ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 8ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ

ΘΕΜΑ Α

2003 ΕΣΠΕΡΙΝΟ

1.Οι ιντερφερόνες είναι

α.αντιικές πρωτεΐνες που παράγονται από κύτταρα που έχουν μολυνθεί από ιούς.

β.ένζυμα που ελέγχουν το μεταβολισμό των σακχάρων.

γ.πρωτεΐνες που προκαλούν σύντηξη των καρκινικών κυττάρων.

δ.χημικές ενώσεις που προκαλούν αλλαγές στα γονίδια.

Μονάδες 5

2003 ΟΜΟΓΕΝΕΙΣ

5.Τα μονοκλωνικά αντισώματα παράγονται από

α.καρκινικά κύτταρα.

β.έναν κλώνο Β-λεμφοκυττάρων.

γ.βακτήρια.

δ.ερυθρά αιμοσφαίρια.

Μονάδες 5

2004 ΗΜΕΡΗΣΙΟ

  1. Οι ιντερφερόνες που χρησιμοποιεί σήμερα ο άνθρωπος είναι δυνατόν να παράγονται σε μεγάλες ποσότητες από …

α.κύτταρα ανθρώπου.

β.κύτταρα ζώων.

γ.γενετικά τροποποιημένα βακτήρια.

δ.φυτικά κύτταρα.

Μονάδες 5

2004 ΕΣΠΕΡΙΝΟ

  1. Η ινσουλίνη είναι μια ορμόνη που ρυθμίζει

α.το μεταβολισμό των υδατανθράκων στο αίμα.

β.τη συγκέντρωση των πρωτεϊνών στο αίμα.

γ.τη συγκέντρωση των αλάτων στο αίμα.

δ.το μεταβολισμό της χοληστερόλης.

Μονάδες 5

2004 ΟΜΟΓΕΝΕΙΣ

  1. Οι ιντερφερόνες είναι πρωτεΐνες που παράγονται από κύτταρα

α.που μολύνθηκαν από ιούς.

β.που μολύνθηκαν από μύκητες.

γ.ατόμων με χρωμοσωμικές ανωμαλίες.

δ.μόνο φυτικών οργανισμών.

Μονάδες 5

2005 ΗΜΕΡΗΣΙΟ

3.Exvivoονομάζεται η γονιδιακή θεραπεία κατά την οποία …

α. τα κύτταρα τροποποιούνται έξω από τον οργανισμό και εισάγονται πάλι σ’ αυτόν.

β.τα κύτταρα τροποποιούνται μέσα στον οργανισμό του ασθενούς.

γ.τα κύτταρα πολλαπλασιάζονται στο εργαστήριο.

δ.τα κύτταρα συντήκονται με αντισώματα.

Μονάδες 5 

2005 ΟΜΟΓΕΝΕΙΣ

  1. Κατά την invivoγονιδιακή θεραπεία

α.τα φυσιολογικά γονίδια εισάγονται κατ’ ευθείαν στον οργανισμό.

β.τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό.

γ.γίνεται πλήρης αντικατάσταση του μεταλλαγμένου γονιδίου.

δ.χρησιμοποιούνται ως φορείς βακτήρια ή πρωτόζωα.

Μονάδες 5

2006 ΕΣΠΕΡΙΝΟ

  1. Τα αντισώματα είναι

α.νουκλεϊκά οξέα.

β.πρωτεΐνες.

γ.υδατάνθρακες.

δ.λιπίδια.

Μονάδες 3

2006 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟΥ 

4.Στην exvivoγονιδιακή θεραπεία τα κύτταρα του ασθενούς

α.τροποποιούνται μέσα στον οργανισμό του.

β.τροποποιούνται έξω από τον οργανισμό του και εισάγονται πάλι σ’ αυτόν.

γ.συντήκονται με καρκινικά κύτταρα.

δ.ιχνηθετούνται με ραδιενεργό φώσφορο.

Μονάδες 5

2006 ΟΜΟΓΕΝΕΙΣ

5.Η γονιδιακή θεραπεία

α.εφαρμόζεται μόνο στα λεμφοκύτταρα.

β.έχει ως στόχο να διορθώσει μια γενετική βλάβη.

γ.αντικαθιστά πολλά μεταλλαγμένα γονίδια.

δ.μεταβιβάζεται πάντοτε στους απογόνους.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ

5.Η κυστική ίνωση κληρονομείται με

α.φυλοσύνδετο επικρατή τύπο κληρονομικότητας.

β.φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας.

γ.αυτοσωμικό επικρατή τύπο κληρονομικότητας.

δ.αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας.

Μονάδες 5

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

5.Η ινσουλίνη είναι μια ορμόνη που

α.ρυθμίζει την παραγωγή αντιικών πρωτεϊνών.

β.ρυθμίζει το μεταβολισμό των υδατανθράκων.

γ.παράγεται από πρόδρομα ερυθροκύτταρα.

δ.παράγεται από Β-λεμφοκύτταρα.

