Monthly Archives: Μαΐου 2019

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 8ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ

ΘΕΜΑ Α

2003 ΕΣΠΕΡΙΝΟ

1.Οι ιντερφερόνες είναι

α.αντιικές πρωτεΐνες που παράγονται από κύτταρα που έχουν μολυνθεί από ιούς.

β.ένζυμα που ελέγχουν το μεταβολισμό των σακχάρων.

γ.πρωτεΐνες που προκαλούν σύντηξη των καρκινικών κυττάρων.

δ.χημικές ενώσεις που προκαλούν αλλαγές στα γονίδια.

Μονάδες 5

2003 ΟΜΟΓΕΝΕΙΣ

5.Τα μονοκλωνικά αντισώματα παράγονται από

α.καρκινικά κύτταρα.

β.έναν κλώνο Β-λεμφοκυττάρων.

γ.βακτήρια.

δ.ερυθρά αιμοσφαίρια.

Μονάδες 5

2004 ΗΜΕΡΗΣΙΟ

  1. Οι ιντερφερόνες που χρησιμοποιεί σήμερα ο άνθρωπος είναι δυνατόν να παράγονται σε μεγάλες ποσότητες από …

α.κύτταρα ανθρώπου.

β.κύτταρα ζώων.

γ.γενετικά τροποποιημένα βακτήρια.

δ.φυτικά κύτταρα.

Μονάδες 5

2004 ΕΣΠΕΡΙΝΟ

  1. Η ινσουλίνη είναι μια ορμόνη που ρυθμίζει

α.το μεταβολισμό των υδατανθράκων στο αίμα.

β.τη συγκέντρωση των πρωτεϊνών στο αίμα.

γ.τη συγκέντρωση των αλάτων στο αίμα.

δ.το μεταβολισμό της χοληστερόλης.

Μονάδες 5

2004 ΟΜΟΓΕΝΕΙΣ

  1. Οι ιντερφερόνες είναι πρωτεΐνες που παράγονται από κύτταρα

α.που μολύνθηκαν από ιούς.

β.που μολύνθηκαν από μύκητες.

γ.ατόμων με χρωμοσωμικές ανωμαλίες.

δ.μόνο φυτικών οργανισμών.

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

3.Exvivoονομάζεται η γονιδιακή θεραπεία κατά την οποία …

α. τα κύτταρα τροποποιούνται έξω από τον οργανισμό και εισάγονται πάλι σ’ αυτόν.

β.τα κύτταρα τροποποιούνται μέσα στον οργανισμό του ασθενούς.

γ.τα κύτταρα πολλαπλασιάζονται στο εργαστήριο.

δ.τα κύτταρα συντήκονται με αντισώματα.

Μονάδες 5 

2005 ΟΜΟΓΕΝΕΙΣ

  1. Κατά την invivoγονιδιακή θεραπεία

α.τα φυσιολογικά γονίδια εισάγονται κατ’ ευθείαν στον οργανισμό.

β.τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό.

γ.γίνεται πλήρης αντικατάσταση του μεταλλαγμένου γονιδίου.

δ.χρησιμοποιούνται ως φορείς βακτήρια ή πρωτόζωα.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

  1. Τα αντισώματα είναι

α.νουκλεϊκά οξέα.

β.πρωτεΐνες.

γ.υδατάνθρακες.

δ.λιπίδια.

Μονάδες 3

2006 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟΥ 

4.Στην exvivoγονιδιακή θεραπεία τα κύτταρα του ασθενούς

α.τροποποιούνται μέσα στον οργανισμό του.

β.τροποποιούνται έξω από τον οργανισμό του και εισάγονται πάλι σ’ αυτόν.

γ.συντήκονται με καρκινικά κύτταρα.

δ.ιχνηθετούνται με ραδιενεργό φώσφορο.

Μονάδες 5

2006 ΟΜΟΓΕΝΕΙΣ

5.Η γονιδιακή θεραπεία

α.εφαρμόζεται μόνο στα λεμφοκύτταρα.

β.έχει ως στόχο να διορθώσει μια γενετική βλάβη.

γ.αντικαθιστά πολλά μεταλλαγμένα γονίδια.

δ.μεταβιβάζεται πάντοτε στους απογόνους.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ

5.Η κυστική ίνωση κληρονομείται με

α.φυλοσύνδετο επικρατή τύπο κληρονομικότητας.

β.φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας.

γ.αυτοσωμικό επικρατή τύπο κληρονομικότητας.

δ.αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

5.Η ινσουλίνη είναι μια ορμόνη που

α.ρυθμίζει την παραγωγή αντιικών πρωτεϊνών.

β.ρυθμίζει το μεταβολισμό των υδατανθράκων.

γ.παράγεται από πρόδρομα ερυθροκύτταρα.

δ.παράγεται από Β-λεμφοκύτταρα.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

4.Κατά την invivoγονιδιακή θεραπεία

α.χρησιμοποιούνται μεταλλαγμένα βακτήρια ως φορείς.

β.τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό.

γ.γίνεται αντικατάσταση των μεταλλαγμένων γονιδίων.

δ.τα φυσιολογικά γονίδια εισάγονται κατευθείαν στον οργανισμό.

Μονάδες 5

2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

5.Οι ιντερφερόνες είναι πρωτεΐνες που

α.παράγονται από τα κύτταρα του παγκρέατος.

β.παράγονται από υβριδώματα.

γ.έχουν αντιιική δράση.

δ.φέρουν γενετικές πληροφορίες.

Μονάδες 5 

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

  1. Η γονιδιακή θεραπεία εφαρμόσθηκε για την αντιμετώπιση

α.της κυστικής ίνωσης.

β.του αλφισμού.

γ.της υπερχοληστερολαιμίας.

δ.του συνδρόμου Down.

Μονάδες 5

2009 ΟΜΟΓΕΝΕΙΣ

  1. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες

α.λιπιδίων.

β.DNA.

γ.RNA.

δ.μονοκλωνικών αντισωμάτων.

Μονάδες 5 

2010 ΕΣΠΕΡΙΝΟ

Α2. Η ινσουλίνη είναι μια ορμόνη που ρυθμίζει

α.τον μεταβολισμό των πρωτεϊνών.

β.τη συγκέντρωση των αλάτων στα ούρα.

γ.τον μεταβολισμό των υδατανθράκων στο αίμα.

δ.τη συγκέντρωση της χοληστερόλης στο αίμα.

Μονάδες 5

2011 ΗΜΕΡΗΣΙΟ

Α5. Τα υβριδώματα παράγονται ύστερα από

α.σύντηξη βακτηρίων με καρκινικά κύτταρα.

β.σύντηξη Β λεμφοκυττάρων με καρκινικά κύτταρα.

γ.σύντηξη Β λεμφοκυττάρων με ιούς.

δ.υβριδοποίηση δύο μονόκλωνων αλυσίδων DNA.

Μονάδες 5

2012 ΕΣΠΕΡΙΝΟ

Α3. Τα υβριδώματα παράγονται ύστερα από σύντηξη

α.β-λεμφοκυττάρων με ιούς

β.β-λεμφοκυττάρων με βακτήρια

γ.μονοκλωνικών αντισωμάτων με καρκινικά κύτταρα

δ.β-λεμφοκυττάρων με καρκινικά κύτταρα.

Μονάδες 5

2012 ΟΜΟΓΕΝΕΙΣ

Α1. Η ασθένεια που χαρακτηρίζεται από έλλειψη ή μείωση ινσουλίνης είναι

α.ο αλφισμός.

β.η φαινυλκετονουρία.

γ.ο διαβήτης.

δ.η αιμορροφιλία.

Μονάδες 5 

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α4. Τα υβριδώματα είναι

α.υβρίδια καλαμποκιού

β.καρκινικά κύτταρα

γ.υβριδικά μόρια DNA-RNA

δ.κύτταρα που προκύπτουν από σύντηξη Β-λεμφοκυττάρων με καρκινικά κύτταρα.

Μονάδες 5

2013 ΟΜΟΓΕΝΕΙΣ

Α4. Υβριδώματα ονομάζονται τα

α. κύτταρα που προκύπτουν από σύντηξη Β-λεμφοκυττάρων με καρκινικά κύτταρα.

β.κύτταρα που προκύπτουν μετά από βακτηριακή ζύμωση.

γ.υβρίδια καλαμποκιού.

δ.υβριδοποιημένα μόρια DNA.

Μονάδες 5

Α5. Τα αντισώματα είναι

α.νουκλεϊκά οξέα.

β.υδατάνθρακες.

γ.λιπίδια.

δ.πρωτεΐνες.

Μονάδες 5

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α5. Με τη γονιδιακή θεραπεία

α.παράγονται μονοκλωνικά αντισώματα

β.γίνεται εισαγωγή του φυσιολογικού αλληλόμορφου γονιδίου

γ.γίνεται αντικατάσταση του μεταλλαγμένου γονιδίου από το φυσιολογικό

δ.μεταβιβάζεται στους απογόνους το φυσιολογικό γονίδιο.

Μονάδες 5

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ 

Α5. Ο τύπος γονιδιακής θεραπείας κατά τον οποίο τα κύτταρα τροποποιούνται έξω από τον οργανισμό ονομάζεται

α.exvivo

β.ιχνηθέτηση

γ.invivo

δ.χαρτογράφηση.

Μονάδες 5

2014 ΟΜΟΓΕΝΕΙΣ

Α3. Η ινσουλίνη χρησιμοποιείται για τη θεραπεία

α.της αιμορροφιλίας

β.του εμφυσήματος

γ.της κυστικής ίνωσης

δ.του διαβήτη.

