με γονιδιακή θεραπεία

γ.εμφανίζει αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας

δ.εμφανίζεται μόνο σε γενετικά τροποποιημένους οργανισμούς.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α2. Η ινσουλίνη

α.παράγεται από κύτταρα του ήπατος

β.ρυθμίζει τη συγκέντρωση των λιπιδίων στο αίμα

γ.αποτελείται από δύο μικρά πεπτίδια

δ.κωδικοποιείται από δυο γονίδια.

Μονάδες 5

2016 ΟΜΟΓΕΝΕΙΣ

Α3. Η πρώτη invivoγονιδιακή θεραπεία εφαρμόστηκε το 1993 για τη θεραπεία της

α.κυστικής ίνωσης

β.φαινυλκετονουρίας

γ.υπερχοληστερολαιμίας

δ.αιμορροφιλίας.

Μονάδες 5

Α4. Η ινσουλίνη

α.αποτελείται από μόρια γλυκόζης

β.παράγεται στο ήπαρ

γ.όταν απουσιάζει από τον οργανισμό προκαλείται διαβήτης

δ.αποτελείται από νουκλεοτίδια.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α5. Ο ανθρώπινος αντιαιμορροφιλικός παράγοντας ΙΧ παραλαμβάνεται από

α.διαγονιδιακά θηλυκά πρόβατα

β.διαγονιδιακά αρσενικά πρόβατα

γ.διαγονιδιακά αρσενικά και θηλυκά πρόβατα

δ.μικρής ηλικίας θηλυκά πρόβατα.

Μονάδες 5

2017 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ-ΟΜΟΓΕΝΕΙΣ

Α1. Η γονιδιακή θεραπεία είναι δυνατόν να εφαρμοστεί

α.στο σύνδρομο Down

β.στον καρκίνο του παχέος εντέρου

γ.στην αιμορροφιλία Α

δ.στην υπερχοληστερολαιμία.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Α5. Η γονιδιακή θεραπεία έχει ως στόχο τη «διόρθωση» της γενετικής βλάβης με

α. αντικατάσταση του φυσιολογικού επικρατούς αλληλόμορφου σε όλα τα κύτταρα του ασθενή

β.αντικατάσταση του φυσιολογικού επικρατούς αλληλόμορφου σε ορισμένα σωματικά κύτταρα του ασθενή

γ.την εισαγωγή του φυσιολογικού υπολειπόμενου αλληλόμορφου σε όλα τα κύτταρα του ασθενή

δ.την εισαγωγή του φυσιολογικού επικρατούς αλληλόμορφου σε ορισμένα σωματικά κύτταρα του ασθενή.

Μονάδες 5

2018 ΗΜΕΡΗΣΙΟ

Α3. Ραδιενεργός 32Ρ και ραδιενεργό 35S είναι δυνατόν να ενσωματωθούν αντίστοιχα:

α. σε έναν υποκινητή γονιδίου και ένα μονοκλωνικό αντίσωμα

β. στην DNA πολυμεράση και σε ένα πλασμίδιο

γ. στην RNA πολυμεράση και στην προϊνσουλίνη

δ. στον χειριστή του οπερονίου της λακτόζης και στην λακτόζη.

Μονάδες 5 

ΘΕΜΑ Β

2001 ΟΜΟΓΕΝΕΙΣ

  1. Να περιγράψετε την τεχνική παραγωγής μονοκλωνικών αντισωμάτων για ένα συγκεκριμένο αντιγόνο.

Μονάδες 10

ΕΣΠΕΡΙΝΟ 2002

Α.Να ξαναγράψετε στο τετράδιό σας τις προτάσεις, αφού συμπληρώσετε τα κενά με τις σωστές λέξεις.

1.Η ινσουλίνη είναι μία ορμόνη που αποτελείται από 51 ……… και παράγεται από ειδικά κύτταρα του ………….. Η ορμόνη αυτή ρυθμίζει το μεταβολισμό των ……….. και ειδικότερα το ποσοστό της γλυκόζης στο ………. .

Μονάδες 6

2002 ΟΜΟΓΕΝΕΙΣ

1.Τι είναι οι φαρμακευτικές πρωτεΐνες;

Μονάδες 5

  1. Να περιγράψετε πώς τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν ως θεραπευτικά μέσα.

Μονάδες 10

2004 ΗΜΕΡΗΣΙΟ

Να απαντήσετε στις παρακάτω ερωτήσεις:

  1. Ποιος είναι ο ρόλος των μονοκλωνικών αντισωμάτων ως ανοσοδιαγνωστικά;

Μονάδες 7

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

4.Με ποια διαδικασία παράγονται μονοκλωνικά αντισώματα στο εργαστήριο για ένα επιλεγμένο αντιγόνο;

Μονάδες 7

2005 ΗΜΕΡΗΣΙΟ

  1. Τι είναι οι ιντερφερόνες, τι προκαλούν και σε ποιες περιπτώσεις μπορούν να χρησιμοποιηθούν για την αντιμετώπιση ασθενειών;

Μονάδες 9

2005 ΕΣΠΕΡΙΝΟ

  1. Η γονιδιακή θεραπεία στηρίζεται στην εφαρμογή της τεχνολογίας του ανασυνδυασμένου DNA. (Σ-Λ)

Μονάδες 3

2006 ΕΣΠΕΡΙΝΟ

  1. Η ινσουλίνη είναι μία (ορμόνη – βιταμίνη) που αποτελείται από 51 (αμινοξέα – νουκλεοτίδια) και παράγεται από ειδικά κύτταρα του (ήπατος – παγκρέατος). Ρυθμίζει το μεταβολισμό των (υδατανθράκων – πρωτεϊνών) και ειδικότερα το ποσοστό τους (στο αίμα – στα ούρα). Η ασθένεια που οφείλεται στην έλλειψη ή μείωση της ινσουλίνης ονομάζεται (διαβήτης – αναιμία).

Μονάδες 6

  1. Η γονιδιακή θεραπεία στοχεύει να “διορθώσει” τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου.

Μονάδες 3

2006 ΟΜΟΓΕΝΕΙΣ

3.Τι είναι μονοκλωνικά αντισώματα και ως τι χρησιμοποιούνται;

Μονάδες 8

2007 ΕΣΠΕΡΙΝΟ

Β.Να γράψετε στο τετράδιό σας το γράμμα κάθε στοιχείου της Στήλης Ι και δίπλα στο γράμμα αυτό τον αριθμό ενός στοιχείου της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                   Στήλη Ι                                                      Στήλη ΙΙ

(ασθένεια)                                   (φαρμακευτική ουσία που ενδείκνυται)

α. διαβήτης                                                1.α1-αντιθρυψίνη

                   β.καρκίνος                                               2. απαμινάση της αδενοσίνης

                   γ.εμφύσημα                                              3. ιντερφερόνες

                   δ.κληρονομική ανεπάρκεια                      4. παράγοντας ΙΧ

                   ανοσοποιητικού συστήματος

                   ε.αιμορροφιλία Β                                      5. φαινυλαλανίνη

                                                                                     6.αυξητική ορμόνη

                                                                                     7.ινσουλίνη

Μονάδες 10

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

3.Τι είναι και πού οφείλεται η κυστική ίνωση; (μονάδες 2) Ποια είναι η διαδικασία που εφαρμόστηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993; (μονάδες 6)

Μονάδες 8

2008 ΗΜΕΡΗΣΙΟ

3.Πώς συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος στη μελέτη της εξέλιξής του και στη μαζική παραγωγή προϊόντων;

Μονάδες 7

2008 ΕΣΠΕΡΙΝΟ

2.Γιατί η “διόρθωση” μιας γενετικής βλάβης που επιτυγχάνεται με τη γονιδιακή θεραπεία δεν μεταβιβάζεται στους απογόνους;

Μονάδες 8

2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

4.Τι είναι γονιδιακή θεραπεία και ποιος ο στόχος της;

Μονάδες 4

2009 ΗΜΕΡΗΣΙΟ

  1. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου; (μονάδες 5) Ποια τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας; (μονάδες 2)

Μονάδες 7

2009 ΕΣΠΕΡΙΝΟ

Β. Ένας νέος τομέας της βιοτεχνολογίας που αναπτύσσεται ταχύτατα είναι η γονιδιακή θεραπεία.