Μονάδες 5

2008 ΕΣΠΕΡΙΝΟ

4.Κατά την invivoγονιδιακή θεραπεία

α.χρησιμοποιούνται μεταλλαγμένα βακτήρια ως φορείς.

β.τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό.

γ.γίνεται αντικατάσταση των μεταλλαγμένων γονιδίων.

δ.τα φυσιολογικά γονίδια εισάγονται κατευθείαν στον οργανισμό.

Μονάδες 5

2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

5.Οι ιντερφερόνες είναι πρωτεΐνες που

α.παράγονται από τα κύτταρα του παγκρέατος.

β.παράγονται από υβριδώματα.

γ.έχουν αντιιική δράση.

δ.φέρουν γενετικές πληροφορίες.

Μονάδες 5 

2009 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

  1. Η γονιδιακή θεραπεία εφαρμόσθηκε για την αντιμετώπιση

α.της κυστικής ίνωσης.

β.του αλφισμού.

γ.της υπερχοληστερολαιμίας.

δ.του συνδρόμου Down.

Μονάδες 5

2009 ΟΜΟΓΕΝΕΙΣ

  1. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες

α.λιπιδίων.

β.DNA.

γ.RNA.

δ.μονοκλωνικών αντισωμάτων.

Μονάδες 5 

2010 ΕΣΠΕΡΙΝΟ

Α2. Η ινσουλίνη είναι μια ορμόνη που ρυθμίζει

α.τον μεταβολισμό των πρωτεϊνών.

β.τη συγκέντρωση των αλάτων στα ούρα.

γ.τον μεταβολισμό των υδατανθράκων στο αίμα.

δ.τη συγκέντρωση της χοληστερόλης στο αίμα.

Μονάδες 5

2011 ΗΜΕΡΗΣΙΟ

Α5. Τα υβριδώματα παράγονται ύστερα από

α.σύντηξη βακτηρίων με καρκινικά κύτταρα.

β.σύντηξη Β λεμφοκυττάρων με καρκινικά κύτταρα.

γ.σύντηξη Β λεμφοκυττάρων με ιούς.

δ.υβριδοποίηση δύο μονόκλωνων αλυσίδων DNA.

Μονάδες 5

2012 ΕΣΠΕΡΙΝΟ

Α3. Τα υβριδώματα παράγονται ύστερα από σύντηξη

α.β-λεμφοκυττάρων με ιούς

β.β-λεμφοκυττάρων με βακτήρια

γ.μονοκλωνικών αντισωμάτων με καρκινικά κύτταρα

δ.β-λεμφοκυττάρων με καρκινικά κύτταρα.

Μονάδες 5

2012 ΟΜΟΓΕΝΕΙΣ

Α1. Η ασθένεια που χαρακτηρίζεται από έλλειψη ή μείωση ινσουλίνης είναι

α.ο αλφισμός.

β.η φαινυλκετονουρία.

γ.ο διαβήτης.

δ.η αιμορροφιλία.

Μονάδες 5 

2013 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α4. Τα υβριδώματα είναι

α.υβρίδια καλαμποκιού

β.καρκινικά κύτταρα

γ.υβριδικά μόρια DNA-RNA

δ.κύτταρα που προκύπτουν από σύντηξη Β-λεμφοκυττάρων με καρκινικά κύτταρα.

Μονάδες 5

2013 ΟΜΟΓΕΝΕΙΣ

Α4. Υβριδώματα ονομάζονται τα

α. κύτταρα που προκύπτουν από σύντηξη Β-λεμφοκυττάρων με καρκινικά κύτταρα.

β.κύτταρα που προκύπτουν μετά από βακτηριακή ζύμωση.

γ.υβρίδια καλαμποκιού.

δ.υβριδοποιημένα μόρια DNA.

Μονάδες 5

Α5. Τα αντισώματα είναι

α.νουκλεϊκά οξέα.

β.υδατάνθρακες.

γ.λιπίδια.

δ.πρωτεΐνες.

Μονάδες 5

2014 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α5. Με τη γονιδιακή θεραπεία

α.παράγονται μονοκλωνικά αντισώματα

β.γίνεται εισαγωγή του φυσιολογικού αλληλόμορφου γονιδίου

γ.γίνεται αντικατάσταση του μεταλλαγμένου γονιδίου από το φυσιολογικό

δ.μεταβιβάζεται στους απογόνους το φυσιολογικό γονίδιο.

Μονάδες 5

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ 

Α5. Ο τύπος γονιδιακής θεραπείας κατά τον οποίο τα κύτταρα τροποποιούνται έξω από τον οργανισμό ονομάζεται

α.exvivo

β.ιχνηθέτηση

γ.invivo

δ.χαρτογράφηση.

Μονάδες 5

2014 ΟΜΟΓΕΝΕΙΣ

Α3. Η ινσουλίνη χρησιμοποιείται για τη θεραπεία

α.της αιμορροφιλίας

β.του εμφυσήματος

γ.της κυστικής ίνωσης

δ.του διαβήτη.