Μονάδες 5

Α4. Στόχος της γονιδιακής θεραπείας είναι η

α.παραγωγή μονοκλωνικών αντισωμάτων

β.αντικατάσταση του μεταλλαγμένου γονιδίου

γ.«διόρθωση» της γενετικής βλάβης

δ.παραγωγή φαρμακευτικών πρωτεϊνών.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ

Α4.Η κυστική ίνωση κληρονομείται ως

α.αυτοσωμικός επικρατής χαρακτήρας

β.φυλοσύνδετος υπολειπόμενος χαρακτήρας

γ.φυλοσύνδετος επικρατής χαρακτήρας

δ.αυτοσωμικός υπολειπόμενος χαρακτήρας.

Μονάδες 5

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α3. Οι ιντερφερόνες είναι

α.πρωτεΐνες

β.αντιβιοτικά

γ.εμβόλια

δ.αντισώματα.

Μονάδες 5

Α4. Για τη θεραπεία του διαβήτη χρησιμοποιούμε

α.α1-αντιθρυψίνη

β.ιντερφερόνες

γ.ινσουλίνη

δ.παράγοντα ΙΧ

Μονάδες 5

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α4. Η ανεπάρκεια του ανοσοποιητικού συστήματος λόγω έλλειψης του ενζύμου απαμινάση της αδενοσίνης (ADA)

α.οφείλεται στον ιό του AIDS

β.δεν μπορεί να αντιμετωπιστεί με γονιδιακή θεραπεία

γ.εμφανίζει αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας

δ.εμφανίζεται μόνο σε γενετικά τροποποιημένους οργανισμούς.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α2. Η ινσουλίνη

α.παράγεται από κύτταρα του ήπατος

β.ρυθμίζει τη συγκέντρωση των λιπιδίων στο αίμα

γ.αποτελείται από δύο μικρά πεπτίδια

δ.κωδικοποιείται από δυο γονίδια.

Μονάδες 5

2016 ΟΜΟΓΕΝΕΙΣ

Α3. Η πρώτη invivoγονιδιακή θεραπεία εφαρμόστηκε το 1993 για τη θεραπεία της

α.κυστικής ίνωσης

β.φαινυλκετονουρίας

γ.υπερχοληστερολαιμίας

δ.αιμορροφιλίας.

Μονάδες 5

Α4. Η ινσουλίνη

α.αποτελείται από μόρια γλυκόζης

β.παράγεται στο ήπαρ

γ.όταν απουσιάζει από τον οργανισμό προκαλείται διαβήτης

δ.αποτελείται από νουκλεοτίδια.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α5. Ο ανθρώπινος αντιαιμορροφιλικός παράγοντας ΙΧ παραλαμβάνεται από

α.διαγονιδιακά θηλυκά πρόβατα

β.διαγονιδιακά αρσενικά πρόβατα

γ.διαγονιδιακά αρσενικά και θηλυκά πρόβατα

δ.μικρής ηλικίας θηλυκά πρόβατα.

Μονάδες 5

2017 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ-ΟΜΟΓΕΝΕΙΣ

Α1. Η γονιδιακή θεραπεία είναι δυνατόν να εφαρμοστεί

α.στο σύνδρομο Down

β.στον καρκίνο του παχέος εντέρου

γ.στην αιμορροφιλία Α

δ.στην υπερχοληστερολαιμία.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Α5. Η γονιδιακή θεραπεία έχει ως στόχο τη «διόρθωση» της γενετικής βλάβης με

α. αντικατάσταση του φυσιολογικού επικρατούς αλληλόμορφου σε όλα τα κύτταρα του ασθενή

β.αντικατάσταση του φυσιολογικού επικρατούς αλληλόμορφου σε ορισμένα σωματικά κύτταρα του ασθενή

γ.την εισαγωγή του φυσιολογικού υπολειπόμενου αλληλόμορφου σε όλα τα κύτταρα του ασθενή

δ.την εισαγωγή του φυσιολογικού επικρατούς αλληλόμορφου σε ορισμένα σωματικά κύτταρα του ασθενή.

Μονάδες 5

2018 ΗΜΕΡΗΣΙΟ

Α3. Ραδιενεργός 32Ρ και ραδιενεργό 35S είναι δυνατόν να ενσωματωθούν αντίστοιχα:

α. σε έναν υποκινητή γονιδίου και ένα μονοκλωνικό αντίσωμα

β. στην DNA πολυμεράση και σε ένα πλασμίδιο

γ. στην RNA πολυμεράση και στην προϊνσουλίνη

δ. στον χειριστή του οπερονίου της λακτόζης και στην λακτόζη.

Μονάδες 5 

ΘΕΜΑ Β

2001 ΟΜΟΓΕΝΕΙΣ

  1. Να περιγράψετε την τεχνική παραγωγής μονοκλωνικών αντισωμάτων για ένα συγκεκριμένο αντιγόνο.

Μονάδες 10

ΕΣΠΕΡΙΝΟ 2002

Α.Να ξαναγράψετε στο τετράδιό σας τις προτάσεις, αφού συμπληρώσετε τα κενά με τις σωστές λέξεις.

1.Η ινσουλίνη είναι μία ορμόνη που αποτελείται από 51 ……… και παράγεται από ειδικά κύτταρα του ………….. Η ορμόνη αυτή ρυθμίζει το μεταβολισμό των ……….. και ειδικότερα το ποσοστό της γλυκόζης στο ………. .

Μονάδες 6

2002 ΟΜΟΓΕΝΕΙΣ

1.Τι είναι οι φαρμακευτικές πρωτεΐνες;

Μονάδες 5

  1. Να περιγράψετε πώς τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν ως θεραπευτικά μέσα.

Μονάδες 10

2004 ΗΜΕΡΗΣΙΟ

Να απαντήσετε στις παρακάτω ερωτήσεις:

  1. Ποιος είναι ο ρόλος των μονοκλωνικών αντισωμάτων ως ανοσοδιαγνωστικά;

Μονάδες 7

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

4.Με ποια διαδικασία παράγονται μονοκλωνικά αντισώματα στο εργαστήριο για ένα επιλεγμένο αντιγόνο;

Μονάδες 7

2005 ΗΜΕΡΗΣΙΟ

  1. Τι είναι οι ιντερφερόνες, τι προκαλούν και σε ποιες περιπτώσεις μπορούν να χρησιμοποιηθούν για την αντιμετώπιση ασθενειών;

Μονάδες 9

2005 ΕΣΠΕΡΙΝΟ

  1. Η γονιδιακή θεραπεία στηρίζεται στην εφαρμογή της τεχνολογίας του ανασυνδυασμένου DNA. (Σ-Λ)

Μονάδες 3

2006 ΕΣΠΕΡΙΝΟ

  1. Η ινσουλίνη είναι μία (ορμόνη – βιταμίνη) που αποτελείται από 51 (αμινοξέα – νουκλεοτίδια) και παράγεται από ειδικά κύτταρα του (ήπατος – παγκρέατος). Ρυθμίζει το μεταβολισμό των (υδατανθράκων – πρωτεϊνών) και ειδικότερα το ποσοστό τους (στο αίμα – στα ούρα). Η ασθένεια που οφείλεται στην έλλειψη ή μείωση της ινσουλίνης ονομάζεται (διαβήτης – αναιμία).

Μονάδες 6

  1. Η γονιδιακή θεραπεία στοχεύει να “διορθώσει” τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου.

Μονάδες 3

2006 ΟΜΟΓΕΝΕΙΣ

3.Τι είναι μονοκλωνικά αντισώματα και ως τι χρησιμοποιούνται;

Μονάδες 8

2007 ΕΣΠΕΡΙΝΟ

Β.Να γράψετε στο τετράδιό σας το γράμμα κάθε στοιχείου της Στήλης Ι και δίπλα στο γράμμα αυτό τον αριθμό ενός στοιχείου της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                   Στήλη Ι                                                      Στήλη ΙΙ

(ασθένεια)                                   (φαρμακευτική ουσία που ενδείκνυται)

α. διαβήτης                                                1.α1-αντιθρυψίνη

                   β.καρκίνος                                               2. απαμινάση της αδενοσίνης

                   γ.εμφύσημα                                              3. ιντερφερόνες

                   δ.κληρονομική ανεπάρκεια                      4. παράγοντας ΙΧ

                   ανοσοποιητικού συστήματος

                   ε.αιμορροφιλία Β                                      5. φαινυλαλανίνη

                                                                                     6.αυξητική ορμόνη

                                                                                     7.ινσουλίνη

Μονάδες 10

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

3.Τι είναι και πού οφείλεται η κυστική ίνωση; (μονάδες 2) Ποια είναι η διαδικασία που εφαρμόστηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993; (μονάδες 6)

Μονάδες 8

2008 ΗΜΕΡΗΣΙΟ

3.Πώς συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος στη μελέτη της εξέλιξής του και στη μαζική παραγωγή προϊόντων;

Μονάδες 7

2008 ΕΣΠΕΡΙΝΟ

2.Γιατί η “διόρθωση” μιας γενετικής βλάβης που επιτυγχάνεται με τη γονιδιακή θεραπεία δεν μεταβιβάζεται στους απογόνους;

Μονάδες 8

2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

4.Τι είναι γονιδιακή θεραπεία και ποιος ο στόχος της;

Μονάδες 4

2009 ΗΜΕΡΗΣΙΟ

  1. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου; (μονάδες 5) Ποια τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας; (μονάδες 2)

Μονάδες 7

2009 ΕΣΠΕΡΙΝΟ

Β. Ένας νέος τομέας της βιοτεχνολογίας που αναπτύσσεται ταχύτατα είναι η γονιδιακή θεραπεία.

1.Ποιος είναι ο στόχος της γονιδιακής θεραπείας;

Μονάδες 5

  1. Ποιες είναι οι προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας;

Μονάδες 6

  1. Να αναφέρετε ονομαστικά τους τύπους γονιδιακής θεραπείας.