1.Ποιος είναι ο στόχος της γονιδιακής θεραπείας;

Μονάδες 5

  1. Ποιες είναι οι προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας;

Μονάδες 6

  1. Να αναφέρετε ονομαστικά τους τύπους γονιδιακής θεραπείας.

Μονάδες 4

2010 ΕΣΠΕΡΙΝΟ

  1. Οι ιντερφερόνες παράγονται από κύτταρα που έχουν μολυνθεί από ………… .
  2. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες ενός …………… αντισώματος.

Μονάδες 4

2011 ΕΣΠΕΡΙΝΟ

Β1.Να γράψετε στο τετράδιό σας τα γράμματα της Στήλης Ι και δίπλα σε κάθε γράμμα, τον αριθμό της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία τηςΣτήλης ΙΙ περισσεύουν.

                       Στήλη Ι                                                            Στήλη ΙΙ

α.invivoγονιδιακή θεραπεία                               1.μικροέγχυση

       β.γενετική τροποποίηση ζώων                           2. περιοριστική ενδονουκλεάση

       γ.ημιαυτόνομα οργανίδια                                     3. ριβοσώματα

       δ.ένζυμο που συνδέει τμήματα DNA                   4. RNAπολυμεράση

       ε.πλασμίδιο Ti                                                      5. DNAδεσμάση

       στ.σύνθεση κυτταροπλασματικών πρωτεϊνών   6.μιτοχόνδρια

                                                                                     7.Agrobacteriumtumefaciens

                                                                                     8.κυστική ίνωση

Μονάδες 12

2011 ΟΜΟΓΕΝΕΙΣ

Β1. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 8 

2012 ΗΜΕΡΗΣΙΟ

Β1. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα για την επιλογή οργάνων συμβατών στις μεταμοσχεύσεις;

Μονάδες 6

2013 ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε τη διαδικασία που εφαρμόστηκε για πρώτη φορά το 1990  στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος, η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA).

Μονάδες 8

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β3. Μια από τις πιο ενδιαφέρουσες χρήσεις των μονοκλωνικών αντισωμάτων είναι η εφαρμογή τους στη θεραπεία του καρκίνου. Σε ποια ιδιότητα των μονοκλωνικών αντισωμάτων βασίζεται αυτή η εφαρμογή; (μονάδες 2) Να περιγράψετε τον τρόπο της θεραπευτικής τους δράσης. (μονάδες 4)

Μονάδες 6

2015 ΗΜΕΡΗΣΙΟ

Β4. Τι είναι η ινσουλίνη και ποιος είναι ο ρόλος της;

Μονάδες 6

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β2. β.Όλα τα αντιγόνα έχουν πάντα μία μόνο περιοχή που αναγνωρίζεται από μόνο ένα αντίσωμα. Σωστόή Λάθος

Μονάδα 1

2015 ΟΜΟΓΕΝΕΙΣ 

Β4. Τι ονομάζεται αντιγονικός καθοριστής (μονάδες 3) και ποια αντισώματα ονομάζονται μονοκλωνικά (μονάδες 3);

Μονάδες 6

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β4. Τα μονοκλωνικά αντισώματα μπορούν να συνεισφέρουν σημαντικά στην αύξηση της ευαισθησίας κλινικών δοκιμασιών όπως η ταυτοποίηση των ομάδων αίματος. Στην παρασκευή ενός τέτοιου τεστ προσδιορισμού των ομάδων αίματος, σύμφωνα με το σύστημα ΑΒ0, να εξηγήσετε πόσα και ποια μονοκλωνικά αντισώματα θα πρέπει να περιέχονται.

Μονάδες 6

2016 ΟΜΟΓΕΝΕΙΣ

Β1. Να αντιστοιχίσετε σωστά τον αριθμό (1, 2, 3, 4και 5) καθεμιάς από τις πρωτεΐνες της στήλης Ιμε το γράμμα της εφαρμογής (Α, Β, Γ, Δκαι Ε) που αναφέρεται στη στήλη ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. α1αντιθρυψίνη Α: Αντιιικός παράγοντας
2. Παράγοντας VIII B:Αιμορροφιλία Α
3. Παράγοντας ΙΧ Γ: Εμφύσημα
4. Ιντερφερόνες Δ: Τεστ κύησης
5. Μονοκλωνικά αντισώματα Ε: Αιμορροφιλία Β

 

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ

Β3. Κατά την έναρξη της κύησης ο οργανισμός της εγκυμονούσας παράγει μια ειδική ορμόνη, τη χοριακή γοναδοτροπίνη. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων που θα μπορούσαν να χρησιμοποιηθούν σε διαγνωστικούς ελέγχους (τεστ) κύησης.

Μονάδες 7

2017 ΕΣΠΕΡΙΝΟ

Β3. Στο μαστικό αδένα ενός προβάτου υπάρχει συγκεκριμένος κυτταρικός τύπος στον οποίο εκφράζεται το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος. Θέλουμε να πάρουμε την πρωτεΐνη α1-αντιθρυψίνη από το γάλα ενός διαγονιδιακού προβάτου. Για το λόγο αυτό εισάγουμε μέσα στο γονίδιο της καζεΐνης με κατάλληλο προσανατολισμό το γονίδιο της α1-αντιθρυψίνης. Να εξηγήσετε γιατί θα εκφραστεί το γονίδιο της α1-αντιθρυψίνης στα κύτταρα του μαστικού αδένα.

Μονάδες 6

Β4. Κατά την έναρξη της κύησης ο οργανισμός της εγκυμονούσας παράγει μια ειδική ορμόνη, τη χοριακή γοναδοτροπίνη. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων που θα μπορούσαν να χρησιμοποιηθούν σε διαγνωστικούς ελέγχους (τεστ) κύησης.

Μονάδες 7 

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Β1. Να αντιστοιχίσετε σωστά τον κάθε αριθμό της Στήλης Ι (δομές/μόρια) με ένα μόνο γράμμα της Στήλης ΙΙ(διαδικασίες). Επισημαίνεται ότι μία από τις διαδικασίες της Στήλης ΙΙ δεν έχει αντιστοιχία με κάποια από τις δομές/μόρια της Στήλης Ι.

Στήλη Ι (δομές/μόρια) Στήλη ΙΙ (διαδικασίες)
1. νουκλεόσωμα Α. Αντιγραφή
2. πριμόσωμα Β. Μετάφραση
3. πολύσωμα Γ. Ανοσοδιάγνωση
4. ριβονουκλεοπρωτεϊνικά σωματίδια Δ. Αντίστροφη μεταγραφή
5. μονοκλωνικά αντισώματα Ε. Συσπείρωση γενετικού υλικού
ΣΤ. Ωρίμανση mRNA

Μονάδες 5

Β2. Να αναφέρετε τα βήματα που απαιτούνται για να παραχθεί μια φαρμακευτική πρωτεΐνη ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 6

2018 ΗΜΕΡΗΣΙΟ

Β1. Να αντιστοιχίσετε τον κάθε αριθμό της στήλης Ι με ένα μόνο γράμμα της στήλης ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. Περιοριστική ενδονουκλεάση α. Πολυσακχαρίτης
2. Πρωταρχικό τμήμα
3. Πριμόσωμα β. Νουκλεϊκό οξύ
4. Άγαρ
5. Αντίσωμα γ. Πρωτεΐνη
6. Απαμινάση της αδενοσίνης
7. Πλασμίδιο

 

Μονάδες 7

Β3. Σε ποιους βασικούς στόχους της Ιατρικής έχει συμβάλει αποτελεσματικά η βιοτεχνολογία;

Μονάδες 3

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ

Β3. Ποιες ιδιότητες των υβριδωμάτων επιτρέπουν την αποτελεσματική τους χρήση στην παραγωγή μεγάλων ποσοτήτων μονοκλωνικών αντισωμάτων;

Μονάδες 6

ΘΕΜΑ Γ

2000 ΗΜΕΡΗΣΙΟ 

Α. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 9

2001 ΗΜΕΡΗΣΙΟ

  1. Μία ανωμαλία του γονιδίου που ελέγχει τη σύνθεση του ενζύμου απαμινάση της αδενοσίνης (ADA) προκαλεί μία ασθένεια του ανοσοποιητικού συστήματος. Απομονώθηκε το mRNAτου ενζύμου ADAαπό υγιές άτομο και από άτομο που ασθενεί. Τμήματα των παραπάνω mRNAείναι:

                   Υγιές άτομο:               AUGGAAUUUUGGGGGCGCACGUCG……

Άτομο που ασθενεί:   AUGGAAUUUUAGGGGCGCACGUCG……

α.Ποια είναι η αιτία της ασθένειας;

Μονάδες 6

β.Με ποιο τρόπο κληρονομείται αυτή η ασθένεια;

Μονάδες 2 

ΕΣΠΕΡΙΝΟ 2002

Α. 1. Τι είναι τα μονοκλωνικά αντισώματα;

Μονάδες 5

2.Πώς λειτουργούν τα μονοκλωνικά αντισώματα ως θεραπευτικά μέσα;

Μονάδες 8

2003 ΗΜΕΡΗΣΙΟ

1.Πώς αντιμετωπίζεται η κυστική ίνωση με γονιδιακή θεραπεία;

Μονάδες 10

2.Άνδρας ο οποίος πάσχει από κυστική ίνωση και υποβλήθηκε σε γονιδιακή θεραπεία για τη νόσο αποκτά παιδιά με φυσιολογική γυναίκα. Τι πιθανότητες υπάρχουν να είναι τα παιδιά τους φυσιολογικά; Να δικαιολογήσετε την απάντησή σας.

Μονάδες 15

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Η ινσουλίνη είναι μία ορμόνη απαραίτητη για την καλή λειτουργία του ανθρώπινου οργανισμού.

1.Ποιος είναι ο ρόλος της ινσουλίνης στον οργανισμό μας;

Μονάδες 5

2.Από τι αποτελείται το μόριο της ινσουλίνης;

Μονάδες 5

3.Να γράψετε συνοπτικά τα στάδια παραγωγής της ανθρώπινης ινσουλίνης σε καλλιέργεια βακτηρίων.

Μονάδες 15

2003 ΟΜΟΓΕΝΕΙΣ

Α. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990, σ’ ένα τετράχρονο κορίτσι που έπασχε από έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA). Να περιγράψετε τη διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας.

Μονάδες 10

2005 ΕΣΠΕΡΙΝΟ

Ο οργανισμός μας είναι ικανός να παράγει αντισώματα εναντίον κάθε ξένου αντιγόνου.

  1. Πώς ο αντιγονικός καθοριστής σχετίζεται με την παραγωγή μονοκλωνικών αντισωμάτων από τον οργανισμό;

Μονάδες 10

  1. Πώς παράγονται στο εργαστήριο μεγάλες ποσότητες μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο;

Μονάδες 15

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Η Βιοτεχνολογία με την παραγωγή μονοκλωνικών αντισωμάτων και τη γονιδιακή θεραπεία έχει συμβάλει αποτελεσματικά στην υλοποίηση των βασικών στόχων της Ιατρικής, μεταξύ των οποίων είναι και η αποτελεσματική θεραπεία ασθενειών.

1.Γιατί τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν στη θεραπεία του καρκίνου (Μονάδες 6) και ποια είναι τα πλεονεκτήματα που παρουσιάζει η χρήση τους έναντι άλλων μεθόδων θεραπείας του (Μονάδες 2);

Μονάδες 8

2.Ποια διαδικασία ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (Μονάδες 8) και τι πιθανά προβλήματα αντιμετωπίζουν τα άτομα που πάσχουν από τη συγκεκριμένη ασθένεια (Μονάδες 3);

Μονάδες 11

  1. Γιατί η χρήση της γονιδιακής θεραπείας θα είναι περιορισμένη στο άμεσο μέλλον;

Μονάδες 6

2007 ΗΜΕΡΗΣΙΟ

Η Βιοτεχνολογία με την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA, τη χρήση της τεχνικής PCRκαι την παραγωγή μονοκλωνικών αντισωμάτων συνεισφέρει σε τομείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική.

1.Τι επιτρέπει η μέθοδος της αλυσιδωτής αντίδρασης της πολυμεράσης (PCR); (μονάδες 4) Να αναφέρετε τρεις πρακτικές εφαρμογές της (μονάδες 3).

Μονάδες 7

2.Να περιγράψετε τη διαδικασία παραγωγής στο εργαστήριο μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 8

2007 ΟΜΟΓΕΝΕΙΣ

Βιοτεχνολογία, με την ευρεία έννοια, είναι η χρήση ζωντανών οργανισμών προς όφελος του ανθρώπου και στηρίζεται κυρίως σε τεχνικές καλλιέργειας και ανάπτυξης των μικροοργανισμών και σε τεχνικές ανασυνδυασμένου DNA.

1.Με ποιο τρόπο καλλιεργούνται οι μικροοργανισμοί σε μεγάλη κλίμακα (βιομηχανική καλλιέργεια);

Μονάδες 10

2.Τι εννοούμε με τον όρο ζύμωση και ποια είναι τα προϊόντα της ζύμωσης;

Μονάδες 5

3.Η ανθρώπινη ινσουλίνη είναι μία από τις φαρμακευτικές πρωτεΐνες που παράγονται από βακτήρια. Μία από τις μεθόδους που χρησιμοποιούνται για την παραγωγή της είναι η παραγωγή του πρόδρομου μορίου της σε μία βακτηριακή καλλιέργεια και η μετατροπή του σε ινσουλίνη με ενζυμική κατεργασία. Να γράψετε, συνοπτικά, τα στάδια αυτής της μεθόδου.

Μονάδες 10

2008 ΕΣΠΕΡΙΝΟ 

Για την παραγωγή του προδρόμου μορίου της ινσουλίνης, δηλαδή της προϊνσουλίνης, κατάλληλα μετασχηματισμένα κύτταρα Escherichiacoliκαλλιεργήθηκαν σε βιοαντιδραστήρα. Η απεικόνιση της μεταβολής του πληθυσμού του βακτηρίου (Ν) σε σχέση με το χρόνο (t) έδωσε το παρακάτω διάγραμμα:

2019-02-19, 22.37.53

1.Με βάση το διάγραμμα αυτό, να χαρακτηρίσετε τον τύπο της καλλιέργειας και να περιγράψετε τις φάσεις της.

Μονάδες 10

2.Σε ποια συνήθως χρονικά διαστήματα της καλλιέργειας των βακτηρίων αναμένεται να παραχθεί η προϊνσουλίνη; Αφού παραλάβουμε την προϊνσουλίνη από τον βιοαντιδραστήρα, πώς θα την μετατρέψουμε σε ινσουλίνη;

Μονάδες 10

3.Ποιος είναι ο βιολογικός ρόλος της ινσουλίνης και ποια ασθένεια προκαλεί η μείωση ή η έλλειψή της;

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

Για πρώτη φορά η γονιδιακή θεραπεία εφαρμόστηκε σε ένα κορίτσι που είχε έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA).

1.Ποιος είναι ο ρόλος του ενζύμου αυτού (μονάδες 3) και ποια τα συμπτώματα που εμφανίζουν τα άτομα με έλλειψη του συγκεκριμένου ενζύμου (μονάδες 6).

Μονάδες 9

2.Πώς ονομάζεται ο τύπος της γονιδιακής θεραπείας που εφαρμόστηκε (μονάδες 2) και γιατί (μονάδες 4).

Μονάδες 6

3.Ποια είναι η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας.

Μονάδες 10 

2010 ΗΜΕΡΗΣΙΟ

Γ1. Να περιγράψετε τις διαδικασίες με τις οποίες μπορούν να παραχθούν μονοκλωνικά αντισώματα, τα οποία συνεισφέρουν στον προσδιορισμό των ομάδων αίματος του ανθρώπου.

Μονάδες 7

2017 ΗΜΕΡΗΣΙΟ

Γ1. Στο μαστικό αδένα ενός προβάτου υπάρχει συγκεκριμένος κυτταρικός τύπος στον οποίο εκφράζεται το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος. Θέλουμε να πάρουμε την πρωτεΐνη α1-αντιθρυψίνη από το γάλα ενός διαγονιδιακού προβάτου. Για το λόγο αυτό εισάγουμε μέσα στο γονίδιο της καζεΐνης με κατάλληλο προσανατολισμό το γονίδιο της α1-αντιθρυψίνης. Να εξηγήσετε γιατί θα εκφραστεί το γονίδιο της α1-αντιθρυψίνης στα κύτταρα του μαστικού αδένα.