Μονάδες 5

Α4. Στόχος της γονιδιακής θεραπείας είναι η

α.παραγωγή μονοκλωνικών αντισωμάτων

β.αντικατάσταση του μεταλλαγμένου γονιδίου

γ.«διόρθωση» της γενετικής βλάβης

δ.παραγωγή φαρμακευτικών πρωτεϊνών.

Μονάδες 5

2015 ΗΜΕΡΗΣΙΟ

Α4.Η κυστική ίνωση κληρονομείται ως

α.αυτοσωμικός επικρατής χαρακτήρας

β.φυλοσύνδετος υπολειπόμενος χαρακτήρας

γ.φυλοσύνδετος επικρατής χαρακτήρας

δ.αυτοσωμικός υπολειπόμενος χαρακτήρας.

Μονάδες 5

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α3. Οι ιντερφερόνες είναι

α.πρωτεΐνες

β.αντιβιοτικά

γ.εμβόλια

δ.αντισώματα.

Μονάδες 5

Α4. Για τη θεραπεία του διαβήτη χρησιμοποιούμε

α.α1-αντιθρυψίνη

β.ιντερφερόνες

γ.ινσουλίνη

δ.παράγοντα ΙΧ

Μονάδες 5

2016 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α4. Η ανεπάρκεια του ανοσοποιητικού συστήματος λόγω έλλειψης του ενζύμου απαμινάση της αδενοσίνης (ADA)

α.οφείλεται στον ιό του AIDS

β.δεν μπορεί να αντιμετωπιστεί με γονιδιακή θεραπεία

γ.εμφανίζει αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας

δ.εμφανίζεται μόνο σε γενετικά τροποποιημένους οργανισμούς.

Μονάδες 5

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Α2. Η ινσουλίνη

α.παράγεται από κύτταρα του ήπατος

β.ρυθμίζει τη συγκέντρωση των λιπιδίων στο αίμα

γ.αποτελείται από δύο μικρά πεπτίδια

δ.κωδικοποιείται από δυο γονίδια.

Μονάδες 5

2016 ΟΜΟΓΕΝΕΙΣ

Α3. Η πρώτη invivoγονιδιακή θεραπεία εφαρμόστηκε το 1993 για τη θεραπεία της

α.κυστικής ίνωσης

β.φαινυλκετονουρίας

γ.υπερχοληστερολαιμίας

δ.αιμορροφιλίας.

Μονάδες 5

Α4. Η ινσουλίνη

α.αποτελείται από μόρια γλυκόζης

β.παράγεται στο ήπαρ

γ.όταν απουσιάζει από τον οργανισμό προκαλείται διαβήτης

δ.αποτελείται από νουκλεοτίδια.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ

Α5. Ο ανθρώπινος αντιαιμορροφιλικός παράγοντας ΙΧ παραλαμβάνεται από

α.διαγονιδιακά θηλυκά πρόβατα

β.διαγονιδιακά αρσενικά πρόβατα

γ.διαγονιδιακά αρσενικά και θηλυκά πρόβατα

δ.μικρής ηλικίας θηλυκά πρόβατα.

Μονάδες 5

2017 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ-ΟΜΟΓΕΝΕΙΣ

Α1. Η γονιδιακή θεραπεία είναι δυνατόν να εφαρμοστεί

α.στο σύνδρομο Down

β.στον καρκίνο του παχέος εντέρου

γ.στην αιμορροφιλία Α

δ.στην υπερχοληστερολαιμία.

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Α5. Η γονιδιακή θεραπεία έχει ως στόχο τη «διόρθωση» της γενετικής βλάβης με

α. αντικατάσταση του φυσιολογικού επικρατούς αλληλόμορφου σε όλα τα κύτταρα του ασθενή

β.αντικατάσταση του φυσιολογικού επικρατούς αλληλόμορφου σε ορισμένα σωματικά κύτταρα του ασθενή

γ.την εισαγωγή του φυσιολογικού υπολειπόμενου αλληλόμορφου σε όλα τα κύτταρα του ασθενή

δ.την εισαγωγή του φυσιολογικού επικρατούς αλληλόμορφου σε ορισμένα σωματικά κύτταρα του ασθενή.

Μονάδες 5

2018 ΗΜΕΡΗΣΙΟ

Α3. Ραδιενεργός 32Ρ και ραδιενεργό 35S είναι δυνατόν να ενσωματωθούν αντίστοιχα:

α. σε έναν υποκινητή γονιδίου και ένα μονοκλωνικό αντίσωμα

β. στην DNA πολυμεράση και σε ένα πλασμίδιο

γ. στην RNA πολυμεράση και στην προϊνσουλίνη

δ. στον χειριστή του οπερονίου της λακτόζης και στην λακτόζη.

Μονάδες 5 

ΘΕΜΑ Β

2001 ΟΜΟΓΕΝΕΙΣ

  1. Να περιγράψετε την τεχνική παραγωγής μονοκλωνικών αντισωμάτων για ένα συγκεκριμένο αντιγόνο.

Μονάδες 10

ΕΣΠΕΡΙΝΟ 2002

Α.Να ξαναγράψετε στο τετράδιό σας τις προτάσεις, αφού συμπληρώσετε τα κενά με τις σωστές λέξεις.