Μονάδες 4

2010 ΕΣΠΕΡΙΝΟ

  1. Οι ιντερφερόνες παράγονται από κύτταρα που έχουν μολυνθεί από ………… .
  2. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες ενός …………… αντισώματος.

Μονάδες 4

2011 ΕΣΠΕΡΙΝΟ

Β1.Να γράψετε στο τετράδιό σας τα γράμματα της Στήλης Ι και δίπλα σε κάθε γράμμα, τον αριθμό της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία τηςΣτήλης ΙΙ περισσεύουν.

                       Στήλη Ι                                                            Στήλη ΙΙ

α.invivoγονιδιακή θεραπεία                               1.μικροέγχυση

       β.γενετική τροποποίηση ζώων                           2. περιοριστική ενδονουκλεάση

       γ.ημιαυτόνομα οργανίδια                                     3. ριβοσώματα

       δ.ένζυμο που συνδέει τμήματα DNA                   4. RNAπολυμεράση

       ε.πλασμίδιο Ti                                                      5. DNAδεσμάση

       στ.σύνθεση κυτταροπλασματικών πρωτεϊνών   6.μιτοχόνδρια

                                                                                     7.Agrobacteriumtumefaciens

                                                                                     8.κυστική ίνωση

Μονάδες 12

2011 ΟΜΟΓΕΝΕΙΣ

Β1. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 8 

2012 ΗΜΕΡΗΣΙΟ

Β1. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα για την επιλογή οργάνων συμβατών στις μεταμοσχεύσεις;

Μονάδες 6

2013 ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε τη διαδικασία που εφαρμόστηκε για πρώτη φορά το 1990  στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος, η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA).

Μονάδες 8

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β3. Μια από τις πιο ενδιαφέρουσες χρήσεις των μονοκλωνικών αντισωμάτων είναι η εφαρμογή τους στη θεραπεία του καρκίνου. Σε ποια ιδιότητα των μονοκλωνικών αντισωμάτων βασίζεται αυτή η εφαρμογή; (μονάδες 2) Να περιγράψετε τον τρόπο της θεραπευτικής τους δράσης. (μονάδες 4)

Μονάδες 6

2015 ΗΜΕΡΗΣΙΟ

Β4. Τι είναι η ινσουλίνη και ποιος είναι ο ρόλος της;

Μονάδες 6

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β2. β.Όλα τα αντιγόνα έχουν πάντα μία μόνο περιοχή που αναγνωρίζεται από μόνο ένα αντίσωμα. Σωστόή Λάθος

Μονάδα 1

2015 ΟΜΟΓΕΝΕΙΣ 

Β4. Τι ονομάζεται αντιγονικός καθοριστής (μονάδες 3) και ποια αντισώματα ονομάζονται μονοκλωνικά (μονάδες 3);

Μονάδες 6

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β4. Τα μονοκλωνικά αντισώματα μπορούν να συνεισφέρουν σημαντικά στην αύξηση της ευαισθησίας κλινικών δοκιμασιών όπως η ταυτοποίηση των ομάδων αίματος. Στην παρασκευή ενός τέτοιου τεστ προσδιορισμού των ομάδων αίματος, σύμφωνα με το σύστημα ΑΒ0, να εξηγήσετε πόσα και ποια μονοκλωνικά αντισώματα θα πρέπει να περιέχονται.

Μονάδες 6

2016 ΟΜΟΓΕΝΕΙΣ

Β1. Να αντιστοιχίσετε σωστά τον αριθμό (1, 2, 3, 4και 5) καθεμιάς από τις πρωτεΐνες της στήλης Ιμε το γράμμα της εφαρμογής (Α, Β, Γ, Δκαι Ε) που αναφέρεται στη στήλη ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. α1αντιθρυψίνη Α: Αντιιικός παράγοντας
2. Παράγοντας VIII B:Αιμορροφιλία Α
3. Παράγοντας ΙΧ Γ: Εμφύσημα
4. Ιντερφερόνες Δ: Τεστ κύησης
5. Μονοκλωνικά αντισώματα Ε: Αιμορροφιλία Β

 

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ

Β3. Κατά την έναρξη της κύησης ο οργανισμός της εγκυμονούσας παράγει μια ειδική ορμόνη, τη χοριακή γοναδοτροπίνη. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων που θα μπορούσαν να χρησιμοποιηθούν σε διαγνωστικούς ελέγχους (τεστ) κύησης.

Μονάδες 7

2017 ΕΣΠΕΡΙΝΟ

Β3. Στο μαστικό αδένα ενός προβάτου υπάρχει συγκεκριμένος κυτταρικός τύπος στον οποίο εκφράζεται το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος. Θέλουμε να πάρουμε την πρωτεΐνη α1-αντιθρυψίνη από το γάλα ενός διαγονιδιακού προβάτου. Για το λόγο αυτό εισάγουμε μέσα στο γονίδιο της καζεΐνης με κατάλληλο προσανατολισμό το γονίδιο της α1-αντιθρυψίνης. Να εξηγήσετε γιατί θα εκφραστεί το γονίδιο της α1-αντιθρυψίνης στα κύτταρα του μαστικού αδένα.

Μονάδες 6

Β4. Κατά την έναρξη της κύησης ο οργανισμός της εγκυμονούσας παράγει μια ειδική ορμόνη, τη χοριακή γοναδοτροπίνη. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων που θα μπορούσαν να χρησιμοποιηθούν σε διαγνωστικούς ελέγχους (τεστ) κύησης.

Μονάδες 7 

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Β1. Να αντιστοιχίσετε σωστά τον κάθε αριθμό της Στήλης Ι (δομές/μόρια) με ένα μόνο γράμμα της Στήλης ΙΙ(διαδικασίες). Επισημαίνεται ότι μία από τις διαδικασίες της Στήλης ΙΙ δεν έχει αντιστοιχία με κάποια από τις δομές/μόρια της Στήλης Ι.

Στήλη Ι (δομές/μόρια) Στήλη ΙΙ (διαδικασίες)
1. νουκλεόσωμα Α. Αντιγραφή
2. πριμόσωμα Β. Μετάφραση
3. πολύσωμα Γ. Ανοσοδιάγνωση
4. ριβονουκλεοπρωτεϊνικά σωματίδια Δ. Αντίστροφη μεταγραφή
5. μονοκλωνικά αντισώματα Ε. Συσπείρωση γενετικού υλικού
ΣΤ. Ωρίμανση mRNA

Μονάδες 5

Β2. Να αναφέρετε τα βήματα που απαιτούνται για να παραχθεί μια φαρμακευτική πρωτεΐνη ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 6

2018 ΗΜΕΡΗΣΙΟ

Β1. Να αντιστοιχίσετε τον κάθε αριθμό της στήλης Ι με ένα μόνο γράμμα της στήλης ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. Περιοριστική ενδονουκλεάση α. Πολυσακχαρίτης
2. Πρωταρχικό τμήμα
3. Πριμόσωμα β. Νουκλεϊκό οξύ
4. Άγαρ
5. Αντίσωμα γ. Πρωτεΐνη
6. Απαμινάση της αδενοσίνης
7. Πλασμίδιο

 

Μονάδες 7

Β3. Σε ποιους βασικούς στόχους της Ιατρικής έχει συμβάλει αποτελεσματικά η βιοτεχνολογία;

Μονάδες 3

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ

Β3. Ποιες ιδιότητες των υβριδωμάτων επιτρέπουν την αποτελεσματική τους χρήση στην παραγωγή μεγάλων ποσοτήτων μονοκλωνικών αντισωμάτων;

Μονάδες 6

ΘΕΜΑ Γ

2000 ΗΜΕΡΗΣΙΟ 

Α. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 9

2001 ΗΜΕΡΗΣΙΟ

  1. Μία ανωμαλία του γονιδίου που ελέγχει τη σύνθεση του ενζύμου απαμινάση της αδενοσίνης (ADA) προκαλεί μία ασθένεια του ανοσοποιητικού συστήματος. Απομονώθηκε το mRNAτου ενζύμου ADAαπό υγιές άτομο και από άτομο που ασθενεί. Τμήματα των παραπάνω mRNAείναι:

                   Υγιές άτομο:               AUGGAAUUUUGGGGGCGCACGUCG……

Άτομο που ασθενεί:   AUGGAAUUUUAGGGGCGCACGUCG……

α.Ποια είναι η αιτία της ασθένειας;

Μονάδες 6

β.Με ποιο τρόπο κληρονομείται αυτή η ασθένεια;

Μονάδες 2 

ΕΣΠΕΡΙΝΟ 2002

Α. 1. Τι είναι τα μονοκλωνικά αντισώματα;

Μονάδες 5

2.Πώς λειτουργούν τα μονοκλωνικά αντισώματα ως θεραπευτικά μέσα;

Μονάδες 8

2003 ΗΜΕΡΗΣΙΟ

1.Πώς αντιμετωπίζεται η κυστική ίνωση με γονιδιακή θεραπεία;

Μονάδες 10

2.Άνδρας ο οποίος πάσχει από κυστική ίνωση και υποβλήθηκε σε γονιδιακή θεραπεία για τη νόσο αποκτά παιδιά με φυσιολογική γυναίκα. Τι πιθανότητες υπάρχουν να είναι τα παιδιά τους φυσιολογικά; Να δικαιολογήσετε την απάντησή σας.

Μονάδες 15

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Η ινσουλίνη είναι μία ορμόνη απαραίτητη για την καλή λειτουργία του ανθρώπινου οργανισμού.

1.Ποιος είναι ο ρόλος της ινσουλίνης στον οργανισμό μας;

Μονάδες 5

2.Από τι αποτελείται το μόριο της ινσουλίνης;

Μονάδες 5

3.Να γράψετε συνοπτικά τα στάδια παραγωγής της ανθρώπινης ινσουλίνης σε καλλιέργεια βακτηρίων.