Μονάδες 6

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ2. Μετά την κλωνοποίηση ορισμένων γονιδίων ιντερφερονών είναι σήμερα δυνατή η παραγωγή τους σε μεγάλες ποσότητες από γενετικά τροποποιημένα βακτήρια. Να εξηγήσετε πώς θα παραλάβουμε ιντερφερόνη από καλλιέργεια γενετικά τροποποιημένων βακτηρίων σε βιοαντιδραστήρα.

Μονάδες 8

ΘΕΜΑ Δ

2006 ΗΜΕΡΗΣΙΟ

Μια φυσιολογική γυναίκα παντρεύεται έναν άνδρα και αποκτούν δύο παιδιά, το Γιάννη και την Ελένη. Ο Γιάννης παρουσιάζει οικογενή υπερχοληστερολαιμία και β-θαλασσαιμία, ενώ η Ελένη δεν παρουσιάζει καμιά από τις δύο ασθένειες. Να γράψετε τους πιθανούς γονότυπους των γονέων και των παιδιών (Μονάδες 6) και να δικαιολογήσετε την απάντησή σας (Μονάδες 6). Εάν οι συγκεκριμένοι γονείς αποκτήσουν και τρίτο παιδί, να προσδιορίσετε την πιθανότητα να πάσχει μόνο από υπερχοληστερολαιμία, χωρίς να ληφθεί υπόψη η β-θαλασσαιμία (Μονάδες 6).

Πρόσφατα ανακοινώθηκε μελέτη για την εφαρμογή της γονιδιακής θεραπείας σε ασθενείς που πάσχουν από β-θαλασσαιμία. Λαμβάνοντας υπόψη ότι τα γονίδια των αιμοσφαιρινών εκφράζονται στα πρόδρομα ερυθροκύτταρα, ποιος τύπος γονιδιακής θεραπείας θα μπορούσε να εφαρμοστεί για την αντιμετώπιση της β-θαλασσαιμίας και γιατί (Μονάδες 7);

Μονάδες 25

 

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ

ΣΤΟ 1ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ)

ΘΕΜΑ Α

2000 ΗΜΕΡΗΣΙΟ

  1. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

α.γραμμικό δίκλωνο DNA

β.γραμμικό μονόκλωνο DNA

γ.κυκλικό δίκλωνο DNA

δ.κυκλικό μονόκλωνο DNA

Μονάδες 5

2000 ΕΣΠΕΡΙΝΟ

  1. Μέσα σ’ ένα φυτικό ευκαρυωτικό κύτταρο, DNAυπάρχει μόνο:

α) στον πυρήνα

β) στον πυρήνα και στα μιτοχόνδρια

γ) στα μιτοχόνδρια και στους χλωροπλάστες

δ) στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες

Μονάδες 3

  1. Στη φύση τα πλασμίδια βρίσκονται:

α) στα φυτικά κύτταρα

β) στους ιούς

γ) στα βακτήρια

δ) στα ζωικά κύτταρα

Μονάδες 3 

2001 ΗΜΕΡΗΣΙΟ

1.Το DNAαποτελεί το γενετικό υλικό όλων των κυττάρων και των περισσότερων ιών. Να περιγράψετε συνοπτικά τις λειτουργίες του γενετικού υλικού.

Μονάδες 5

2001 ΕΣΠΕΡΙΝΟ

3.Οι ιοί περιέχουν γενετικό υλικό; Τι είδους μπορεί να είναι αυτό;

Μονάδες 15

2001 ΟΜΟΓΕΝΕΙΣ

Β. 1. Πότε ένα κύτταρο χαρακτηρίζεται απλοειδές και πότε διπλοειδές;

Μονάδες 5

  1. Τι ονομάζεται καρυότυπος;

Μονάδες 5 

2002 ΗΜΕΡΗΣΙΟ

1.Δίκλωνο κυκλικό μόριο DNAπεριέχεται σε:

α.γαμέτη

β.ευκαρυωτικό πυρήνα

γ.βακτήριο

δ.νουκλεόσωμα.

Μονάδες 5

2002 ΕΣΠΕΡΙΝΟ

2.Οι δύο αδερφές χρωματίδες συγκροτούν ένα

α.μεταφασικό χρωμόσωμα.

β.υβρίδωμα.

γ.νουκλεόσωμα.

δ.κύτταρο.

Μονάδες 5

3.Το πλασμίδιο είναι

α.δίκλωνο RNA.

β.κυκλικό δίκλωνο DNA.

γ.μονόκλωνο DNA.

δ.μονόκλωνο RNA.

Μονάδες 5

2003 ΗΜΕΡΗΣΙΟ

2.Τα φυλετικά χρωμοσώματα του ανθρώπου βρίσκονται:

α.μόνο στα μυϊκά κύτταρα

β.μόνο στα γεννητικά κύτταρα

γ.σε όλα τα κύτταρα

δ.μόνο στα ηπατικά κύτταρα.

Μονάδες 5

2003 ΕΣΠΕΡΙΝΟ

2.Τα φυλετικά χρωμοσώματα του ανθρώπου

α.δεν περιέχουν γονίδια.

β.είναι όμοια μορφολογικά στους άνδρες και στις γυναίκες.

γ.καθορίζουν το φύλο.

δ.δεν μεταβιβάζονται στους απογόνους.

Μονάδες 5

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Πολλά νουκλεοτίδια ενώνονται μεταξύ τους με ετεροπολικούς δεσμούς και δημιουργούν μία πολυνουκλεοτιδική αλυσίδα.

Μονάδες 2

2003 ΟΜΟΓΕΝΕΙΣ 

3.Το υλικό των προκαρυωτικών κυττάρων είναι

α.γραμμικό μονόκλωνο DNA.

β.δίκλωνο RNA.

γ.κυκλικό δίκλωνο DNA.

δ.γραμμικό δίκλωνο DNA.

Μονάδες 5

2004 ΕΣΠΕΡΙΝΟ

  1. Στα ευκαρυωτικά κύτταρα, το γενετικό υλικό κατανέμεται

α.στον πυρήνα.

β.στα μιτοχόνδρια και στο πλασμίδιο.

γ.στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες.

δ.στον πυρήνα και στα ριβοσώματα.

Μονάδες 5

  1. Η ποσότητα του DNAείναι

α.ίδια σε όλα τα είδη των σωματικών κυττάρων ενός οργανισμού.

β.διπλάσια στα ηπατικά κύτταρα των οργανισμών.

γ.μικρότερη στους περισσότερο εξελιγμένους οργανισμούς.

δ.η μισή στα διπλοειδή κύτταρα σε σχέση με τα απλοειδή.

Μονάδες 5

  1. Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση των νουκλεοτιδίων με

α.δεσμούς υδρογόνου.

β.φωσφοδιεστερικούς δεσμούς.

γ.πεπτιδικούς δεσμούς.

δ.ετεροπολικούς δεσμούς.

Μονάδες 5

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα …

α.δίκλωνο γραμμικό μόριο DNA.

β.δίκλωνο κυκλικό μόριο DNA.

γ.δίκλωνο κυκλικό μόριο RNA.

δ.μονόκλωνο κυκλικό μόριο RNA.

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

1.Τα φυλετικά χρωμοσώματα …

α.υπάρχουν μόνο στα γεννητικά κύτταρα.

β.εντοπίζονται μόνο στα σωματικά κύτταρα.

γ.υπάρχουν στα σωματικά και στα γεννητικά κύτταρα.

δ.εντοπίζονται στα φυτικά και στα βακτηριακά κύτταρα.

Μονάδες 5

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Στα πειράματά τους οι Avery, Mac-Leodκαι McCartyδιαπίστωσαν ότι ο μετασχηματισμός των αδρών βακτηρίων σε λεία οφείλεται …

α.στο DNA.

β.στο RNA.

γ.στους υδατάνθρακες.

δ.στις πρωτεΐνες.

Μονάδες 5

2005 ΕΣΠΕΡΙΝΟ

  1. Τα πλασμίδια

α.είναι δίκλωνα, κυκλικά μόρια DNAμε διάφορα μεγέθη.

β.απαντούν σε όλους τους ευκαρυωτικούς οργανισμούς.

γ.φέρουν πληροφορίες για πρωτεΐνες με αντιγονική δράση.

δ.αποτελούν βασικό συστατικό του νουκλεοσώματος.