1.Η ινσουλίνη είναι μία ορμόνη που αποτελείται από 51 ……… και παράγεται από ειδικά κύτταρα του ………….. Η ορμόνη αυτή ρυθμίζει το μεταβολισμό των ……….. και ειδικότερα το ποσοστό της γλυκόζης στο ………. .

Μονάδες 6

2002 ΟΜΟΓΕΝΕΙΣ

1.Τι είναι οι φαρμακευτικές πρωτεΐνες;

Μονάδες 5

  1. Να περιγράψετε πώς τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν ως θεραπευτικά μέσα.

Μονάδες 10

2004 ΗΜΕΡΗΣΙΟ

Να απαντήσετε στις παρακάτω ερωτήσεις:

  1. Ποιος είναι ο ρόλος των μονοκλωνικών αντισωμάτων ως ανοσοδιαγνωστικά;

Μονάδες 7

2004 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

4.Με ποια διαδικασία παράγονται μονοκλωνικά αντισώματα στο εργαστήριο για ένα επιλεγμένο αντιγόνο;

Μονάδες 7

2005 ΗΜΕΡΗΣΙΟ

  1. Τι είναι οι ιντερφερόνες, τι προκαλούν και σε ποιες περιπτώσεις μπορούν να χρησιμοποιηθούν για την αντιμετώπιση ασθενειών;

Μονάδες 9

2005 ΕΣΠΕΡΙΝΟ

  1. Η γονιδιακή θεραπεία στηρίζεται στην εφαρμογή της τεχνολογίας του ανασυνδυασμένου DNA. (Σ-Λ)

Μονάδες 3

2006 ΕΣΠΕΡΙΝΟ

  1. Η ινσουλίνη είναι μία (ορμόνη – βιταμίνη) που αποτελείται από 51 (αμινοξέα – νουκλεοτίδια) και παράγεται από ειδικά κύτταρα του (ήπατος – παγκρέατος). Ρυθμίζει το μεταβολισμό των (υδατανθράκων – πρωτεϊνών) και ειδικότερα το ποσοστό τους (στο αίμα – στα ούρα). Η ασθένεια που οφείλεται στην έλλειψη ή μείωση της ινσουλίνης ονομάζεται (διαβήτης – αναιμία).

Μονάδες 6

  1. Η γονιδιακή θεραπεία στοχεύει να “διορθώσει” τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου.

Μονάδες 3

2006 ΟΜΟΓΕΝΕΙΣ

3.Τι είναι μονοκλωνικά αντισώματα και ως τι χρησιμοποιούνται;

Μονάδες 8

2007 ΕΣΠΕΡΙΝΟ

Β.Να γράψετε στο τετράδιό σας το γράμμα κάθε στοιχείου της Στήλης Ι και δίπλα στο γράμμα αυτό τον αριθμό ενός στοιχείου της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία της Στήλης ΙΙπερισσεύουν.

                   Στήλη Ι                                                      Στήλη ΙΙ

(ασθένεια)                                   (φαρμακευτική ουσία που ενδείκνυται)

α. διαβήτης                                                1.α1-αντιθρυψίνη

                   β.καρκίνος                                               2. απαμινάση της αδενοσίνης

                   γ.εμφύσημα                                              3. ιντερφερόνες

                   δ.κληρονομική ανεπάρκεια                      4. παράγοντας ΙΧ

                   ανοσοποιητικού συστήματος

                   ε.αιμορροφιλία Β                                      5. φαινυλαλανίνη

                                                                                     6.αυξητική ορμόνη

                                                                                     7.ινσουλίνη

Μονάδες 10

2007 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

3.Τι είναι και πού οφείλεται η κυστική ίνωση; (μονάδες 2) Ποια είναι η διαδικασία που εφαρμόστηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993; (μονάδες 6)

Μονάδες 8

2008 ΗΜΕΡΗΣΙΟ

3.Πώς συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος στη μελέτη της εξέλιξής του και στη μαζική παραγωγή προϊόντων;

Μονάδες 7

2008 ΕΣΠΕΡΙΝΟ

2.Γιατί η “διόρθωση” μιας γενετικής βλάβης που επιτυγχάνεται με τη γονιδιακή θεραπεία δεν μεταβιβάζεται στους απογόνους;

Μονάδες 8

2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ

4.Τι είναι γονιδιακή θεραπεία και ποιος ο στόχος της;

Μονάδες 4

2009 ΗΜΕΡΗΣΙΟ

  1. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου; (μονάδες 5) Ποια τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας; (μονάδες 2)

Μονάδες 7

2009 ΕΣΠΕΡΙΝΟ

Β. Ένας νέος τομέας της βιοτεχνολογίας που αναπτύσσεται ταχύτατα είναι η γονιδιακή θεραπεία.

1.Ποιος είναι ο στόχος της γονιδιακής θεραπείας;

Μονάδες 5

  1. Ποιες είναι οι προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας;

Μονάδες 6

  1. Να αναφέρετε ονομαστικά τους τύπους γονιδιακής θεραπείας.

