Αρχείο μηνός Μάρτιος 2018

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ 2018 (Β)

ΖΗΤΗΜΑ 1Ο

 Α. Επιλέξτε τη σωστή επιλογή που συμπληρώνει σωστά την πρόταση.

(μονάδες 20)

1) Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά τις ομάδες αίματος στο σύστημα ΑΒΟ του ανθρώπου:

2017 Διαγώνισμα προσομοίωσης Β-01

Τα άτομα της ΙΙΙ γενεάς έχουν φαινοτύπους:

α) Ο, Α, Β, Ο, Ο με πιθανότητα  (1/4)3 x(1/2) 2

β) Ο, Β, Ο, Α, Α με πιθανότητα  4 x(1/4)

γ) Ο, Α, Β, Ο, Α με πιθανότητα   1/4 x 1/4 x 1/4 x 1/4 x 1/4 x 1/4

δ) Ο, Ο, Ο, Ο, Ο με πιθανότητα  1 –  1023/1024

ε) Τίποτα από τα παραπάνω.

 

2) Δίνεται η παρακάτω υποθετική αλληλουχία του ενός κλώνου (κωδική

 

) γονιδίου που κωδικοποιεί για tRNA.

 

ΥΠΟΚΙΝΗΤΗΣ                   ΕΣΩΝΙΟ                     ΕΣΩΝΙΟ                        ΑΛΜ

ATCGCCTTAACCTACTACGCCTATACTATTCTATCCCCGCTATCTCATTCCTTT

—————-                    —————-                        ————                 ————-

Ποια είναι η αλληλουχία του ώριμου μεταγραφήματος;

α) Ομοίως με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

β) Συμπληρωματική με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

γ) Όμοια με την παραπάνω χωρίς τον υποκινητή και τα εσώνια αποτελούμενη από ριβονουκλεοτίδια.

δ) Συμπληρωματική με την παραπάνω χωρίς τον υποκινητή, τα εσώνια και τις ΑΛΜ αποτελούμενη από ριβονουκλεοτίδια.

ε) Τίποτα από τα παραπάνω.

3) Ένα άτομο προσήλθε στο νοσοκομείο και μετά από βιοχημικές εξετάσεις διαπιστώθηκε ότι έχει αυξημένα επίπεδα HbA2 και ήταν μολυσμένο από το πλασμώδιο. Το άτομο αυτό:

α) Νοσεί από δρεπανοκυτταρική αναιμία.

β) Νοσεί από β-θαλασσαιμία.

γ) Νοσεί από λοιμώδες νόσημα (ελονοσία).

δ) Είναι φορέας μίας γενετικής νόσου και δεν κινδυνεύει να πεθάνει από ελονοσία.

ε) Είναι φορέας δύο ασθενειών, της δρεπανοκυτταρικής αναιμίας (γενετική νόσος) και της ελονοσίας (λοιμώδης).

4) Ο καρκίνος είναι ένα γενετικό νόσημα που οφείλεται κατά κανόνα σε:

α) Έλλειψη πρωτοογκογονιδίων και υπερλειτουργία ογκοκατασταλτικών.

β) Έλλειψη ογκοκατασταλτικών και υπερλειτουργία πρωτοογκογονιδίων.

γ) Έλλειψη επιδιορθωτικών ενζύμων και υπερέκφραση ογκοκατασταλτικών γονιδίων.

δ) Λάθη που γίνονται κατά τη μείωση και τη μίτωση και οδηγεί σε ανευπλοειδία.

ε) Τίποτα από τα παραπάνω.

5) Στο βακτήριο E.coli η φυσιολογική έκφραση του ρυθμιστικού γονιδίου του οπερονίου της λακτόζης (υποθετικά) έχει ρυθμό 20 μόρια καταστολέα/24h και ρυθμό αποικοδόμησης καταστολέων 10 μόρια καταστολέα/24h όταν το βακτήριο αναπτύσσεται σε περιβάλλον με 100% γλυκόζη. Ένα βακτήριο που αναπτύσσεται σε περιβάλλον γλυκόζης και λακτόζης μετράται η παραγωγή των mRNA που κωδικοποιούνται από το οπερόνιο της λακτόζης.