Μονάδες 3

  1. Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται

α.τα μιτοχόνδρια και τα ριβοσώματα.

β.οι χλωροπλάστες και ο πυρήνας.

γ.οι χλωροπλάστες και τα μιτοχόνδρια.

δ.τα ζεύγη των φυλετικών χρωμοσωμάτων.

Μονάδες 3

Β. Ποιες είναι, συνοπτικά, οι λειτουργίες του γενετικού υλικού;

Μονάδες 10 

2006 ΗΜΕΡΗΣΙΟ

  1. Ο καρυότυπος

α.απεικονίζει την ταξινόμηση των χρωμοσωμάτων κατά ελαττούμενο μέγεθος.

β.χρησιμοποιείται για τον εντοπισμό γονιδιακών μεταλλάξεων.

γ.απεικονίζει το γενετικό υλικό κατά το στάδιο της μετάφασης.

δ.χρησιμοποιείται μόνο για τη μελέτη φυλετικών χρωμοσωμάτων.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

  1. Ένα νουκλεοτίδιο DNAμπορεί να αποτελείται από

α.δεοξυριβόζη, φωσφορική ομάδα, ουρακίλη.

β.ριβόζη, φωσφορική ομάδα, θυμίνη.

γ.DNAδεσμάση, φωσφορική ομάδα, αδενίνη.

δ.δεοξυριβόζη, φωσφορική ομάδα, αδενίνη.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ

4.Το πλασμίδιο είναι

α.δίκλωνο γραμμικό μόριο DNA.

β.δίκλωνο κυκλικό μόριο DNA.

γ.δίκλωνο κυκλικό μόριο RNA.

δ.δίκλωνο γραμμικό μόριο RNA.

Μονάδες 5 

2008 ΗΜΕΡΗΣΙΟ

1.Ο πνευμονιόκοκκος, τα δύο στελέχη του οποίου χρησιμοποίησε ο Griffithστο γνωστό πείραμα, είναι:

α.μύκητας.

β.βακτήριο.

γ.ιός.

δ.πρωτόζωο.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

2.Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται

α.τα ριβοσώματα και οι χλωροπλάστες.

β.οι χλωροπλάστες και τα μιτοχόνδρια.

γ.τα χρωμοσώματα και τα ριβοσώματα.

δ.ο πυρήνας και οι χλωροπλάστες.

Μονάδες 5

2008 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Στους περισσότερους οργανισμούς ένα μιτοχόνδριο περιέχει

α.ένα μόριο κυκλικού DNA.

β.δύο έως δέκα μόρια κυκλικού DNA.

γ.ένα μόριο γραμμικού RNA.

δ.πολλά μόρια γραμμικού RNA.

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

1.Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι

α.κυκλικό μονόκλωνο DNA.

β.κυκλικό δίκλωνο DNA.

γ.γραμμικό δίκλωνο DNA.

δ.γραμμικό μονόκλωνο DNA.

Μονάδες 5 

2009 ΗΜΕΡΗΣΙΟ

  1. Τα νουκλεοσώματα

α.αποτελούνται αποκλειστικά από DNA.

β.δεν σχηματίζονται κατά τη μεσόφαση.

γ.αποτελούνται από DNAπου τυλίγεται γύρω από πρωτεΐνες.

δ.είναι ορατά μόνο με το οπτικό μικροσκόπιο.

Μονάδες 5

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

  1. Δύο αδελφές χρωματίδες συγκροτούν

α.τον καρυότυπο.

β.το νουκλεόσωμα.

γ.κάθε μεταφασικό χρωμόσωμα.

δ.το μόριο DNA.

Μονάδες 5

2009 ΕΣΠΕΡΙΝΟ

  1. Στον ανθρώπινο φυσιολογικό καρυότυπο απεικονίζονται

α.23 χρωμοσώματα.

β.22 ζεύγη χρωμοσωμάτων.

γ.23 ζεύγη χρωμοσωμάτων.

δ.46 ζεύγη χρωμοσωμάτων.

Μονάδες 5

2009 ΟΜΟΓΕΝΕΙΣ

  1. Τα πλασμίδια είναι

α.δίκλωνα κυκλικά μόρια RNA.

β.δίκλωνα γραμμικά μόρια RNA.

γ.δίκλωνα κυκλικά μόρια DNA.

δ.μονόκλωνα κυκλικά μόρια DNA.

Μονάδες 5

2010 ΗΜΕΡΗΣΙΟ

Α2. Η διπλή έλικα του DNA

α.έχει μεταβαλλόμενο σκελετό

β.έχει υδρόφιλο σκελετό

γ.έχει πεπτιδικούς δεσμούς

δ.είναι αριστερόστροφη

Μονάδες 5

2010 ΕΣΠΕΡΙΝΟ

Α1. Η ποσότητα του DNAείναι

α.διπλάσια στα νευρικά κύτταρα σε σχέση με τα ηπατικά του ίδιου οργανισμού.

β.η μισή στα διπλοειδή κύτταρα σε σχέση με τα απλοειδή.

γ.ίδια σε όλα τα είδη των σωματικών κυττάρων ενός οργανισμού.

δ.συνήθως μικρότερη στους περισσότερο εξελιγμένους οργανισμούς.

Μονάδες 5

2010 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α3. Η έκφραση invitroχρησιμοποιείται για την περιγραφή μιας βιολογικής διαδικασίας που πραγματοποιείται

α.στο ύπαιθρο

β.σε έναν οργανισμό

γ.στον πυθμένα μιας λίμνης

δ.σε δοκιμαστικό σωλήνα

Μονάδες 5

2011 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ – ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

Α4. Η ποσότητα του DNA

α.είναι ίδια σε όλους τους απλοειδείς οργανισμούς.

β.είναι σταθερή σε όλους τους διπλοειδείς οργανισμούς.

γ.μεταβάλλεται στα κύτταρα των διαφόρων ιστών ενός οργανισμού.

δ.διαφέρει στα κύτταρα των οργανισμών που ανήκουν σε διαφορετικά είδη.

Μονάδες 5

2011 ΟΜΟΓΕΝΕΙΣ 

Α1. Μέσα σ’ ένα φυτικό ευκαρυωτικό κύτταρο, DNAυπάρχει μόνο

α.στα ριβοσώματα και στους χλωροπλάστες.

β.στον πυρήνα και στα μιτοχόνδρια.

γ.στον πυρήνα.

δ.στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες.

Μονάδες 5

2012 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α2. Οι ιστόνες είναι

α.DNA

β.RNA

γ.πρωτεΐνες

δ.υδατάνθρακες.

Μονάδες 5

2012 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α1. Τα φυλετικά χρωμοσώματα υπάρχουν

α.μόνο στα ωάρια

β.μόνο στα σπερματοζωάρια

γ.μόνο στα σωματικά κύτταρα

δ.στα σωματικά κύτταρα και στους γαμέτες.

Μονάδες 5 

2012 ΟΜΟΓΕΝΕΙΣ

Α3. Τα πλασμίδια είναι μόρια DNAπου φυσιολογικά βρίσκονται σε

α.φυτά.

β.ζώα.

γ.ιούς.

δ.βακτήρια.

Μονάδες 5

2013 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Βασική μονάδα οργάνωσης της χρωματίνης αποτελεί το

α.νουκλεοτίδιο

β.πολύσωμα

γ.νουκλεόσωμα

δ.κεντρομερίδιο

Μονάδες 5

2013 ΟΜΟΓΕΝΕΙΣ

Α1. Στον άνθρωπο το αρσενικό άτομο καθορίζεται από την

α.παρουσία του Χ χρωμοσώματος.

β.απουσία του Χ χρωμοσώματος.

γ.παρουσία του Υ χρωμοσώματος.

δ.απουσία του Υ χρωμοσώματος.

Μονάδες 5 

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Τα πλασμίδια είναι

α.κυκλικά δίκλωνα μόρια RNA

β.γραμμικά μόρια DNA

γ.μονόκλωνα μόρια DNA

δ.κυκλικά δίκλωνα μόρια DNA.

Μονάδες 5 

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

 Α1. Τα κύτταρα στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο ονομάζονται

α.διπλοειδή

β.διαφοροποιημένα

γ.απλοειδή

δ.μετασχηματισμένα.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ 

Α2. Το νουκλεόσωμα αποτελείται

α.από RNAκαι ιστόνες

β.μόνο από RNA

γ.από DNAκαι ιστόνες

δ.μόνο από DNA.