Μονάδες 4

2010 ΕΣΠΕΡΙΝΟ

  1. Οι ιντερφερόνες παράγονται από κύτταρα που έχουν μολυνθεί από ………… .
  2. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες ενός …………… αντισώματος.

Μονάδες 4

2011 ΕΣΠΕΡΙΝΟ

Β1.Να γράψετε στο τετράδιό σας τα γράμματα της Στήλης Ι και δίπλα σε κάθε γράμμα, τον αριθμό της Στήλης ΙΙ, ώστε να προκύπτει η σωστή αντιστοίχιση. Δύο στοιχεία τηςΣτήλης ΙΙ περισσεύουν.

                       Στήλη Ι                                                            Στήλη ΙΙ

α.invivoγονιδιακή θεραπεία                               1.μικροέγχυση

       β.γενετική τροποποίηση ζώων                           2. περιοριστική ενδονουκλεάση

       γ.ημιαυτόνομα οργανίδια                                     3. ριβοσώματα

       δ.ένζυμο που συνδέει τμήματα DNA                   4. RNAπολυμεράση

       ε.πλασμίδιο Ti                                                      5. DNAδεσμάση

       στ.σύνθεση κυτταροπλασματικών πρωτεϊνών   6.μιτοχόνδρια

                                                                                     7.Agrobacteriumtumefaciens

                                                                                     8.κυστική ίνωση

Μονάδες 12

2011 ΟΜΟΓΕΝΕΙΣ

Β1. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 8 

2012 ΗΜΕΡΗΣΙΟ

Β1. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα για την επιλογή οργάνων συμβατών στις μεταμοσχεύσεις;

Μονάδες 6

2013 ΗΜΕΡΗΣΙΟ

Β1. Να περιγράψετε τη διαδικασία που εφαρμόστηκε για πρώτη φορά το 1990  στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος, η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA).

Μονάδες 8

2014 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β3. Μια από τις πιο ενδιαφέρουσες χρήσεις των μονοκλωνικών αντισωμάτων είναι η εφαρμογή τους στη θεραπεία του καρκίνου. Σε ποια ιδιότητα των μονοκλωνικών αντισωμάτων βασίζεται αυτή η εφαρμογή; (μονάδες 2) Να περιγράψετε τον τρόπο της θεραπευτικής τους δράσης. (μονάδες 4)

Μονάδες 6

2015 ΗΜΕΡΗΣΙΟ

Β4. Τι είναι η ινσουλίνη και ποιος είναι ο ρόλος της;

Μονάδες 6

2015 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β2. β.Όλα τα αντιγόνα έχουν πάντα μία μόνο περιοχή που αναγνωρίζεται από μόνο ένα αντίσωμα. Σωστόή Λάθος

Μονάδα 1

2015 ΟΜΟΓΕΝΕΙΣ 

Β4. Τι ονομάζεται αντιγονικός καθοριστής (μονάδες 3) και ποια αντισώματα ονομάζονται μονοκλωνικά (μονάδες 3);

Μονάδες 6

2016 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Β4. Τα μονοκλωνικά αντισώματα μπορούν να συνεισφέρουν σημαντικά στην αύξηση της ευαισθησίας κλινικών δοκιμασιών όπως η ταυτοποίηση των ομάδων αίματος. Στην παρασκευή ενός τέτοιου τεστ προσδιορισμού των ομάδων αίματος, σύμφωνα με το σύστημα ΑΒ0, να εξηγήσετε πόσα και ποια μονοκλωνικά αντισώματα θα πρέπει να περιέχονται.

Μονάδες 6

2016 ΟΜΟΓΕΝΕΙΣ

Β1. Να αντιστοιχίσετε σωστά τον αριθμό (1, 2, 3, 4και 5) καθεμιάς από τις πρωτεΐνες της στήλης Ιμε το γράμμα της εφαρμογής (Α, Β, Γ, Δκαι Ε) που αναφέρεται στη στήλη ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. α1αντιθρυψίνη Α: Αντιιικός παράγοντας
2. Παράγοντας VIII B:Αιμορροφιλία Α
3. Παράγοντας ΙΧ Γ: Εμφύσημα
4. Ιντερφερόνες Δ: Τεστ κύησης
5. Μονοκλωνικά αντισώματα Ε: Αιμορροφιλία Β

 

Μονάδες 5

2017 ΗΜΕΡΗΣΙΟ

Β3. Κατά την έναρξη της κύησης ο οργανισμός της εγκυμονούσας παράγει μια ειδική ορμόνη, τη χοριακή γοναδοτροπίνη. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων που θα μπορούσαν να χρησιμοποιηθούν σε διαγνωστικούς ελέγχους (τεστ) κύησης.