2017 Διαγώνισμα προσομοίωσης Β-02

Στις χρονικές στιγμές t1, t2, t3 αντιστοίχως έχουμε μορια mRNA οπερονιου της λακτόζης:

α) 10 μόρια,     100 μόρια,        0 μόρια

β) 0 μόρια,       100 μόρια,        100 μόρια

γ) 10 μόρια,     100 μόρια,        100 μόρια

δ) 100 μόρια,   1000 μόρια,      0 μόρια

ε) Τίποτα από τα παραπάνω

Β. Χαρακτηρίστε ως Σ (Σωστή) ή Λ (Λανθασμένη) την καθεμία από τις παρακάτω προτάσεις:

α) Ένα πείραμα in vivo είναι το πείραμα δημιουργίας αμιγών στελεχών του Mendel.

β) Η Τρισωμία 21 (μη διαχωρισμός του 21ο χρωμοσώματος) έχει περισσότερες πιθανότητες να εμφανιστεί κατά τη μείωση σε σχέση με οποιαδήποτε άλλη τρισωμία του ανθρώπου.

γ) Για τα γονίδια α των αιμοσφαιρίνων ισχύουν οι νόμοι του Mendel.

δ) Ένα θηλυκό άτομο έχει όλα του τα γονίδια σε δύο αντίγραφα, ένα αρσενικό άτομο όχι.

ε) Το ρετινοβλάστωμα είναι μορφή καρκίνου που ελέγχεται μονογονιδιακά.

στ) Υπάρχει γονίδιό μας που γι’ αυτό υπάρχουν εκατοντάδες αντίγραφά του σε ένα μας κύτταρο.

ζ) Το ίδιο προϊόν ζύμωσης μπορεί να παράγεται από τον ίδιο μικροοργανισμό σε μεγάλες ποσότητες, τόσο στην εκθετική όσο και στη στατική.

η) Οι στόχοι της Ιατρικής είναι με τη σειρά: Η πρόληψη, η διάγνωση και η θεραπεία.

θ) Για τη δημιουργία των Βt φυτών δημιουργήθηκε cDNA βιβλιοθήκη του B. thurigiensis.

ι) Τα προϊόντα της ζύμωσης μπορεί να είναι ζωντανά ή νεκρά κύτταρα ή προϊόντα ζωντανών κυττάρων.

 

ΖΗΤΗΜΑ 2Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α. Δίνεται ο παρακάτω πίνακας. Να πραγματοποιηθούν όλες οι πιθανές αντιστοιχίσεις.

                                                            (μονάδες 5)

ΣΥΜΠΛΗΡΩΜΑΤΙΚΟΤΗΤΑ
1.     ΠΡΩΤΑΡΧΙΚΟ ΤΜΗΜΑ RNA Α. in vivo
2.     ΣΥΝΔΕΣΗ ΜΕΤΑΓΡΑΦΙΚΩΝ ΠΑΡΑΓ.
3.     ΔΗΜΙΟΥΡΓΙΑ 3΄       5΄ Ρ-ΔΕΣΜΩΝ B. in vitro
4.     ΣΥΝΔΕΣΗ ΚΟΛΛΩΔΩΝ ΑΚΡΩΝ
5.     ΙΧΝΗΘΕΤΗΜΕΝΟΣ ΑΝΙΧΝΕΥΤΗΣ Γ. ΤΙΠΟΤΑ ΑΠΟ ΤΑ ΠΑΡΑΠΑΝΩ

Β. 1) Ποιο θα είναι το αποτέλεσμα στην πρωτεΐνη που παράγεται σε προκαρυωτικό κύτταρο, αν στο γονίδιο που την κωδικοποιεί γίνει αντικατάσταση μίας βάσης;

(μονάδες 8)

2) Με ποιον από τους παρακάτω τρόπους θα μπορούσε να προκύψει ένα μηρυκαστικό ζώο το οποίο να παράγει τον πηκτικό παράγοντα ΙΧ στο γάλα του:

α) Με τη μέθοδο των επιλεκτικών διασταυρώσεων.