Μονάδες 15

2003 ΟΜΟΓΕΝΕΙΣ

Α. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990, σ’ ένα τετράχρονο κορίτσι που έπασχε από έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA). Να περιγράψετε τη διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας.

Μονάδες 10

2005 ΕΣΠΕΡΙΝΟ

Ο οργανισμός μας είναι ικανός να παράγει αντισώματα εναντίον κάθε ξένου αντιγόνου.

  1. Πώς ο αντιγονικός καθοριστής σχετίζεται με την παραγωγή μονοκλωνικών αντισωμάτων από τον οργανισμό;

Μονάδες 10

  1. Πώς παράγονται στο εργαστήριο μεγάλες ποσότητες μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο;

Μονάδες 15

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Η Βιοτεχνολογία με την παραγωγή μονοκλωνικών αντισωμάτων και τη γονιδιακή θεραπεία έχει συμβάλει αποτελεσματικά στην υλοποίηση των βασικών στόχων της Ιατρικής, μεταξύ των οποίων είναι και η αποτελεσματική θεραπεία ασθενειών.

1.Γιατί τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν στη θεραπεία του καρκίνου (Μονάδες 6) και ποια είναι τα πλεονεκτήματα που παρουσιάζει η χρήση τους έναντι άλλων μεθόδων θεραπείας του (Μονάδες 2);

Μονάδες 8

2.Ποια διαδικασία ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (Μονάδες 8) και τι πιθανά προβλήματα αντιμετωπίζουν τα άτομα που πάσχουν από τη συγκεκριμένη ασθένεια (Μονάδες 3);

Μονάδες 11

  1. Γιατί η χρήση της γονιδιακής θεραπείας θα είναι περιορισμένη στο άμεσο μέλλον;

Μονάδες 6

2007 ΗΜΕΡΗΣΙΟ

Η Βιοτεχνολογία με την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA, τη χρήση της τεχνικής PCRκαι την παραγωγή μονοκλωνικών αντισωμάτων συνεισφέρει σε τομείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική.

1.Τι επιτρέπει η μέθοδος της αλυσιδωτής αντίδρασης της πολυμεράσης (PCR); (μονάδες 4) Να αναφέρετε τρεις πρακτικές εφαρμογές της (μονάδες 3).

Μονάδες 7

2.Να περιγράψετε τη διαδικασία παραγωγής στο εργαστήριο μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 8

2007 ΟΜΟΓΕΝΕΙΣ

Βιοτεχνολογία, με την ευρεία έννοια, είναι η χρήση ζωντανών οργανισμών προς όφελος του ανθρώπου και στηρίζεται κυρίως σε τεχνικές καλλιέργειας και ανάπτυξης των μικροοργανισμών και σε τεχνικές ανασυνδυασμένου DNA.

1.Με ποιο τρόπο καλλιεργούνται οι μικροοργανισμοί σε μεγάλη κλίμακα (βιομηχανική καλλιέργεια);

Μονάδες 10

2.Τι εννοούμε με τον όρο ζύμωση και ποια είναι τα προϊόντα της ζύμωσης;

Μονάδες 5

3.Η ανθρώπινη ινσουλίνη είναι μία από τις φαρμακευτικές πρωτεΐνες που παράγονται από βακτήρια. Μία από τις μεθόδους που χρησιμοποιούνται για την παραγωγή της είναι η παραγωγή του πρόδρομου μορίου της σε μία βακτηριακή καλλιέργεια και η μετατροπή του σε ινσουλίνη με ενζυμική κατεργασία. Να γράψετε, συνοπτικά, τα στάδια αυτής της μεθόδου.

Μονάδες 10

2008 ΕΣΠΕΡΙΝΟ 

Για την παραγωγή του προδρόμου μορίου της ινσουλίνης, δηλαδή της προϊνσουλίνης, κατάλληλα μετασχηματισμένα κύτταρα Escherichiacoliκαλλιεργήθηκαν σε βιοαντιδραστήρα. Η απεικόνιση της μεταβολής του πληθυσμού του βακτηρίου (Ν) σε σχέση με το χρόνο (t) έδωσε το παρακάτω διάγραμμα:

2019-02-19, 22.37.53

1.Με βάση το διάγραμμα αυτό, να χαρακτηρίσετε τον τύπο της καλλιέργειας και να περιγράψετε τις φάσεις της.

Μονάδες 10

2.Σε ποια συνήθως χρονικά διαστήματα της καλλιέργειας των βακτηρίων αναμένεται να παραχθεί η προϊνσουλίνη; Αφού παραλάβουμε την προϊνσουλίνη από τον βιοαντιδραστήρα, πώς θα την μετατρέψουμε σε ινσουλίνη;

Μονάδες 10

3.Ποιος είναι ο βιολογικός ρόλος της ινσουλίνης και ποια ασθένεια προκαλεί η μείωση ή η έλλειψή της;

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

Για πρώτη φορά η γονιδιακή θεραπεία εφαρμόστηκε σε ένα κορίτσι που είχε έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA).

1.Ποιος είναι ο ρόλος του ενζύμου αυτού (μονάδες 3) και ποια τα συμπτώματα που εμφανίζουν τα άτομα με έλλειψη του συγκεκριμένου ενζύμου (μονάδες 6).

Μονάδες 9

2.Πώς ονομάζεται ο τύπος της γονιδιακής θεραπείας που εφαρμόστηκε (μονάδες 2) και γιατί (μονάδες 4).

Μονάδες 6

3.Ποια είναι η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας.

Μονάδες 10 

2010 ΗΜΕΡΗΣΙΟ

Γ1. Να περιγράψετε τις διαδικασίες με τις οποίες μπορούν να παραχθούν μονοκλωνικά αντισώματα, τα οποία συνεισφέρουν στον προσδιορισμό των ομάδων αίματος του ανθρώπου.

Μονάδες 7

2017 ΗΜΕΡΗΣΙΟ

Γ1. Στο μαστικό αδένα ενός προβάτου υπάρχει συγκεκριμένος κυτταρικός τύπος στον οποίο εκφράζεται το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος. Θέλουμε να πάρουμε την πρωτεΐνη α1-αντιθρυψίνη από το γάλα ενός διαγονιδιακού προβάτου. Για το λόγο αυτό εισάγουμε μέσα στο γονίδιο της καζεΐνης με κατάλληλο προσανατολισμό το γονίδιο της α1-αντιθρυψίνης. Να εξηγήσετε γιατί θα εκφραστεί το γονίδιο της α1-αντιθρυψίνης στα κύτταρα του μαστικού αδένα.

Μονάδες 6

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ2. Μετά την κλωνοποίηση ορισμένων γονιδίων ιντερφερονών είναι σήμερα δυνατή η παραγωγή τους σε μεγάλες ποσότητες από γενετικά τροποποιημένα βακτήρια. Να εξηγήσετε πώς θα παραλάβουμε ιντερφερόνη από καλλιέργεια γενετικά τροποποιημένων βακτηρίων σε βιοαντιδραστήρα.

Μονάδες 8

ΘΕΜΑ Δ

2006 ΗΜΕΡΗΣΙΟ

Μια φυσιολογική γυναίκα παντρεύεται έναν άνδρα και αποκτούν δύο παιδιά, το Γιάννη και την Ελένη. Ο Γιάννης παρουσιάζει οικογενή υπερχοληστερολαιμία και β-θαλασσαιμία, ενώ η Ελένη δεν παρουσιάζει καμιά από τις δύο ασθένειες. Να γράψετε τους πιθανούς γονότυπους των γονέων και των παιδιών (Μονάδες 6) και να δικαιολογήσετε την απάντησή σας (Μονάδες 6). Εάν οι συγκεκριμένοι γονείς αποκτήσουν και τρίτο παιδί, να προσδιορίσετε την πιθανότητα να πάσχει μόνο από υπερχοληστερολαιμία, χωρίς να ληφθεί υπόψη η β-θαλασσαιμία (Μονάδες 6).

Πρόσφατα ανακοινώθηκε μελέτη για την εφαρμογή της γονιδιακής θεραπείας σε ασθενείς που πάσχουν από β-θαλασσαιμία. Λαμβάνοντας υπόψη ότι τα γονίδια των αιμοσφαιρινών εκφράζονται στα πρόδρομα ερυθροκύτταρα, ποιος τύπος γονιδιακής θεραπείας θα μπορούσε να εφαρμοστεί για την αντιμετώπιση της β-θαλασσαιμίας και γιατί (Μονάδες 7);

Μονάδες 25

 

Advertisements

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ

ΣΤΟ 1ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ)

ΘΕΜΑ Α

2000 ΗΜΕΡΗΣΙΟ

  1. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

α.γραμμικό δίκλωνο DNA

β.γραμμικό μονόκλωνο DNA

γ.κυκλικό δίκλωνο DNA

δ.κυκλικό μονόκλωνο DNA

Μονάδες 5

2000 ΕΣΠΕΡΙΝΟ

  1. Μέσα σ’ ένα φυτικό ευκαρυωτικό κύτταρο, DNAυπάρχει μόνο:

α) στον πυρήνα

β) στον πυρήνα και στα μιτοχόνδρια

γ) στα μιτοχόνδρια και στους χλωροπλάστες

δ) στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες

Μονάδες 3

  1. Στη φύση τα πλασμίδια βρίσκονται:

α) στα φυτικά κύτταρα

β) στους ιούς

γ) στα βακτήρια

δ) στα ζωικά κύτταρα

Μονάδες 3 

2001 ΗΜΕΡΗΣΙΟ

1.Το DNAαποτελεί το γενετικό υλικό όλων των κυττάρων και των περισσότερων ιών. Να περιγράψετε συνοπτικά τις λειτουργίες του γενετικού υλικού.