Μονάδες 7

2017 ΕΣΠΕΡΙΝΟ

Β3. Στο μαστικό αδένα ενός προβάτου υπάρχει συγκεκριμένος κυτταρικός τύπος στον οποίο εκφράζεται το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος. Θέλουμε να πάρουμε την πρωτεΐνη α1-αντιθρυψίνη από το γάλα ενός διαγονιδιακού προβάτου. Για το λόγο αυτό εισάγουμε μέσα στο γονίδιο της καζεΐνης με κατάλληλο προσανατολισμό το γονίδιο της α1-αντιθρυψίνης. Να εξηγήσετε γιατί θα εκφραστεί το γονίδιο της α1-αντιθρυψίνης στα κύτταρα του μαστικού αδένα.

Μονάδες 6

Β4. Κατά την έναρξη της κύησης ο οργανισμός της εγκυμονούσας παράγει μια ειδική ορμόνη, τη χοριακή γοναδοτροπίνη. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων που θα μπορούσαν να χρησιμοποιηθούν σε διαγνωστικούς ελέγχους (τεστ) κύησης.

Μονάδες 7 

2017 ΗΜΕΡΗΣΙΟ-ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Β1. Να αντιστοιχίσετε σωστά τον κάθε αριθμό της Στήλης Ι (δομές/μόρια) με ένα μόνο γράμμα της Στήλης ΙΙ(διαδικασίες). Επισημαίνεται ότι μία από τις διαδικασίες της Στήλης ΙΙ δεν έχει αντιστοιχία με κάποια από τις δομές/μόρια της Στήλης Ι.

Στήλη Ι (δομές/μόρια) Στήλη ΙΙ (διαδικασίες)
1. νουκλεόσωμα Α. Αντιγραφή
2. πριμόσωμα Β. Μετάφραση
3. πολύσωμα Γ. Ανοσοδιάγνωση
4. ριβονουκλεοπρωτεϊνικά σωματίδια Δ. Αντίστροφη μεταγραφή
5. μονοκλωνικά αντισώματα Ε. Συσπείρωση γενετικού υλικού
ΣΤ. Ωρίμανση mRNA

Μονάδες 5

Β2. Να αναφέρετε τα βήματα που απαιτούνται για να παραχθεί μια φαρμακευτική πρωτεΐνη ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

Μονάδες 6

2018 ΗΜΕΡΗΣΙΟ

Β1. Να αντιστοιχίσετε τον κάθε αριθμό της στήλης Ι με ένα μόνο γράμμα της στήλης ΙΙ.

Στήλη Ι   Στήλη ΙΙ
1. Περιοριστική ενδονουκλεάση α. Πολυσακχαρίτης
2. Πρωταρχικό τμήμα
3. Πριμόσωμα β. Νουκλεϊκό οξύ
4. Άγαρ
5. Αντίσωμα γ. Πρωτεΐνη
6. Απαμινάση της αδενοσίνης
7. Πλασμίδιο

 

Μονάδες 7

Β3. Σε ποιους βασικούς στόχους της Ιατρικής έχει συμβάλει αποτελεσματικά η βιοτεχνολογία;

Μονάδες 3

2018 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ-ΟΜΟΓΕΝΕΙΣ

Β3. Ποιες ιδιότητες των υβριδωμάτων επιτρέπουν την αποτελεσματική τους χρήση στην παραγωγή μεγάλων ποσοτήτων μονοκλωνικών αντισωμάτων;

Μονάδες 6

ΘΕΜΑ Γ

2000 ΗΜΕΡΗΣΙΟ 

Α. Να περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 9

2001 ΗΜΕΡΗΣΙΟ

  1. Μία ανωμαλία του γονιδίου που ελέγχει τη σύνθεση του ενζύμου απαμινάση της αδενοσίνης (ADA) προκαλεί μία ασθένεια του ανοσοποιητικού συστήματος. Απομονώθηκε το mRNAτου ενζύμου ADAαπό υγιές άτομο και από άτομο που ασθενεί. Τμήματα των παραπάνω mRNAείναι:

                   Υγιές άτομο:               AUGGAAUUUUGGGGGCGCACGUCG……

Άτομο που ασθενεί:   AUGGAAUUUUAGGGGCGCACGUCG……

α.Ποια είναι η αιτία της ασθένειας;

Μονάδες 6

β.Με ποιο τρόπο κληρονομείται αυτή η ασθένεια;

Μονάδες 2 

ΕΣΠΕΡΙΝΟ 2002

Α. 1. Τι είναι τα μονοκλωνικά αντισώματα;

Μονάδες 5

2.Πώς λειτουργούν τα μονοκλωνικά αντισώματα ως θεραπευτικά μέσα;

Μονάδες 8

2003 ΗΜΕΡΗΣΙΟ

1.Πώς αντιμετωπίζεται η κυστική ίνωση με γονιδιακή θεραπεία;

Μονάδες 10

2.Άνδρας ο οποίος πάσχει από κυστική ίνωση και υποβλήθηκε σε γονιδιακή θεραπεία για τη νόσο αποκτά παιδιά με φυσιολογική γυναίκα. Τι πιθανότητες υπάρχουν να είναι τα παιδιά τους φυσιολογικά; Να δικαιολογήσετε την απάντησή σας.

Μονάδες 15

2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Η ινσουλίνη είναι μία ορμόνη απαραίτητη για την καλή λειτουργία του ανθρώπινου οργανισμού.