β) Με μεθόδους Γενετικής Μηχανικής.                                                    (μονάδες 2)

Αιτιολογήστε την απάντησή σας.                                                            (μονάδες 5)

3) Να αναφέρετε τα πλεονεκτήματα παραγωγής ανθρώπινης αυξητικής ορμόνης με μεθόδους Γενετικής Μηχανικής σε σχέση με την εξαγωγή της από πτώματα.

(μονάδες 5)

ΖΗΤΗΜΑ 3Ο

Α. Η Ράνια και η Αρεθα είναι δύο φίλες που ταξίδεψαν στο Περού πριν από μερικά χρόνια. Κατά το ταξίδι τους στα υψίπεδα των Άνδεων, εμφάνισαν συμπτώματα αναιμίας και μεταφέρθηκαν στο τοπικό νοσοκομείο, όπου και διαγνώστηκαν φαινοτυπικα ως ετεροζυγες για κάποιο παθολογικό αλληλόμορφο του γενετικού τόπου, όπου εδράζεται το γονίδιο της β σφαιρινης στο 11 χρωμόσωμα μας. Τα γονίδιά της α σφαιρινης εδράζονται στο 16ο χρωμόσωμα μας.

Μετά από βιοχημικές και μοριακές εξετάσεις στην Ελλάδα αποδείχθηκε ότι η Ράνια είναι φορέας της δρεπανοκυτταρική αναιμίας και η Αρεθα της μεσογειακής αναιμίας.

Παρακάτω φαίνεται το γενεαλογικό δένδρο των οικογενειών που δημιούργησαν οι δυο φίλες.

 2018 διόρθωση-01

Το άτομο ΙΙ3 νοσεί από δρεπανοκυτταρική αναιμία και το άτομο ΙΙ6 νοσεί από μεσογειακή αναιμία. Είναι γνωστό ότι τα άτομα ΙΙ8, ΙΙΙ7, ΙV6 είναι ομόζυγα φυσιολογικά για την μεσογειακή αναιμία και το άτομο ΙΙ1 είναι επίσης ομόζυγο φυσιολογικό για το γονίδιο β, ενώ ένα μόνο από τα άτομα ΙΙΙ2, ΙV2, V2 είναι ετεροζυγο για το γονίδιο βς.

Το άτομο VII1 γεννήθηκε με μίκροδρεπανοκυττταρική αναιμία.

α. Εάν υποθέσουμε ότι τα σχολικά εγχειρίδια στο Περού, κάνουν αναφορά στην δρεπανοκυτταρική αναιμία και την μεσογειακή αναιμία, με ποιο τρόπο κληρονόμησης νομίζετε ότι θα αναφέρουν ότι κληρονομούνται οι ασθένειες αυτές; (μονάδες 2)

β. Ποιά ήταν οι πιθανότητα, οι δυο φίλες να αποκτήσουν τον απόγονο VII1, που νοσεί από μίκροδρεπανοκυττταρική αναιμία, όπως προκύπτει από το γενεαλογικό δένδρο ; (5)

γ. Το ζευγάρι VI1, VI2, πρόκειται να αποκτήσει και δεύτερο παιδί. Το ζευγάρι ζήτησε γενετική καθοδήγηση για το ποιό είναι το ενδεχόμενο να αποκτήσει υγιές κορίτσι,  φορέα της δρεπανοκυτταρική αναιμίας ή υγιές αγόρι, φορέα της μεσογειακής αναιμίας ή υγιές κορίτσι ομόζυγο για το φυσιολογικό γονίδιο β1 ή υγιές αγόρι φορέα της δρεπανοκυττταρικής αναιμίας.

Τι τους απάντησε ο γενετιστής πριν και μετά τις μοριακές εξετάσεις για το γονίδιο β στο έμβρυο. Οι γονείς δεν θέλησαν ωστόσο να μάθουν το φύλο του δεύτερου παιδιού τους πριν την γέννηση του.(6)

Η μοριακή εξέταση έγινε με μια περιοριστική ενδονουκλεαση που πέπτει το αλληλόμορφο βς και το β όχι. Επίσης αποδείχθηκε ότι το παθολογικό αλληλόμορφο β1 για την μεσογειακή αναιμία έχει πάθει έλλειψη 25 ζ.β εντός της 5´ αμεταφραστής περιοχής του.