Μονάδες 5 

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α1. Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι

α.γραμμικό δίκλωνο μόριο DNA

β.κυκλικό δίκλωνο μόριο DNA

γ.γραμμικό μονόκλωνο μόριο DNA

δ.κυκλικό μονόκλωνο μόριο DNA.

Μονάδες 5 

2015 ΟΜΟΓΕΝΕΙΣ 

Α1. Δύο διαδοχικά νουκλεοτίδια μιας πολυνουκλεοτιδικής αλυσίδας συνδέονται μεταξύ τους με δεσμό που ονομάζεται

α.5΄- 3΄ φωσφοδιεστερικός δεσμός

β.δεσμός υδρογόνου

γ.πεπτιδικός δεσμός

δ.3΄- 5΄ φωσφοδιεστερικός δεσμός.

Μονάδες 5 

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Το γενετικό υλικό των χλωροπλαστών

α.είναι γραμμικό δίκλωνο DNA

β.είναι κυκλικό μόριο DNA

γ.έχει μικρότερο μήκος από το μιτοχονδριακό DNA

δ.είναι γραμμικό RNA.

Μονάδες 5

Α2. Ένας φυσιολογικός γαμέτης ανθρώπου μπορεί να περιέχει

α.46 χρωμοσώματα

β.ένα Χ χρωμόσωμα

γ.πλασμίδια

δ.DNAμήκους 1,5 x109ζεύγη βάσεων.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

Α3. Το μιτοχονδριακό DNA

α.στα ανθρώπινα κύτταρα είναι δίκλωνο και γραμμικό

β.έχει πληροφορίες για όλες τις λειτουργίες των μιτοχονδρίων

γ.είναι γραμμικό σε ορισμένα κατώτερα πρωτόζωα

δ.υπάρχει πάντα σε ένα μόνο αντίγραφο σε κάθε μιτοχόνδριο.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ 

Α3. Νουκλεοσώματα εντοπίζονται

α.σε μιτοχόνδρια ανθρώπινου μυϊκού κυττάρου

β.σε πυρήνα φυτικού κυττάρου

γ.στο κυτταρόπλασμα του βακτηρίου Escherichiacoli(E. coli)

δ.σε πυρήνα, μιτοχόνδριο και χλωροπλάστη φυτικού κυττάρου.

Μονάδες 5

Α4. Σταθερότερη δευτερογενή δομή μεταξύ μορίων DNAίσου μήκους έχει το μόριο με

α.30% Α

β.20% Α

γ.10% Α

δ.40% Α.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Α1. Το μιτοχονδριακό DNAείναι γραμμικό

α.σε ορισμένα κατώτερα πρωτόζωα

β.στα περισσότερα κύτταρα των ευκαρυωτικών οργανισμών

γ.στα βακτήρια

δ.στα φυτικά κύτταρα.

Μονάδες 5

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ 

Α4. Ερευνητές μελετούν τη δομή του DNA σε ηπατικά, γαμετικά και βακτηριακά κύτταρα και παρατηρούν ότι δίκλωνα κυκλικά μόρια DNA

α.εντοπίζονται μόνο στα βακτηριακά κύτταρα.

β.εντοπίζονται μόνο στα ηπατικά και γαμετικά κύτταρα.

γ.δεν εντοπίζονται σε κανένα από τα τρία είδη κυττάρων.

δ.εντοπίζονται και στα τρία είδη κυττάρων.

Μονάδες 5

Α5. Στις δύο παρακάτω υποθετικές διατάξεις, που αναφέρονται σε μερικώς αναδιπλούμενα μονόκλωνα μόρια DNA,

2019-02-19, 23.01.56

ο κανόνας της συμπληρωματικότητας και αντιπαραλληλότητας

α.ικανοποιείται μόνο στηνΙ.

β.ικανοποιείται μόνο στη ΙΙ.

γ.ικανοποιείται τόσο στηνΙ όσο και στη ΙΙ.

δ.δεν ικανοποιείται σε καμία από τις δύο διατάξεις.

Μονάδες 5

ΘΕΜΑ Β

2000 ΕΣΠΕΡΙΝΟ 

  1. Η σύνδεση με δεσμούς υδρογόνου της Α (αδενίνης) με τη Τ (θυμίνη) είναι τόσο ισχυρή όσο και η σύνδεση της C(κυτοσίνης) με τη G(γουανίνη). (Σ-Λ)

2.Το DNA, όπως και το RNA, είναι ένα μακρομόριο που αποτελείται από …………

2001 ΗΜΕΡΗΣΙΟ

3.Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα και γιατί;

Μονάδες 5

2001 ΕΣΠΕΡΙΝΟ 

  1. Η σύνδεση με δεσμούς υδρογόνου της Α (αδενίνης) με την C(κυτοσίνη) είναι τόσο ισχυρή όσο και η σύνδεση της Τ (θυμίνης) με τη G(γουανίνη). (Σ-Λ)

4.Τα χρωμοσώματα του ανθρώπου που καθορίζουν αν ένα άτομο θα είναι αρσενικό ή θηλυκό λέγονται _______________ .

2002 ΕΣΠΕΡΙΝΟ

1.Ποια οργανίδια του ευκαρυωτικού κυττάρου χαρακτηρίζονται ως ημιαυτόνομα και γιατί;

Μονάδες 8

2.Τι είναι το νουκλεόσωμα;

Μονάδες 4

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ 

2.Από τι αποτελείται το νουκλεόσωμα και ποιος είναι ο ρόλος του;

Μονάδες 10

2004 ΕΣΠΕΡΙΝΟ

Α. Ποιες είναι συνοπτικά οι λειτουργίες του γενετικού υλικού;

Μονάδες 15

Β. Να μεταφέρετε στο τετράδιό σας τις παρακάτω προτάσεις, συμπληρώνοντας τα κενά με τις σωστές λέξεις.

1.Οι αδελφές χρωματίδες είναι συνδεδεμένες στο _______________ .

Μονάδες 2

  1. Κάθε νουκλεοτίδιο του DNAαποτελείται από μια πεντόζη, τη _____________, ενωμένη με μία φωσφορική ομάδα και μια ________________________ .

Μονάδες 4

  1. Τα κύτταρα, στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο, ονομάζονται ______________ .

Μονάδες 2

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

  1. Γιατί τα μιτοχόνδρια χαρακτηρίζονται ως ημιαυτόνομα οργανίδια;

Μονάδες 4

2005 ΗΜΕΡΗΣΙΟ

  1. Ποια είναι η δομή του DNAστο χώρο σύμφωνα με το μοντέλο της διπλής έλικας των Watsonκαι Crick;

Μονάδες 9

2005 ΕΣΠΕΡΙΝΟ

  1. Η ποσότητα του DNAσε κάθε οργανισμό είναι σταθερή και δεν μεταβάλλεται από τις αλλαγές στο περιβάλλον. (Σ-Λ) 

2006 ΗΜΕΡΗΣΙΟ

  1. Πώς επιβεβαιώθηκε οριστικά από τους Hersheyκαι Chaseότι το DNAείναι το γενετικό υλικό των κυττάρων;

Μονάδες 6 

2006 ΕΣΠΕΡΙΝΟ

  1. 1. Τα μιτοχόνδρια περιέχουν ως γενετικό υλικό (DNA-RNA), το οποίο κωδικοποιεί μικρό αριθμό πρωτεϊνών που ελέγχουν τη λειτουργία της (φωτοσύνθεσης-οξειδωτικής φωσφορυλίωσης). Τα μιτοχόνδρια χαρακτηρίζονται ως (αυτόνομα-ημιαυτόνομα) οργανίδια και στους ανώτερους οργανισμούς έχουν (μητρική-πατρική) προέλευση.