Μονάδες 5

2001 ΕΣΠΕΡΙΝΟ

3.Οι ιοί περιέχουν γενετικό υλικό; Τι είδους μπορεί να είναι αυτό;

Μονάδες 15

2001 ΟΜΟΓΕΝΕΙΣ

Β. 1. Πότε ένα κύτταρο χαρακτηρίζεται απλοειδές και πότε διπλοειδές;

Μονάδες 5

  1. Τι ονομάζεται καρυότυπος;

Μονάδες 5 

2002 ΗΜΕΡΗΣΙΟ

1.Δίκλωνο κυκλικό μόριο DNAπεριέχεται σε:

α.γαμέτη

β.ευκαρυωτικό πυρήνα

γ.βακτήριο

δ.νουκλεόσωμα.

Μονάδες 5

2002 ΕΣΠΕΡΙΝΟ

2.Οι δύο αδερφές χρωματίδες συγκροτούν ένα

α.μεταφασικό χρωμόσωμα.

β.υβρίδωμα.

γ.νουκλεόσωμα.

δ.κύτταρο.

Μονάδες 5

3.Το πλασμίδιο είναι

α.δίκλωνο RNA.

β.κυκλικό δίκλωνο DNA.

γ.μονόκλωνο DNA.

δ.μονόκλωνο RNA.

Μονάδες 5

2003 ΗΜΕΡΗΣΙΟ

2.Τα φυλετικά χρωμοσώματα του ανθρώπου βρίσκονται:

α.μόνο στα μυϊκά κύτταρα

β.μόνο στα γεννητικά κύτταρα

γ.σε όλα τα κύτταρα

δ.μόνο στα ηπατικά κύτταρα.

Μονάδες 5

2003 ΕΣΠΕΡΙΝΟ

2.Τα φυλετικά χρωμοσώματα του ανθρώπου

α.δεν περιέχουν γονίδια.

β.είναι όμοια μορφολογικά στους άνδρες και στις γυναίκες.

γ.καθορίζουν το φύλο.

δ.δεν μεταβιβάζονται στους απογόνους.

Μονάδες 5

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Πολλά νουκλεοτίδια ενώνονται μεταξύ τους με ετεροπολικούς δεσμούς και δημιουργούν μία πολυνουκλεοτιδική αλυσίδα.

Μονάδες 2

2003 ΟΜΟΓΕΝΕΙΣ 

3.Το υλικό των προκαρυωτικών κυττάρων είναι

α.γραμμικό μονόκλωνο DNA.

β.δίκλωνο RNA.

γ.κυκλικό δίκλωνο DNA.

δ.γραμμικό δίκλωνο DNA.

Μονάδες 5

2004 ΕΣΠΕΡΙΝΟ

  1. Στα ευκαρυωτικά κύτταρα, το γενετικό υλικό κατανέμεται

α.στον πυρήνα.

β.στα μιτοχόνδρια και στο πλασμίδιο.

γ.στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες.

δ.στον πυρήνα και στα ριβοσώματα.

Μονάδες 5

  1. Η ποσότητα του DNAείναι

α.ίδια σε όλα τα είδη των σωματικών κυττάρων ενός οργανισμού.

β.διπλάσια στα ηπατικά κύτταρα των οργανισμών.

γ.μικρότερη στους περισσότερο εξελιγμένους οργανισμούς.

δ.η μισή στα διπλοειδή κύτταρα σε σχέση με τα απλοειδή.

Μονάδες 5

  1. Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση των νουκλεοτιδίων με

α.δεσμούς υδρογόνου.

β.φωσφοδιεστερικούς δεσμούς.

γ.πεπτιδικούς δεσμούς.

δ.ετεροπολικούς δεσμούς.

Μονάδες 5

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα …

α.δίκλωνο γραμμικό μόριο DNA.

β.δίκλωνο κυκλικό μόριο DNA.

γ.δίκλωνο κυκλικό μόριο RNA.

δ.μονόκλωνο κυκλικό μόριο RNA.

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

1.Τα φυλετικά χρωμοσώματα …

α.υπάρχουν μόνο στα γεννητικά κύτταρα.

β.εντοπίζονται μόνο στα σωματικά κύτταρα.

γ.υπάρχουν στα σωματικά και στα γεννητικά κύτταρα.

δ.εντοπίζονται στα φυτικά και στα βακτηριακά κύτταρα.

Μονάδες 5

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Στα πειράματά τους οι Avery, Mac-Leodκαι McCartyδιαπίστωσαν ότι ο μετασχηματισμός των αδρών βακτηρίων σε λεία οφείλεται …

α.στο DNA.

β.στο RNA.

γ.στους υδατάνθρακες.

δ.στις πρωτεΐνες.

Μονάδες 5

2005 ΕΣΠΕΡΙΝΟ

  1. Τα πλασμίδια

α.είναι δίκλωνα, κυκλικά μόρια DNAμε διάφορα μεγέθη.

β.απαντούν σε όλους τους ευκαρυωτικούς οργανισμούς.

γ.φέρουν πληροφορίες για πρωτεΐνες με αντιγονική δράση.

δ.αποτελούν βασικό συστατικό του νουκλεοσώματος.

Μονάδες 3

  1. Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται

α.τα μιτοχόνδρια και τα ριβοσώματα.

β.οι χλωροπλάστες και ο πυρήνας.

γ.οι χλωροπλάστες και τα μιτοχόνδρια.

δ.τα ζεύγη των φυλετικών χρωμοσωμάτων.

Μονάδες 3

Β. Ποιες είναι, συνοπτικά, οι λειτουργίες του γενετικού υλικού;

Μονάδες 10 

2006 ΗΜΕΡΗΣΙΟ

  1. Ο καρυότυπος

α.απεικονίζει την ταξινόμηση των χρωμοσωμάτων κατά ελαττούμενο μέγεθος.

β.χρησιμοποιείται για τον εντοπισμό γονιδιακών μεταλλάξεων.

γ.απεικονίζει το γενετικό υλικό κατά το στάδιο της μετάφασης.

δ.χρησιμοποιείται μόνο για τη μελέτη φυλετικών χρωμοσωμάτων.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

  1. Ένα νουκλεοτίδιο DNAμπορεί να αποτελείται από

α.δεοξυριβόζη, φωσφορική ομάδα, ουρακίλη.

β.ριβόζη, φωσφορική ομάδα, θυμίνη.

γ.DNAδεσμάση, φωσφορική ομάδα, αδενίνη.

δ.δεοξυριβόζη, φωσφορική ομάδα, αδενίνη.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ

4.Το πλασμίδιο είναι

α.δίκλωνο γραμμικό μόριο DNA.

β.δίκλωνο κυκλικό μόριο DNA.

γ.δίκλωνο κυκλικό μόριο RNA.

δ.δίκλωνο γραμμικό μόριο RNA.

Μονάδες 5 

2008 ΗΜΕΡΗΣΙΟ

1.Ο πνευμονιόκοκκος, τα δύο στελέχη του οποίου χρησιμοποίησε ο Griffithστο γνωστό πείραμα, είναι:

α.μύκητας.

β.βακτήριο.

γ.ιός.

δ.πρωτόζωο.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

2.Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται

α.τα ριβοσώματα και οι χλωροπλάστες.

β.οι χλωροπλάστες και τα μιτοχόνδρια.

γ.τα χρωμοσώματα και τα ριβοσώματα.

δ.ο πυρήνας και οι χλωροπλάστες.

Μονάδες 5

2008 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Στους περισσότερους οργανισμούς ένα μιτοχόνδριο περιέχει

α.ένα μόριο κυκλικού DNA.

β.δύο έως δέκα μόρια κυκλικού DNA.

γ.ένα μόριο γραμμικού RNA.

δ.πολλά μόρια γραμμικού RNA.

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

1.Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι

α.κυκλικό μονόκλωνο DNA.

β.κυκλικό δίκλωνο DNA.

γ.γραμμικό δίκλωνο DNA.

δ.γραμμικό μονόκλωνο DNA.

Μονάδες 5 

2009 ΗΜΕΡΗΣΙΟ

  1. Τα νουκλεοσώματα

α.αποτελούνται αποκλειστικά από DNA.

β.δεν σχηματίζονται κατά τη μεσόφαση.

γ.αποτελούνται από DNAπου τυλίγεται γύρω από πρωτεΐνες.

δ.είναι ορατά μόνο με το οπτικό μικροσκόπιο.

Μονάδες 5

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

  1. Δύο αδελφές χρωματίδες συγκροτούν

α.τον καρυότυπο.

β.το νουκλεόσωμα.

γ.κάθε μεταφασικό χρωμόσωμα.

δ.το μόριο DNA.

Μονάδες 5

2009 ΕΣΠΕΡΙΝΟ

  1. Στον ανθρώπινο φυσιολογικό καρυότυπο απεικονίζονται

α.23 χρωμοσώματα.

β.22 ζεύγη χρωμοσωμάτων.

γ.23 ζεύγη χρωμοσωμάτων.

δ.46 ζεύγη χρωμοσωμάτων.

Μονάδες 5

2009 ΟΜΟΓΕΝΕΙΣ

  1. Τα πλασμίδια είναι

α.δίκλωνα κυκλικά μόρια RNA.

β.δίκλωνα γραμμικά μόρια RNA.

γ.δίκλωνα κυκλικά μόρια DNA.

δ.μονόκλωνα κυκλικά μόρια DNA.

Μονάδες 5

2010 ΗΜΕΡΗΣΙΟ

Α2. Η διπλή έλικα του DNA

α.έχει μεταβαλλόμενο σκελετό

β.έχει υδρόφιλο σκελετό

γ.έχει πεπτιδικούς δεσμούς

δ.είναι αριστερόστροφη

Μονάδες 5

2010 ΕΣΠΕΡΙΝΟ

Α1. Η ποσότητα του DNAείναι

α.διπλάσια στα νευρικά κύτταρα σε σχέση με τα ηπατικά του ίδιου οργανισμού.