1.Ποιος είναι ο ρόλος της ινσουλίνης στον οργανισμό μας;

Μονάδες 5

2.Από τι αποτελείται το μόριο της ινσουλίνης;

Μονάδες 5

3.Να γράψετε συνοπτικά τα στάδια παραγωγής της ανθρώπινης ινσουλίνης σε καλλιέργεια βακτηρίων.

Μονάδες 15

2003 ΟΜΟΓΕΝΕΙΣ

Α. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990, σ’ ένα τετράχρονο κορίτσι που έπασχε από έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA). Να περιγράψετε τη διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας.

Μονάδες 10

2005 ΕΣΠΕΡΙΝΟ

Ο οργανισμός μας είναι ικανός να παράγει αντισώματα εναντίον κάθε ξένου αντιγόνου.

  1. Πώς ο αντιγονικός καθοριστής σχετίζεται με την παραγωγή μονοκλωνικών αντισωμάτων από τον οργανισμό;

Μονάδες 10

  1. Πώς παράγονται στο εργαστήριο μεγάλες ποσότητες μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο;

Μονάδες 15

2005 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟΥ

Η Βιοτεχνολογία με την παραγωγή μονοκλωνικών αντισωμάτων και τη γονιδιακή θεραπεία έχει συμβάλει αποτελεσματικά στην υλοποίηση των βασικών στόχων της Ιατρικής, μεταξύ των οποίων είναι και η αποτελεσματική θεραπεία ασθενειών.

1.Γιατί τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν στη θεραπεία του καρκίνου (Μονάδες 6) και ποια είναι τα πλεονεκτήματα που παρουσιάζει η χρήση τους έναντι άλλων μεθόδων θεραπείας του (Μονάδες 2);

Μονάδες 8

2.Ποια διαδικασία ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (Μονάδες 8) και τι πιθανά προβλήματα αντιμετωπίζουν τα άτομα που πάσχουν από τη συγκεκριμένη ασθένεια (Μονάδες 3);

Μονάδες 11

  1. Γιατί η χρήση της γονιδιακής θεραπείας θα είναι περιορισμένη στο άμεσο μέλλον;

Μονάδες 6

2007 ΗΜΕΡΗΣΙΟ

Η Βιοτεχνολογία με την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA, τη χρήση της τεχνικής PCRκαι την παραγωγή μονοκλωνικών αντισωμάτων συνεισφέρει σε τομείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική.

1.Τι επιτρέπει η μέθοδος της αλυσιδωτής αντίδρασης της πολυμεράσης (PCR); (μονάδες 4) Να αναφέρετε τρεις πρακτικές εφαρμογές της (μονάδες 3).

Μονάδες 7

2.Να περιγράψετε τη διαδικασία παραγωγής στο εργαστήριο μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.

Μονάδες 8

2007 ΟΜΟΓΕΝΕΙΣ

Βιοτεχνολογία, με την ευρεία έννοια, είναι η χρήση ζωντανών οργανισμών προς όφελος του ανθρώπου και στηρίζεται κυρίως σε τεχνικές καλλιέργειας και ανάπτυξης των μικροοργανισμών και σε τεχνικές ανασυνδυασμένου DNA.

1.Με ποιο τρόπο καλλιεργούνται οι μικροοργανισμοί σε μεγάλη κλίμακα (βιομηχανική καλλιέργεια);

Μονάδες 10

2.Τι εννοούμε με τον όρο ζύμωση και ποια είναι τα προϊόντα της ζύμωσης;

Μονάδες 5

3.Η ανθρώπινη ινσουλίνη είναι μία από τις φαρμακευτικές πρωτεΐνες που παράγονται από βακτήρια. Μία από τις μεθόδους που χρησιμοποιούνται για την παραγωγή της είναι η παραγωγή του πρόδρομου μορίου της σε μία βακτηριακή καλλιέργεια και η μετατροπή του σε ινσουλίνη με ενζυμική κατεργασία. Να γράψετε, συνοπτικά, τα στάδια αυτής της μεθόδου.

Μονάδες 10

2008 ΕΣΠΕΡΙΝΟ 

Για την παραγωγή του προδρόμου μορίου της ινσουλίνης, δηλαδή της προϊνσουλίνης, κατάλληλα μετασχηματισμένα κύτταρα Escherichiacoliκαλλιεργήθηκαν σε βιοαντιδραστήρα. Η απεικόνιση της μεταβολής του πληθυσμού του βακτηρίου (Ν) σε σχέση με το χρόνο (t) έδωσε το παρακάτω διάγραμμα:

2019-02-19, 22.37.53

1.Με βάση το διάγραμμα αυτό, να χαρακτηρίσετε τον τύπο της καλλιέργειας και να περιγράψετε τις φάσεις της.