Μονάδες 4

5.Σε πολλά βακτήρια, εκτός από το κύριο κυκλικό DNA, υπάρχουν και τα πλασμίδια. (Σ-Λ)

2006 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

 1.Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα;

Μονάδες 4

2006 ΟΜΟΓΕΝΕΙΣ

1.Τι εννοούμε με τον όρο γονιδίωμα; Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή;

Μονάδες 8

2007 ΗΜΕΡΗΣΙΟ

1.Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα (μονάδες 2)και για ποιο λόγο; (μονάδες 5)

Μονάδες 7

2007 ΕΣΠΕΡΙΝΟ

Γ.Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή;

Μονάδες 5

2007 ΟΜΟΓΕΝΕΙΣ

1.Ποιες είναι, συνοπτικά, οι λειτουργίες του γενετικού υλικού;

Μονάδες 6

2008 ΗΜΕΡΗΣΙΟ

4.Πώς χρησιμοποιείται ο όρος αδελφές χρωματίδες, σε ποιο στάδιο της κυτταρικής διαίρεσης εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και πώς μοιράζονται στα δύο νέα κύτταρα;

Μονάδες 5 

2008 ΕΣΠΕΡΙΝΟ

1.Ποια χρωμοσώματα χαρακτηρίζονται ως αυτοσωμικά, ποια ως φυλετικά και πώς καθορίζεται το φύλο στον άνθρωπο;

Μονάδες 9

2008 ΟΜΟΓΕΝΕΙΣ

1.Ποια χρωμοσώματα στον άνθρωπο ονομάζονται αυτοσωμικά και ποια φυλετικά; (μονάδες 4). Πώς καθορίζεται το φύλο στον άνθρωπο; (μονάδες 4).

Μονάδες 8

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Να περιγράψετε το πείραμα με το οποίο επιβεβαιώθηκε οριστικά ότι το DNAείναι το γενετικό υλικό.

Μονάδες 5 

2009 ΟΜΟΓΕΝΕΙΣ

  1. Γιατί τα μιτοχόνδρια και οι χλωροπλάστες χαρακτηρίζονται ημιαυτόνομα οργανίδια;

Μονάδες 4 

2010 ΗΜΕΡΗΣΙΟ

Β1. Ποια κύτταρα ονομάζονται απλοειδή και ποια κύτταρα ονομάζονται διπλοειδή;

Μονάδες 6

Β2. Να περιγράψετε τον σχηματισμό του 3΄-5΄ φωσφοδιεστερικού δεσμού.

Μονάδες 8

2010 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε τη διαδικασία με την οποία μπορεί να κατασκευαστεί ο καρυότυπος ενός ανθρώπου.

Μονάδες 7

2011 ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε το πείραμα του Griffithκαι να αναφέρετε το συμπέρασμα στο οποίο κατέληξε.

Μονάδες 8

Β4. Η ανάλυση δειγμάτων DNAαπό δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη βρέθηκε ποσοστό γουανίνης (G) 28%. Να εξηγήσετε αν τα βακτήρια των δύο καλλιεργειών ανήκουν στο ίδιο ή σε διαφορετικό είδος.

Μονάδες 4

2011 ΕΣΠΕΡΙΝΟ

Β2. Να ταξινομήσετε τις παρακάτω μορφολογικές δομές του γενετικού υλικού ενός ευκαρυωτικού κυττάρου αρχίζοντας από το μικρότερο προς το μεγαλύτερο βαθμό συσπείρωσης:

1.ινίδια χρωματίνης

2.μεταφασικά χρωμοσώματα

3.«χάντρες» νουκλεοσωμάτων

4.διπλή έλικα DNA

5.αδελφές χρωματίδες

Μονάδες 5 

2011 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β2. Ποια είναι η μορφή των μεταφασικών χρωμοσωμάτων ενός κυττάρου (μονάδες 3), σε τι διαφέρουν μεταξύ τους (μονάδες 3) και με ποια κριτήρια ταξινομούνται κατά τη δημιουργία καρυοτύπου; (μονάδες 3)

Μονάδες 9

2011 ΟΜΟΓΕΝΕΙΣ

Β2. Να εξηγήσετε πώς συνδέονται μεταξύ τους οι δύο αλυσίδες ενός δίκλωνου μορίου DNA.

Μονάδες 6 

2012 ΟΜΟΓΕΝΕΙΣ

Β3. Τι ονομάζεται καρυότυπος;

Μονάδες 6 

2013 ΕΣΠΕΡΙΝΟ

Β3. Ποιες πληροφορίες περιέχει το μιτοχονδριακό DNAκαι γιατί τα μιτοχόνδρια χαρακτηρίζονται ως ημιαυτόνομα οργανίδια;

Μονάδες 6

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β3. Ποια βιοχημικά δεδομένα υποστήριζαν ότι το DNAείναι το γενετικό υλικό, την εποχή που οι Avery, Mac-Leodκαι McCartyεπανέλαβαν invitroτα πειράματα του Griffith;

Μονάδες 9 

2013 ΟΜΟΓΕΝΕΙΣ

Β2. Να ορίσετε τις εκφράσεις: invivo, invitro, ιχνηθέτηση. (μονάδες 6) Να αναφέρετε από ένα παράδειγμα. (μονάδες 3)

Μονάδες 9

2014 ΕΣΠΕΡΙΝΟ

Β1. Να τοποθετήσετε στη σωστή σειρά τα παρακάτω βήματα τα οποία οδηγούν στην κατασκευή καρυότυπου, γράφοντας μόνο τους αριθμούς

1.Τα κύτταρα επωάζονται σε υποτονικό διάλυμα.

2.Αναστέλλεται ο κυτταρικός κύκλος στο στάδιο της μετάφασης.

3.Τα χρωμοσώματα παρατηρούνται στο μικροσκόπιο.

4.Γίνεται επαγωγή κυτταρικών διαιρέσεων με ουσίες που έχουν μιτογόνο δράση.

5.Τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος.

6.Τα χρωμοσώματα απλώνονται σε αντικειμενοφόρο πλάκα και χρωματίζονται με ειδικές χρωστικές ουσίες.

Μονάδες 6

2014 ΟΜΟΓΕΝΕΙΣ

Β4. Η βασική μονάδα οργάνωσης της χρωματίνης είναι το νουκλεόσωμα. Να περιγράψετε τη δομή του.

Μονάδες 6

2015 ΗΜΕΡΗΣΙΟ

Β1. Να αντιστοιχίσετε τον αριθμό της στήλης Ι με ένα μόνο γράμμα, Α ή Β, της στήληςΙΙ.

Στήλη Ι Στήλη ΙΙ
1. Στην πλειονότητά τους έχουν την ικανότητα κυτταρικής διαίρεσης Α: Σωματικά κύτταρα στην αρχή της μεσόφασης
2. Παράγονται με μείωση
3. Δεν έχουν την ικανότητα κυτταρικής διαίρεσης
4. Στον άνθρωπο έχουν DNA συνολικού μήκους δύο μέτρων
5. Παράγονται με μίτωση Β: Γαμέτες
6. Οι μεταλλάξεις στο DNA τους δεν κληρονομούνται στην επόμενη γενιά
7. Στον άνθρωπο έχουν DNA συνολικού μήκους 3Χ109ζεύγη βάσεων
8. Οι μεταλλάξεις στο DNA τους κληρονομούνται στην επόμενη γενιά

Μονάδες 8

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Σωστό ή Λάθος

ε. Η μελέτη των χρωμοσωμάτων με καρυότυπο είναι δυνατή μόνο σε κύτταρα που διαιρούνται. 

2015 ΟΜΟΓΕΝΕΙΣ

Β2. Πώς καθορίζεται το φύλο στον άνθρωπο;

Μονάδες 4 

2016 ΗΜΕΡΗΣΙΟ

Β2. Τι είναι ο καρυότυπος; (μονάδες 4). Να αναφέρετε δύο (2) συμπεράσματα που μπορούν να εξαχθούν από τη μελέτη του καρυότυπου ενός ανθρώπου (μονάδες 4).

Μονάδες 8

2016 ΕΣΠΕΡΙΝΟ

Β3. Η ανάλυση της αλληλουχίας των βάσεων ενός μορίου DNAέδειξε ότι αυτό αποτελείται από 4800 νουκλεοτίδια με Αδενίνη, 4280 με Κυτοσίνη, 4530 με Θυμίνη και 4610 με Γουανίνη. Να εξηγήσετε αν αυτό το μόριο DNAμπορεί να αποτελεί γενετικό υλικό.