β.η μισή στα διπλοειδή κύτταρα σε σχέση με τα απλοειδή.

γ.ίδια σε όλα τα είδη των σωματικών κυττάρων ενός οργανισμού.

δ.συνήθως μικρότερη στους περισσότερο εξελιγμένους οργανισμούς.

Μονάδες 5

2010 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α3. Η έκφραση invitroχρησιμοποιείται για την περιγραφή μιας βιολογικής διαδικασίας που πραγματοποιείται

α.στο ύπαιθρο

β.σε έναν οργανισμό

γ.στον πυθμένα μιας λίμνης

δ.σε δοκιμαστικό σωλήνα

Μονάδες 5

2011 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ – ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

Α4. Η ποσότητα του DNA

α.είναι ίδια σε όλους τους απλοειδείς οργανισμούς.

β.είναι σταθερή σε όλους τους διπλοειδείς οργανισμούς.

γ.μεταβάλλεται στα κύτταρα των διαφόρων ιστών ενός οργανισμού.

δ.διαφέρει στα κύτταρα των οργανισμών που ανήκουν σε διαφορετικά είδη.

Μονάδες 5

2011 ΟΜΟΓΕΝΕΙΣ 

Α1. Μέσα σ’ ένα φυτικό ευκαρυωτικό κύτταρο, DNAυπάρχει μόνο

α.στα ριβοσώματα και στους χλωροπλάστες.

β.στον πυρήνα και στα μιτοχόνδρια.

γ.στον πυρήνα.

δ.στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες.

Μονάδες 5

2012 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α2. Οι ιστόνες είναι

α.DNA

β.RNA

γ.πρωτεΐνες

δ.υδατάνθρακες.

Μονάδες 5

2012 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α1. Τα φυλετικά χρωμοσώματα υπάρχουν

α.μόνο στα ωάρια

β.μόνο στα σπερματοζωάρια

γ.μόνο στα σωματικά κύτταρα

δ.στα σωματικά κύτταρα και στους γαμέτες.

Μονάδες 5 

2012 ΟΜΟΓΕΝΕΙΣ

Α3. Τα πλασμίδια είναι μόρια DNAπου φυσιολογικά βρίσκονται σε

α.φυτά.

β.ζώα.

γ.ιούς.

δ.βακτήρια.

Μονάδες 5

2013 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Βασική μονάδα οργάνωσης της χρωματίνης αποτελεί το

α.νουκλεοτίδιο

β.πολύσωμα

γ.νουκλεόσωμα

δ.κεντρομερίδιο

Μονάδες 5

2013 ΟΜΟΓΕΝΕΙΣ

Α1. Στον άνθρωπο το αρσενικό άτομο καθορίζεται από την

α.παρουσία του Χ χρωμοσώματος.

β.απουσία του Χ χρωμοσώματος.

γ.παρουσία του Υ χρωμοσώματος.

δ.απουσία του Υ χρωμοσώματος.

Μονάδες 5 

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Τα πλασμίδια είναι

α.κυκλικά δίκλωνα μόρια RNA

β.γραμμικά μόρια DNA

γ.μονόκλωνα μόρια DNA

δ.κυκλικά δίκλωνα μόρια DNA.

Μονάδες 5 

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

 Α1. Τα κύτταρα στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο ονομάζονται

α.διπλοειδή

β.διαφοροποιημένα

γ.απλοειδή

δ.μετασχηματισμένα.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ 

Α2. Το νουκλεόσωμα αποτελείται

α.από RNAκαι ιστόνες

β.μόνο από RNA

γ.από DNAκαι ιστόνες

δ.μόνο από DNA.

Μονάδες 5 

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Α1. Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι

α.γραμμικό δίκλωνο μόριο DNA

β.κυκλικό δίκλωνο μόριο DNA

γ.γραμμικό μονόκλωνο μόριο DNA

δ.κυκλικό μονόκλωνο μόριο DNA.

Μονάδες 5 

2015 ΟΜΟΓΕΝΕΙΣ 

Α1. Δύο διαδοχικά νουκλεοτίδια μιας πολυνουκλεοτιδικής αλυσίδας συνδέονται μεταξύ τους με δεσμό που ονομάζεται

α.5΄- 3΄ φωσφοδιεστερικός δεσμός

β.δεσμός υδρογόνου

γ.πεπτιδικός δεσμός

δ.3΄- 5΄ φωσφοδιεστερικός δεσμός.

Μονάδες 5 

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α1. Το γενετικό υλικό των χλωροπλαστών

α.είναι γραμμικό δίκλωνο DNA

β.είναι κυκλικό μόριο DNA

γ.έχει μικρότερο μήκος από το μιτοχονδριακό DNA

δ.είναι γραμμικό RNA.

Μονάδες 5

Α2. Ένας φυσιολογικός γαμέτης ανθρώπου μπορεί να περιέχει

α.46 χρωμοσώματα

β.ένα Χ χρωμόσωμα

γ.πλασμίδια

δ.DNAμήκους 1,5 x109ζεύγη βάσεων.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

Α3. Το μιτοχονδριακό DNA

α.στα ανθρώπινα κύτταρα είναι δίκλωνο και γραμμικό

β.έχει πληροφορίες για όλες τις λειτουργίες των μιτοχονδρίων

γ.είναι γραμμικό σε ορισμένα κατώτερα πρωτόζωα

δ.υπάρχει πάντα σε ένα μόνο αντίγραφο σε κάθε μιτοχόνδριο.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ 

Α3. Νουκλεοσώματα εντοπίζονται

α.σε μιτοχόνδρια ανθρώπινου μυϊκού κυττάρου

β.σε πυρήνα φυτικού κυττάρου

γ.στο κυτταρόπλασμα του βακτηρίου Escherichiacoli(E. coli)

δ.σε πυρήνα, μιτοχόνδριο και χλωροπλάστη φυτικού κυττάρου.

Μονάδες 5

Α4. Σταθερότερη δευτερογενή δομή μεταξύ μορίων DNAίσου μήκους έχει το μόριο με

α.30% Α

β.20% Α

γ.10% Α

δ.40% Α.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Α1. Το μιτοχονδριακό DNAείναι γραμμικό

α.σε ορισμένα κατώτερα πρωτόζωα

β.στα περισσότερα κύτταρα των ευκαρυωτικών οργανισμών

γ.στα βακτήρια

δ.στα φυτικά κύτταρα.

Μονάδες 5

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ 

Α4. Ερευνητές μελετούν τη δομή του DNA σε ηπατικά, γαμετικά και βακτηριακά κύτταρα και παρατηρούν ότι δίκλωνα κυκλικά μόρια DNA

α.εντοπίζονται μόνο στα βακτηριακά κύτταρα.

β.εντοπίζονται μόνο στα ηπατικά και γαμετικά κύτταρα.

γ.δεν εντοπίζονται σε κανένα από τα τρία είδη κυττάρων.

δ.εντοπίζονται και στα τρία είδη κυττάρων.

Μονάδες 5

Α5. Στις δύο παρακάτω υποθετικές διατάξεις, που αναφέρονται σε μερικώς αναδιπλούμενα μονόκλωνα μόρια DNA,

2019-02-19, 23.01.56

ο κανόνας της συμπληρωματικότητας και αντιπαραλληλότητας

α.ικανοποιείται μόνο στηνΙ.

β.ικανοποιείται μόνο στη ΙΙ.

γ.ικανοποιείται τόσο στηνΙ όσο και στη ΙΙ.

δ.δεν ικανοποιείται σε καμία από τις δύο διατάξεις.

Μονάδες 5

ΘΕΜΑ Β

2000 ΕΣΠΕΡΙΝΟ 

  1. Η σύνδεση με δεσμούς υδρογόνου της Α (αδενίνης) με τη Τ (θυμίνη) είναι τόσο ισχυρή όσο και η σύνδεση της C(κυτοσίνης) με τη G(γουανίνη). (Σ-Λ)

2.Το DNA, όπως και το RNA, είναι ένα μακρομόριο που αποτελείται από …………

2001 ΗΜΕΡΗΣΙΟ

3.Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα και γιατί;

Μονάδες 5

2001 ΕΣΠΕΡΙΝΟ 

  1. Η σύνδεση με δεσμούς υδρογόνου της Α (αδενίνης) με την C(κυτοσίνη) είναι τόσο ισχυρή όσο και η σύνδεση της Τ (θυμίνης) με τη G(γουανίνη). (Σ-Λ)

4.Τα χρωμοσώματα του ανθρώπου που καθορίζουν αν ένα άτομο θα είναι αρσενικό ή θηλυκό λέγονται _______________ .

2002 ΕΣΠΕΡΙΝΟ

1.Ποια οργανίδια του ευκαρυωτικού κυττάρου χαρακτηρίζονται ως ημιαυτόνομα και γιατί;

Μονάδες 8

2.Τι είναι το νουκλεόσωμα;

Μονάδες 4

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ 

2.Από τι αποτελείται το νουκλεόσωμα και ποιος είναι ο ρόλος του;

Μονάδες 10

2004 ΕΣΠΕΡΙΝΟ

Α. Ποιες είναι συνοπτικά οι λειτουργίες του γενετικού υλικού;

Μονάδες 15

Β. Να μεταφέρετε στο τετράδιό σας τις παρακάτω προτάσεις, συμπληρώνοντας τα κενά με τις σωστές λέξεις.

1.Οι αδελφές χρωματίδες είναι συνδεδεμένες στο _______________ .

Μονάδες 2

  1. Κάθε νουκλεοτίδιο του DNAαποτελείται από μια πεντόζη, τη _____________, ενωμένη με μία φωσφορική ομάδα και μια ________________________ .