Μονάδες 10

2.Σε ποια συνήθως χρονικά διαστήματα της καλλιέργειας των βακτηρίων αναμένεται να παραχθεί η προϊνσουλίνη; Αφού παραλάβουμε την προϊνσουλίνη από τον βιοαντιδραστήρα, πώς θα την μετατρέψουμε σε ινσουλίνη;

Μονάδες 10

3.Ποιος είναι ο βιολογικός ρόλος της ινσουλίνης και ποια ασθένεια προκαλεί η μείωση ή η έλλειψή της;

Μονάδες 5

2008 ΟΜΟΓΕΝΕΙΣ

Για πρώτη φορά η γονιδιακή θεραπεία εφαρμόστηκε σε ένα κορίτσι που είχε έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA).

1.Ποιος είναι ο ρόλος του ενζύμου αυτού (μονάδες 3) και ποια τα συμπτώματα που εμφανίζουν τα άτομα με έλλειψη του συγκεκριμένου ενζύμου (μονάδες 6).

Μονάδες 9

2.Πώς ονομάζεται ο τύπος της γονιδιακής θεραπείας που εφαρμόστηκε (μονάδες 2) και γιατί (μονάδες 4).

Μονάδες 6

3.Ποια είναι η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας.

Μονάδες 10 

2010 ΗΜΕΡΗΣΙΟ

Γ1. Να περιγράψετε τις διαδικασίες με τις οποίες μπορούν να παραχθούν μονοκλωνικά αντισώματα, τα οποία συνεισφέρουν στον προσδιορισμό των ομάδων αίματος του ανθρώπου.

Μονάδες 7

2017 ΗΜΕΡΗΣΙΟ

Γ1. Στο μαστικό αδένα ενός προβάτου υπάρχει συγκεκριμένος κυτταρικός τύπος στον οποίο εκφράζεται το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος. Θέλουμε να πάρουμε την πρωτεΐνη α1-αντιθρυψίνη από το γάλα ενός διαγονιδιακού προβάτου. Για το λόγο αυτό εισάγουμε μέσα στο γονίδιο της καζεΐνης με κατάλληλο προσανατολισμό το γονίδιο της α1-αντιθρυψίνης. Να εξηγήσετε γιατί θα εκφραστεί το γονίδιο της α1-αντιθρυψίνης στα κύτταρα του μαστικού αδένα.

Μονάδες 6

2017 ΕΣΠΕΡΙΝΟ (ΜΥΤΙΛΗΝΗ)

Γ2. Μετά την κλωνοποίηση ορισμένων γονιδίων ιντερφερονών είναι σήμερα δυνατή η παραγωγή τους σε μεγάλες ποσότητες από γενετικά τροποποιημένα βακτήρια. Να εξηγήσετε πώς θα παραλάβουμε ιντερφερόνη από καλλιέργεια γενετικά τροποποιημένων βακτηρίων σε βιοαντιδραστήρα.

Μονάδες 8

ΘΕΜΑ Δ

2006 ΗΜΕΡΗΣΙΟ

Μια φυσιολογική γυναίκα παντρεύεται έναν άνδρα και αποκτούν δύο παιδιά, το Γιάννη και την Ελένη. Ο Γιάννης παρουσιάζει οικογενή υπερχοληστερολαιμία και β-θαλασσαιμία, ενώ η Ελένη δεν παρουσιάζει καμιά από τις δύο ασθένειες. Να γράψετε τους πιθανούς γονότυπους των γονέων και των παιδιών (Μονάδες 6) και να δικαιολογήσετε την απάντησή σας (Μονάδες 6). Εάν οι συγκεκριμένοι γονείς αποκτήσουν και τρίτο παιδί, να προσδιορίσετε την πιθανότητα να πάσχει μόνο από υπερχοληστερολαιμία, χωρίς να ληφθεί υπόψη η β-θαλασσαιμία (Μονάδες 6).

Πρόσφατα ανακοινώθηκε μελέτη για την εφαρμογή της γονιδιακής θεραπείας σε ασθενείς που πάσχουν από β-θαλασσαιμία. Λαμβάνοντας υπόψη ότι τα γονίδια των αιμοσφαιρινών εκφράζονται στα πρόδρομα ερυθροκύτταρα, ποιος τύπος γονιδιακής θεραπείας θα μπορούσε να εφαρμοστεί για την αντιμετώπιση της β-θαλασσαιμίας και γιατί (Μονάδες 7);

Μονάδες 25

 

Advertisements

Απάντηση

Εισάγετε τα παρακάτω στοιχεία ή επιλέξτε ένα εικονίδιο για να συνδεθείτε:

Λογότυπο WordPress.com

Σχολιάζετε χρησιμοποιώντας τον λογαριασμό WordPress.com. Αποσύνδεση /  Αλλαγή )

Φωτογραφία Google

Σχολιάζετε χρησιμοποιώντας τον λογαριασμό Google. Αποσύνδεση /  Αλλαγή )

Φωτογραφία Twitter

Σχολιάζετε χρησιμοποιώντας τον λογαριασμό Twitter. Αποσύνδεση /  Αλλαγή )

Φωτογραφία Facebook

Σχολιάζετε χρησιμοποιώντας τον λογαριασμό Facebook. Αποσύνδεση /  Αλλαγή )

Σύνδεση με %s