Μονάδες 3

2016 ΟΜΟΓΕΝΕΙΣ

Β2. Σε τι αναφέρεται ο όρος γονιδίωμα (μονάδες 2); Σε σχέση με το γονιδίωμα, ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή (μονάδες 4);

Μονάδες 6 

2017 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ-ΟΜΟΓΕΝΕΙΣ

Β2. Ποια από τα παρακάτω είναι δυνατόν να παρατηρηθούν με οπτικό μικροσκόπιο και ποια μόνο με ηλεκτρονικό;

α.νουκλεοσώματα

β.μεταφασικό χρωμόσωμα

γ.πολύσωμα

δ.θηλιά έναρξης αντιγραφής

ε.δρεπανοκύτταρα.

Μονάδες 5

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ 

Β4.Να αντιστοιχίσετε σωστά τον κάθε αριθμό της στήλης Ιμε ένα μόνο γράμμα Α ή Β της στήλης ΙΙ, με βάση την ομοιότητα του μιτοχονδριακού DNAτων ατόμων της στήλης Ι.

Στήλη Ι Στήλη ΙΙ
1. Πατέρας και κόρη του Α. Ίδιο μιτοχονδριακό DNA
2. Παππούς και εγγονή του
3. Μητέρα και κόρη της
4. Αδελφός και αδελφή του Β. Διαφορετικό μιτοχονδριακό DNA
5. Πατέρας και γιος του
6. Μητέρα και γιος της
7. Αγόρι και αδελφός της μητέρας του

 

Μονάδες 7

ΘΕΜΑ Γ

2000 ΕΣΠΕΡΙΝΟ

Α.Ο αριθμός και η μορφολογία των χρωμοσωμάτων είναι ιδιαίτερο χαρακτηριστικό των κυττάρων κάθε ζωντανού οργανισμού.

α) Ποια είναι τα μορφολογικά χαρακτηριστικά των χρωμοσωμάτων που παρατηρούνται σ’ ένα καρυότυπο;

Μονάδες 7

β) Πώς μπορεί να διαπιστωθεί το φύλο ενός ανθρώπου από τον καρυότυπο των σωματικών κυττάρων του;

Μονάδες 8

Β. Σ’ ένα ανθρώπινο σωματικό κύτταρο και σ’ ένα ανθρώπινο γαμέτη, ποια διαφορά υπάρχει στο γονιδίωμά τους και πώς ονομάζονται τα κύτταρα αυτά λόγω της συγκεκριμένης διαφοράς;

Μονάδες 10

2001 ΗΜΕΡΗΣΙΟ

1.Σε δύο κύτταρα έγινε ανάλυση του γενετικού τους υλικού και βρέθηκε η παρακάτω επί τοις % σύσταση σε αζωτούχες βάσεις.

Α Τ C G
Κύτταρο 1: 28 28 22 22
Κύτταρο 2: 31 31 19 19

Τα κύτταρα 1, 2 ανήκουν στο ίδιο ή σε διαφορετικά είδη οργανισμών

Μονάδες 2

Να αιτιολογήσετε την απάντησή σας.

Μονάδες 3

2002 ΟΜΟΓΕΝΕΙΣ

1.Ποια είναι η δομή του DNAστο χώρο, σύμφωνα με το μοντέλο της διπλής έλικας;

Μονάδες 12

2005 ΟΜΟΓΕΝΕΙΣ

Α. Στα σωματικά κύτταρα του ανθρώπου υπάρχουν σαράντα έξι (46) χρωμοσώματα.

1.Πόσα χρωμοσώματα κληρονομεί ένα παιδί από τον πατέρα του;

Μονάδες 2

Να δικαιολογήσετε την απάντησή σας.

Μονάδες 3

2.Πόσα αυτοσωμικά χρωμοσώματα υπάρχουν στα σωματικά κύτταρα μιας γυναίκας;

Μονάδες 2

Να δικαιολογήσετε την απάντησή σας.

Μονάδες 3

2010 ΟΜΟΓΕΝΕΙΣ 

Γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που έγινε σε κύτταρα του εμβρύου διαπιστώθηκε τρισωμία 18 και σύνδρομο Turner.

Γ1.Να περιγράψετε τη διαδικασία κατασκευής του καρυότυπου.

Μονάδες 10

2014 ΕΣΠΕΡΙΝΟ

Γ1. Να τοποθετήσετε κατά μέγεθος από το μικρότερο στο μεγαλύτερο, ανάλογα με την ποσότητα του γενετικού υλικού, τα παρακάτω: νουκλεόσωμα, μεταφασικό χρωμόσωμα, γονίδιο, αδελφή χρωματίδα (Το μέσο γονίδιο αποτελείται περίπου από 1000 ζεύγη βάσεων.)

Μονάδες 4

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ – ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

 Γ1. Το φύλο στα κουνέλια καθορίζεται όπως και στον άνθρωπο. Όταν ένα φυσιολογικό σωματικό κύτταρο θηλυκού κουνελιού βρίσκεται στη μετάφαση, το μήκος του DNAτου πυρήνα του είναι 1,6m. Με βάση αυτά τα δεδομένα, το μήκος του συνολικού DNAτου κάθε φυσιολογικού γαμέτη αυτού του κουνελιού είναι:

α)1,6m, β)0,4m,γ) 0,8m, δ)λίγο μεγαλύτερο από 0,4m.

Να γράψετε στο τετράδιό σας τη σωστή απάντηση (μονάδες 2) και να αιτιολογήσετε την επιλογή σας. (μονάδες 3)

Μονάδες 5

Γ2. Σύμφωνα με τα δεδομένα του ερωτήματος Γ1, θα είναι το ίδιο ή όχι το συνολικό μήκος του DNAόλων των φυσιολογικών γαμετών ενός αρσενικού κουνελιού, με το μήκος του συνολικού DNAτων φυσιολογικών γαμετών ενός θηλυκού κουνελιού;

Μονάδες 3

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ3. Ένα φυσιολογικό ωάριο ενός πιθήκου περιέχει 24 χρωμοσώματα. Πόσες αλυσίδες DNAυπάρχουν στον καρυότυπο του συγκεκριμένου οργανισμού; (μονάδες 3) Να αιτιολογήσετε την απάντησή σας. (μονάδες 6)

Μονάδες 9

2018 ΕΣΠΕΡΙΝΟ

Γ1. Στα κύτταρα ενός οργανισμού που βρίσκονται στη μετάφαση υπάρχουν 96 μόρια DNA. Να βρείτε:

α. τον αριθμό των χρωμοσωμάτων και των χρωματίδων που υπάρχουν στη μετάφαση.

β. τον αριθμό των ινιδίων χρωματίνης που υπάρχουν στην αρχή της μεσόφασης και στο τέλος της.

γ. τον αριθμό των μορίων DNA στην αρχή της μεσόφασης και στο τέλος της.

δ. τον αριθμό των χρωμοσωμάτων και των μορίων DNA στους γαμέτες.

ε. τον αριθμό των χρωμοσωμάτων και των μορίων DNA στο φυσιολογικό ζυγωτό.

Μονάδες 10

ΘΕΜΑ Δ

2000 ΗΜΕΡΗΣΙΟ

Ένα ανθρώπινο σωματικό κύτταρο έχει 46 χρωμοσώματα.

Α.1. Πόσα μόρια DNAσυνολικά υπάρχουν στα χρωμοσώματα του συγκεκριμένου κυττάρου, στο στάδιο της μετάφασης της μίτωσης;

          Μονάδες 2

  1. Να δικαιολογήσετε την απάντησή σας.

Μονάδες 4

Β. Να περιγράψετε τις χαρακτηριστικές μορφές, με τις οποίες εμφανίζεται το γενετικό υλικό ενός ευκαρυωτικού κυττάρου, ανάλογα με το στάδιο του κυτταρικού κύκλου που βρίσκεται.

Μονάδες 9

2012 ΗΜΕΡΗΣΙΟ

Δ4. Από τη μύγα Drosophilaαπομονώθηκαν τρία διαφορετικά φυσιολογικά κύτταρα στα οποία προσδιορίστηκε το μέγεθος του γονιδιώματος σε ζεύγη βάσεων. Στο πρώτο κύτταρο το μέγεθος του γονιδιώματος υπολογίστηκε σε 3,2·108ζεύγη βάσεων, στο δεύτερο κύτταρο σε 1,6·108ζεύγη βάσεων και στο τρίτο κύτταρο σε 6,4·108ζεύγη βάσεων. Να δικαιολογήσετε γιατί υπάρχουν οι διαφορές αυτές στο μέγεθος του γονιδιώματος των τριών κυττάρων.

Μονάδες 6