Μονάδες 4

  1. Τα κύτταρα, στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο, ονομάζονται ______________ .

Μονάδες 2

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

  1. Γιατί τα μιτοχόνδρια χαρακτηρίζονται ως ημιαυτόνομα οργανίδια;

Μονάδες 4

2005 ΗΜΕΡΗΣΙΟ

  1. Ποια είναι η δομή του DNAστο χώρο σύμφωνα με το μοντέλο της διπλής έλικας των Watsonκαι Crick;

Μονάδες 9

2005 ΕΣΠΕΡΙΝΟ

  1. Η ποσότητα του DNAσε κάθε οργανισμό είναι σταθερή και δεν μεταβάλλεται από τις αλλαγές στο περιβάλλον. (Σ-Λ) 

2006 ΗΜΕΡΗΣΙΟ

  1. Πώς επιβεβαιώθηκε οριστικά από τους Hersheyκαι Chaseότι το DNAείναι το γενετικό υλικό των κυττάρων;

Μονάδες 6 

2006 ΕΣΠΕΡΙΝΟ

  1. 1. Τα μιτοχόνδρια περιέχουν ως γενετικό υλικό (DNA-RNA), το οποίο κωδικοποιεί μικρό αριθμό πρωτεϊνών που ελέγχουν τη λειτουργία της (φωτοσύνθεσης-οξειδωτικής φωσφορυλίωσης). Τα μιτοχόνδρια χαρακτηρίζονται ως (αυτόνομα-ημιαυτόνομα) οργανίδια και στους ανώτερους οργανισμούς έχουν (μητρική-πατρική) προέλευση.

Μονάδες 4

5.Σε πολλά βακτήρια, εκτός από το κύριο κυκλικό DNA, υπάρχουν και τα πλασμίδια. (Σ-Λ)

2006 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

 1.Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα;

Μονάδες 4

2006 ΟΜΟΓΕΝΕΙΣ

1.Τι εννοούμε με τον όρο γονιδίωμα; Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή;

Μονάδες 8

2007 ΗΜΕΡΗΣΙΟ

1.Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα (μονάδες 2)και για ποιο λόγο; (μονάδες 5)

Μονάδες 7

2007 ΕΣΠΕΡΙΝΟ

Γ.Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή;

Μονάδες 5

2007 ΟΜΟΓΕΝΕΙΣ

1.Ποιες είναι, συνοπτικά, οι λειτουργίες του γενετικού υλικού;

Μονάδες 6

2008 ΗΜΕΡΗΣΙΟ

4.Πώς χρησιμοποιείται ο όρος αδελφές χρωματίδες, σε ποιο στάδιο της κυτταρικής διαίρεσης εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και πώς μοιράζονται στα δύο νέα κύτταρα;

Μονάδες 5 

2008 ΕΣΠΕΡΙΝΟ

1.Ποια χρωμοσώματα χαρακτηρίζονται ως αυτοσωμικά, ποια ως φυλετικά και πώς καθορίζεται το φύλο στον άνθρωπο;

Μονάδες 9

2008 ΟΜΟΓΕΝΕΙΣ

1.Ποια χρωμοσώματα στον άνθρωπο ονομάζονται αυτοσωμικά και ποια φυλετικά; (μονάδες 4). Πώς καθορίζεται το φύλο στον άνθρωπο; (μονάδες 4).

Μονάδες 8

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

1.Να περιγράψετε το πείραμα με το οποίο επιβεβαιώθηκε οριστικά ότι το DNAείναι το γενετικό υλικό.

Μονάδες 5 

2009 ΟΜΟΓΕΝΕΙΣ

  1. Γιατί τα μιτοχόνδρια και οι χλωροπλάστες χαρακτηρίζονται ημιαυτόνομα οργανίδια;

Μονάδες 4 

2010 ΗΜΕΡΗΣΙΟ

Β1. Ποια κύτταρα ονομάζονται απλοειδή και ποια κύτταρα ονομάζονται διπλοειδή;

Μονάδες 6

Β2. Να περιγράψετε τον σχηματισμό του 3΄-5΄ φωσφοδιεστερικού δεσμού.

Μονάδες 8

2010 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε τη διαδικασία με την οποία μπορεί να κατασκευαστεί ο καρυότυπος ενός ανθρώπου.

Μονάδες 7

2011 ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε το πείραμα του Griffithκαι να αναφέρετε το συμπέρασμα στο οποίο κατέληξε.

Μονάδες 8

Β4. Η ανάλυση δειγμάτων DNAαπό δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη βρέθηκε ποσοστό γουανίνης (G) 28%. Να εξηγήσετε αν τα βακτήρια των δύο καλλιεργειών ανήκουν στο ίδιο ή σε διαφορετικό είδος.

Μονάδες 4

2011 ΕΣΠΕΡΙΝΟ

Β2. Να ταξινομήσετε τις παρακάτω μορφολογικές δομές του γενετικού υλικού ενός ευκαρυωτικού κυττάρου αρχίζοντας από το μικρότερο προς το μεγαλύτερο βαθμό συσπείρωσης:

1.ινίδια χρωματίνης

2.μεταφασικά χρωμοσώματα

3.«χάντρες» νουκλεοσωμάτων

4.διπλή έλικα DNA

5.αδελφές χρωματίδες

Μονάδες 5 

2011 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β2. Ποια είναι η μορφή των μεταφασικών χρωμοσωμάτων ενός κυττάρου (μονάδες 3), σε τι διαφέρουν μεταξύ τους (μονάδες 3) και με ποια κριτήρια ταξινομούνται κατά τη δημιουργία καρυοτύπου; (μονάδες 3)

Μονάδες 9

2011 ΟΜΟΓΕΝΕΙΣ

Β2. Να εξηγήσετε πώς συνδέονται μεταξύ τους οι δύο αλυσίδες ενός δίκλωνου μορίου DNA.

Μονάδες 6 

2012 ΟΜΟΓΕΝΕΙΣ

Β3. Τι ονομάζεται καρυότυπος;

Μονάδες 6 

2013 ΕΣΠΕΡΙΝΟ

Β3. Ποιες πληροφορίες περιέχει το μιτοχονδριακό DNAκαι γιατί τα μιτοχόνδρια χαρακτηρίζονται ως ημιαυτόνομα οργανίδια;

Μονάδες 6

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Β3. Ποια βιοχημικά δεδομένα υποστήριζαν ότι το DNAείναι το γενετικό υλικό, την εποχή που οι Avery, Mac-Leodκαι McCartyεπανέλαβαν invitroτα πειράματα του Griffith;

Μονάδες 9 

2013 ΟΜΟΓΕΝΕΙΣ

Β2. Να ορίσετε τις εκφράσεις: invivo, invitro, ιχνηθέτηση. (μονάδες 6) Να αναφέρετε από ένα παράδειγμα. (μονάδες 3)

Μονάδες 9

2014 ΕΣΠΕΡΙΝΟ

Β1. Να τοποθετήσετε στη σωστή σειρά τα παρακάτω βήματα τα οποία οδηγούν στην κατασκευή καρυότυπου, γράφοντας μόνο τους αριθμούς

1.Τα κύτταρα επωάζονται σε υποτονικό διάλυμα.

2.Αναστέλλεται ο κυτταρικός κύκλος στο στάδιο της μετάφασης.

3.Τα χρωμοσώματα παρατηρούνται στο μικροσκόπιο.

4.Γίνεται επαγωγή κυτταρικών διαιρέσεων με ουσίες που έχουν μιτογόνο δράση.

5.Τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος.

6.Τα χρωμοσώματα απλώνονται σε αντικειμενοφόρο πλάκα και χρωματίζονται με ειδικές χρωστικές ουσίες.

Μονάδες 6

2014 ΟΜΟΓΕΝΕΙΣ

Β4. Η βασική μονάδα οργάνωσης της χρωματίνης είναι το νουκλεόσωμα. Να περιγράψετε τη δομή του.

Μονάδες 6

2015 ΗΜΕΡΗΣΙΟ

Β1. Να αντιστοιχίσετε τον αριθμό της στήλης Ι με ένα μόνο γράμμα, Α ή Β, της στήληςΙΙ.

Στήλη Ι Στήλη ΙΙ
1. Στην πλειονότητά τους έχουν την ικανότητα κυτταρικής διαίρεσης Α: Σωματικά κύτταρα στην αρχή της μεσόφασης
2. Παράγονται με μείωση
3. Δεν έχουν την ικανότητα κυτταρικής διαίρεσης
4. Στον άνθρωπο έχουν DNA συνολικού μήκους δύο μέτρων
5. Παράγονται με μίτωση Β: Γαμέτες
6. Οι μεταλλάξεις στο DNA τους δεν κληρονομούνται στην επόμενη γενιά
7. Στον άνθρωπο έχουν DNA συνολικού μήκους 3Χ109ζεύγη βάσεων
8. Οι μεταλλάξεις στο DNA τους κληρονομούνται στην επόμενη γενιά

Μονάδες 8

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ

Σωστό ή Λάθος

ε. Η μελέτη των χρωμοσωμάτων με καρυότυπο είναι δυνατή μόνο σε κύτταρα που διαιρούνται. 

2015 ΟΜΟΓΕΝΕΙΣ

Β2. Πώς καθορίζεται το φύλο στον άνθρωπο;

Μονάδες 4 

2016 ΗΜΕΡΗΣΙΟ

Β2. Τι είναι ο καρυότυπος; (μονάδες 4). Να αναφέρετε δύο (2) συμπεράσματα που μπορούν να εξαχθούν από τη μελέτη του καρυότυπου ενός ανθρώπου (μονάδες 4).