δ. Για ποιο λόγο η αναιμία, που προκαλείται από το αλληλόμορφο β1, αλλά και διάφορα άλλα παθολογικά αλληλόμορφα του γενετικού τόπου της β σφαιρίνης, που οδηγούν σε ελάττωση της φυσιολογικής ποσότητας της HbA ονομάζεται μεσογειακή αναιμία ; (3)

ε. Είναι γνωστό ότι το γονίδιο για την α σφαιρίνη εδράζεται στο 16 χρωμόσωμα μας, και αυτός ο γενετικός τόπος είναι διπλός, διαδοχικά ο ένας μετά τον άλλο. Ο γενετικός τόπος δε, 16p13.2 (πάνω) εκφράζεται με μικρότερο ρυθμό ( υποθετικά στο μισό) σε σχέση με τον γενετικό τόπο του α γονιδίου 16p13.1(κάτω). Εάν υποθέσουμε ότι ο πρώτος γενετικός τόπος φέρει γονίδιο α που εκφράζεται και παράγει 50 μοναδες των αλυσίδων α, τότε ο δεύτερος θα παράγει 100 μονάδες από α σφαιρίνες.

Ένα παιδί του ζευγαριού IV1, IV2, που και οι δυο είναι υγιείς, παντρεύτηκε και απέκτησε δύο παιδιά. Το πρώτο παράγει 200 μονάδες αλυσίδων α και νοσεί από δρεπανοκυτταρική αναιμία, ενώ το δεύτερο παιδί του παράγει 250 μονάδες αλυσίδων α και σε συνθήκες υποξύας εμφανίζει συμπτώματα αναιμίας και δεν παράγει καθόλου HbA2.

Ποιοί είναι οι γόνοτυποι των γονέων των δυο αυτών παιδιών για την α θαλασσαιμία; (2)

Με ποιά πιθανότητα, οι γονείς αυτοί, μπορούν να αποκτήσουν παιδί που θα παράγει 250 μονάδες α σφαιρίνων και θα παράγει περίπου 3% HbA2, ενώ θα νοσεί και από μικροδρεπανοκυττταρική αναιμία; (2)

Β. Το γονίδιο lux της πυγολαμπίδας ενθέτεται σε έναν πλασμιδιακό φορέα κλωνοποίησης που φέρει γονίδιο ανθεκτικότητας στην τετρακυκλίνη (tetR), το οποίο με τη σειρά του φέρει θέση αναγνώρισης από την EcoRI, καθώς και το γονίδιο lacZ του οπερονίου της λακτόζης:

α) Εξηγήστε αν τα κύτταρα-ξενιστές που δέχθηκαν τον ανασυνδυασμένο φορέα κλωνοποίησης θα εμφανίζουν βιοφωταύγεια. (μονάδες 3)

β) Ποια ιδιότητα πρέπει να χαρακτηρίζει τα κύτταρα-ξενιστές (E.coli) ώστε να μπορεί να γίνει η επιλογή των μετασχηματισμένων με το ανασυνδυασμένο.   (μονάδες 2)

ΖΗΤΗΜΑ 4Ο

Α. Τα αλληλόμορφα α+, β+, γ+ και δ+ είναι ανεξάρτητα μεταξύ τους και ελέγχουν το σχηματισμό μαύρου χρώματος σε ένα ζώο. Τα αλληλόμορφα α, β, γ, δ είναι τα υπολειπόμενα τα οποία δεν εκφράζονται.

     Ένα μαύρο άτομο που είναι καθαρή σειρά διασταυρώθηκε με ένα λευκό άτομο και στην F1 γενεά όλοι οι απόγονοι ήταν μαύροι. Στη συνέχεια διασταυρώθηκαν τα άτομα της F1 γενεάς.

Γνωρίζετε ότι το μεταβολικό μονοπάτι είναι:

α+                                β+                             γ+                            δ+

ΛΕΥΚΟ    —>      ΛΕΥΚΟ     —>     ΛΕΥΚΟ   – –>       ΚΑΦΕ    —>     ΜΑΥΡΟ

α) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΛΕΥΚΟ;

β) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΚΑΦΕ;                (μονάδες 5)

Β. Στο βακτήριο E.coli υπάρχει μία πρωτεΐνη με φυσιολογικό αμινοτελικό άκρο:                                         H2N – Met – Val – Ser – Ser – Pro – Met – Gly – Ala – Ala – Met – Ser …

Μία μετάλλαξη προκάλεσε αλλαγή στο αντικωδικόνιο ενός μορίου t

RNA  από 5΄- GAU – 3΄ σε 5΄- CAU – 3΄. Ποιο/α μπορεί να είναι τα πιθανά αμινοτελικά άκρα αυτής της πρωτεΐνης στα μεταλλαγμένα κύτταρα E.coli;               (μονάδες 5)

Γ. Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά την ασθένεια της μυοτονικής δυστροφίας.

2017 Διαγώνισμα προσομοίωσης Β-05

 

Η μυοτονική δυστροφία εμφανίζεται με βαθμιαία σοβαρότερα συμπτώματα από γενεά σε γενεά. Για να εξηγηθεί αυτή η παρατήρηση πραγματοποιήθηκαν μοριακές εξετάσεις στα άτομα Ι2, ΙΙ2 και ΙΙΙ2.

Οι αναλύσεις αυτές έδειξαν ότι ο ιχνηθετημένος ανιχνευτής 5΄CTGCTGCTGCTGCTG 3΄ υβρίδισε στο άτομο Ι2 10 φορές με το άτομο ΙΙ2 300 φορές και με το άτομο ΙΙΙ2 2000 φορές.

α) Ποια διασταύρωση του δοθέντος γενεαλογικού δέντρου αποδεικνύει τον τρόπο κληρονόμισης της ασθένειας; Ποιος είναι ο τύπος κληρονομικότητας;

(μονάδες 2)

β) Τα αποτελέσματα των μοριακών εξετάσεων σε ποιο συμπέρασμα οδηγούν για την αιτία της αυξανόμενης σοβαρότητας των συμπτωμάτων της ασθένειας από γενεά σε γενεά;

(μονάδες 3)

γ) Οι ανιχνευτές υβριδίζουν στην περιοχή της 3΄ αμετάφραστης περιοχής του υπεύθυνου για την ασθένεια γονιδίου. Ποιο από τα τρία διαφορετικά είδη κλωνοποίησης του γονιδίου αυτού μπορούν να χρησιμοποιήσουν οι επιστήμονες; Αιτιολογήστε με συντομία την απάντησή σας.

(μονάδες 3)

δ) Πώς ονομάζονται τα γονίδια που ευθύνονται για την ασθένεια στα άτομα Ι2, ΙΙ2 και ΙΙΙ2;

(μονάδα 1)

ε) Προτείνετε ένα πιθανό τύπο μετάλλαξης που μπορεί να εξηγήσει το διαφορετικό μέγεθος της 3΄ αμετάφραστης περιοχής του υπεύθυνου γονιδίου από γενεά σε γενεά εάν γνωρίζετε ότι είναι αποτέλεσμα μηχανισμού κατά τη διάρκεια του κυτταρικού κύκλου.

(μονάδα 1)

στ) Οι επιστήμονες θέλουν να ενθέσουν σε φορείς έκφρασης (πλασμίδια) τα γονίδια που ευθύνονται για την ασθένεια των ασθενών ατόμων της γενεαλογίας που σας δίνεται. Δίνεται ο περιοριστικός χάρτης του γονιδίου και δύο διαφορετικοί φορείς κλωνοποίησης. Ποια/ες περιοριστικές ενδονουκλεάσες θα χρησιμοποιήσουν οι επιστήμονες ώστε να εξασφαλίσουν των έκφραση των γονιδίων;

2017 Διαγώνισμα προσομοίωσης Β-06

2017 Διαγώνισμα προσομοίωσης Β-07

  1. Ποιος από τους δύο φορείς έκφρασης θα χρησιμοποιηθεί;
  2. Εξηγήστε για ποιο λόγο ο φυσικός Υ1 του γονιδίου της AmpR είναι ο κατάλληλος για την έκφραση του ανθρώπινου γονιδίου στο βακτήριο ξενιστή.

(μονάδες 5)