Μονάδες 8

2016 ΕΣΠΕΡΙΝΟ

Β3. Η ανάλυση της αλληλουχίας των βάσεων ενός μορίου DNAέδειξε ότι αυτό αποτελείται από 4800 νουκλεοτίδια με Αδενίνη, 4280 με Κυτοσίνη, 4530 με Θυμίνη και 4610 με Γουανίνη. Να εξηγήσετε αν αυτό το μόριο DNAμπορεί να αποτελεί γενετικό υλικό.

Μονάδες 3

2016 ΟΜΟΓΕΝΕΙΣ

Β2. Σε τι αναφέρεται ο όρος γονιδίωμα (μονάδες 2); Σε σχέση με το γονιδίωμα, ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή (μονάδες 4);

Μονάδες 6 

2017 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ-ΟΜΟΓΕΝΕΙΣ

Β2. Ποια από τα παρακάτω είναι δυνατόν να παρατηρηθούν με οπτικό μικροσκόπιο και ποια μόνο με ηλεκτρονικό;

α.νουκλεοσώματα

β.μεταφασικό χρωμόσωμα

γ.πολύσωμα

δ.θηλιά έναρξης αντιγραφής

ε.δρεπανοκύτταρα.

Μονάδες 5

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ 

Β4.Να αντιστοιχίσετε σωστά τον κάθε αριθμό της στήλης Ιμε ένα μόνο γράμμα Α ή Β της στήλης ΙΙ, με βάση την ομοιότητα του μιτοχονδριακού DNAτων ατόμων της στήλης Ι.

Στήλη Ι Στήλη ΙΙ
1. Πατέρας και κόρη του Α. Ίδιο μιτοχονδριακό DNA
2. Παππούς και εγγονή του
3. Μητέρα και κόρη της
4. Αδελφός και αδελφή του Β. Διαφορετικό μιτοχονδριακό DNA
5. Πατέρας και γιος του
6. Μητέρα και γιος της
7. Αγόρι και αδελφός της μητέρας του

 

Μονάδες 7

ΘΕΜΑ Γ

2000 ΕΣΠΕΡΙΝΟ

Α.Ο αριθμός και η μορφολογία των χρωμοσωμάτων είναι ιδιαίτερο χαρακτηριστικό των κυττάρων κάθε ζωντανού οργανισμού.

α) Ποια είναι τα μορφολογικά χαρακτηριστικά των χρωμοσωμάτων που παρατηρούνται σ’ ένα καρυότυπο;

Μονάδες 7

β) Πώς μπορεί να διαπιστωθεί το φύλο ενός ανθρώπου από τον καρυότυπο των σωματικών κυττάρων του;

Μονάδες 8

Β. Σ’ ένα ανθρώπινο σωματικό κύτταρο και σ’ ένα ανθρώπινο γαμέτη, ποια διαφορά υπάρχει στο γονιδίωμά τους και πώς ονομάζονται τα κύτταρα αυτά λόγω της συγκεκριμένης διαφοράς;

Μονάδες 10

2001 ΗΜΕΡΗΣΙΟ

1.Σε δύο κύτταρα έγινε ανάλυση του γενετικού τους υλικού και βρέθηκε η παρακάτω επί τοις % σύσταση σε αζωτούχες βάσεις.

Α Τ C G
Κύτταρο 1: 28 28 22 22
Κύτταρο 2: 31 31 19 19

Τα κύτταρα 1, 2 ανήκουν στο ίδιο ή σε διαφορετικά είδη οργανισμών

Μονάδες 2

Να αιτιολογήσετε την απάντησή σας.

Μονάδες 3

2002 ΟΜΟΓΕΝΕΙΣ

1.Ποια είναι η δομή του DNAστο χώρο, σύμφωνα με το μοντέλο της διπλής έλικας;

Μονάδες 12

2005 ΟΜΟΓΕΝΕΙΣ

Α. Στα σωματικά κύτταρα του ανθρώπου υπάρχουν σαράντα έξι (46) χρωμοσώματα.

1.Πόσα χρωμοσώματα κληρονομεί ένα παιδί από τον πατέρα του;

Μονάδες 2

Να δικαιολογήσετε την απάντησή σας.

Μονάδες 3

2.Πόσα αυτοσωμικά χρωμοσώματα υπάρχουν στα σωματικά κύτταρα μιας γυναίκας;

Μονάδες 2

Να δικαιολογήσετε την απάντησή σας.

Μονάδες 3

2010 ΟΜΟΓΕΝΕΙΣ 

Γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που έγινε σε κύτταρα του εμβρύου διαπιστώθηκε τρισωμία 18 και σύνδρομο Turner.

Γ1.Να περιγράψετε τη διαδικασία κατασκευής του καρυότυπου.

Μονάδες 10

2014 ΕΣΠΕΡΙΝΟ

Γ1. Να τοποθετήσετε κατά μέγεθος από το μικρότερο στο μεγαλύτερο, ανάλογα με την ποσότητα του γενετικού υλικού, τα παρακάτω: νουκλεόσωμα, μεταφασικό χρωμόσωμα, γονίδιο, αδελφή χρωματίδα (Το μέσο γονίδιο αποτελείται περίπου από 1000 ζεύγη βάσεων.)

Μονάδες 4

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ – ΕΠΑΝΑΛΗΠΤΙΚΑ ΕΣΠΕΡΙΝΟ

 Γ1. Το φύλο στα κουνέλια καθορίζεται όπως και στον άνθρωπο. Όταν ένα φυσιολογικό σωματικό κύτταρο θηλυκού κουνελιού βρίσκεται στη μετάφαση, το μήκος του DNAτου πυρήνα του είναι 1,6m. Με βάση αυτά τα δεδομένα, το μήκος του συνολικού DNAτου κάθε φυσιολογικού γαμέτη αυτού του κουνελιού είναι:

α)1,6m, β)0,4m,γ) 0,8m, δ)λίγο μεγαλύτερο από 0,4m.

Να γράψετε στο τετράδιό σας τη σωστή απάντηση (μονάδες 2) και να αιτιολογήσετε την επιλογή σας. (μονάδες 3)

Μονάδες 5

Γ2. Σύμφωνα με τα δεδομένα του ερωτήματος Γ1, θα είναι το ίδιο ή όχι το συνολικό μήκος του DNAόλων των φυσιολογικών γαμετών ενός αρσενικού κουνελιού, με το μήκος του συνολικού DNAτων φυσιολογικών γαμετών ενός θηλυκού κουνελιού;

Μονάδες 3

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ3. Ένα φυσιολογικό ωάριο ενός πιθήκου περιέχει 24 χρωμοσώματα. Πόσες αλυσίδες DNAυπάρχουν στον καρυότυπο του συγκεκριμένου οργανισμού; (μονάδες 3) Να αιτιολογήσετε την απάντησή σας. (μονάδες 6)

Μονάδες 9

2018 ΕΣΠΕΡΙΝΟ

Γ1. Στα κύτταρα ενός οργανισμού που βρίσκονται στη μετάφαση υπάρχουν 96 μόρια DNA. Να βρείτε:

α. τον αριθμό των χρωμοσωμάτων και των χρωματίδων που υπάρχουν στη μετάφαση.

β. τον αριθμό των ινιδίων χρωματίνης που υπάρχουν στην αρχή της μεσόφασης και στο τέλος της.

γ. τον αριθμό των μορίων DNA στην αρχή της μεσόφασης και στο τέλος της.

δ. τον αριθμό των χρωμοσωμάτων και των μορίων DNA στους γαμέτες.

ε. τον αριθμό των χρωμοσωμάτων και των μορίων DNA στο φυσιολογικό ζυγωτό.

Μονάδες 10

ΘΕΜΑ Δ

2000 ΗΜΕΡΗΣΙΟ

Ένα ανθρώπινο σωματικό κύτταρο έχει 46 χρωμοσώματα.

Α.1. Πόσα μόρια DNAσυνολικά υπάρχουν στα χρωμοσώματα του συγκεκριμένου κυττάρου, στο στάδιο της μετάφασης της μίτωσης;

          Μονάδες 2

  1. Να δικαιολογήσετε την απάντησή σας.

Μονάδες 4

Β. Να περιγράψετε τις χαρακτηριστικές μορφές, με τις οποίες εμφανίζεται το γενετικό υλικό ενός ευκαρυωτικού κυττάρου, ανάλογα με το στάδιο του κυτταρικού κύκλου που βρίσκεται.

Μονάδες 9

2012 ΗΜΕΡΗΣΙΟ

Δ4. Από τη μύγα Drosophilaαπομονώθηκαν τρία διαφορετικά φυσιολογικά κύτταρα στα οποία προσδιορίστηκε το μέγεθος του γονιδιώματος σε ζεύγη βάσεων. Στο πρώτο κύτταρο το μέγεθος του γονιδιώματος υπολογίστηκε σε 3,2·108ζεύγη βάσεων, στο δεύτερο κύτταρο σε 1,6·108ζεύγη βάσεων και στο τρίτο κύτταρο σε 6,4·108ζεύγη βάσεων. Να δικαιολογήσετε γιατί υπάρχουν οι διαφορές αυτές στο μέγεθος του γονιδιώματος των τριών κυττάρων.

Μονάδες 6

 

Διαγώνισμα κεφαλαίου 2 (Β). Το δόγμα της μοριακής βιολογίας και η ρύθμιση της γονιδιακής έκφρασης

Διαγώνισμα κεφαλαίου 2 (Αντιγραφή και Εκφραση της Γενετικής Πληροφοριας)

Σημείωση: στο ερώτημα V του 4ο θέματος η ερώτηση: Πόσα διαφορετικά μόρια λακτόζης απαιτούνται για την παραγωγή μορίων καταστολέα, αντικαθίσταται από την ερώτηση: πόσα διαφορετικά μόρια mRNA απαιτούνται για την παραγωγή μορίων καταστολέα;