Διαγώνισμα Βιολογίας θετικής Κατευθύνσης κεφαλαίου 4 – Τεχνολογία ανασυνδυασμένου DNA

Ζήτημα 1.                                                                                                                           Μονάδες 25

  1. Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BamHI είναι:

5′ G|GATCC 3′

3′ CCTAG|G 5′

Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BclI είναι:

 5′ T|GATCA 3′

 3′ ACTAG|T 5′

Ένα γραμμικό μόριο DNA διαθέτει μοναδική θέση αναγνώρισης BamHI και ένα άλλο μόριο επίσης γραμμικό, με την ίδια κατά τα άλλα, ακριβώς αλληλουχία διαθέτει μοναδική θέση BclI, στη θέση της BamHI. Τα δυο μόρια πέπτονται ανεξάρτητα το ένα από το άλλο με την κατάλληλη περιοριστική ενδονουκλεάση το καθένα. Τα προϊόντα της πέψης αναμιγνύονται και προστίθεται το ένζυμο DNA δεσμάση. Στο τελικό μείγμα προστίθονται και οι δυο περιοριστικές ενδονουκλεάσες BamHI και BclI.

 Δημιουργούνται:

α. 4 διαφορετικά μόρια DNA

β. 2 διαφορετικά μόρια DNA

γ.1 μόριο DNA

δ. 2 όμοια μόρια DNA

 2. Στο παραπάνω μείγμα:

α. δρουν και οι δυο περιοριστικές ενδονουκλεάσες πάντα

β. δρα μόνο η μια από τις δυο περιοριστικές ενδονουκλεάσες πάντα

γ. μπορεί να δράσει ή η μια ή άλλη περιοριστική ενδονουκλεάση

δ. μπορεί να μην δράσει καμιά από τις δυο περιοριστικές ενδονουκλεάσες.

 3. Ποια από τις παρακάτω αλληλουχίες αποτελεί πιθανή θέση αναγνώρισης κάποιας περιοριστικής ενδονουκλεάσης; (α.,β.,γ. : δίνονται δίκλωνες αλληλουχίες)

α. 5’A|CTGC3′

3’TGAC|G5′

β. 5′ T|TTAAA3′

3’AAATT|T5′

γ. 5′ G|GATCA3′

3′ CCTAG|T5′

δ. 5’G|AATTC3′

 4. Μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη:

α. Για το γονίδιο της EcoRI, β. Για το γονίδιο του tRNA της Aργινίνης των λευκοκυττάρων μας

γ. Για το οπερόνιο της λακτόζης, δ. Για το γονίδιο της αντίστροφης μεταγραφάσης του HIV.

 5. Ένας φορέας κλωνοποίησης διαθέτει εκτός από το γονίδιο ανθεκτικότητας στην καναμυκίνη (αντιβιοτικό) και το γονίδιο LeuI που κωδικοποιεί το ένζυμο το οποίο απαιτείται για την σύνθεση του αμινοξέα Λεύκινη και μπορεί να χρησιμοποιηθεί ως γονίδιο για την επιλογή των μετασχηματισμένων ξενιστών με το ανασυνδυασμένο πλασμίδιο.

Ποιο γονότυπο και ποιο φαινότυπο πρέπει να εμφανίζουν τα επιθυμητά κύτταρα ξενιστές;

α. Πριν το μετασχηματισμό ήταν LeuI- και μετά τον μετασχηματισμό αυξάνονται σε περιβάλλον δίχως Λεύκινη.

β. Πριν το μετασχηματισμό ήταν LeuI+ και μετά το μετασχηματισμό δεν αυξάνεται σε περιβάλλον δίχως Λεύκινη

γ. Μετά το μετασχηματισμό ήταν LeuI- και αυξάνεται σε περιβάλλον δίχως Λεύκινη

δ. Μετά το μετασχηματισμό ήταν LeuI+ και δεν αυξάνεται σε περιβάλλον δίχως Λευκινη

 Ζήτημα 2                                                                                                                          Μονάδες 25

  1. Διαθέτετε το γονίδιο Ψ2 και θέλετε να το ενθέσετε εντός του φορέα κλωνοποίησης Β2 οποίος διαθέτει τις εξής θέσεις περιορισμού (οι αλληλουχίες είναι δίκλωνες αλλά δίνονται μόνο ο ένας από τους δυο κλώνους).

StuI : 5′ AGG|CCT3′                                                                                            SalI: 5΄G|TCGAC3′

Ψ2:5′ TCCGGCGGAATTCCAAGGCCT[ΑΤG…κωδική περιοχή]CGTCGACTCCGGC 3′

       3′ AGGCCGCCTTAAGGTTCCGGA[TAC…κωδική περιοχή]GCAGCTGAGGCCG 5′

 Τμήμα του Β2 _________Διεύθυνσης μεταγραφής_>____StuI_____SalI____EcoRI__________͢

α. Υπάρχουν δυο διαφορετικοί τρόποι ένθεσης του γονιδίου Ψ2 (κωδική περιοχή του) στο πλασμίδιο Β2. Ποιοι είναι αυτοί (4); Ποιο/α περιοριστικό/α ένζυμο/α θα χρησιμοποιήσετε  για να πεψετε το πλασμίδιο και το γονίδιο ώστε να απομονώσετε μόνο την κωδική περιοχή του γονιδίου(2);

β. Ποιος από τους δυο αυτούς τρόπους είναι ο κατάλληλος για να είναι δυνατή η έκφραση του γονιδίου Ψ2 στο κύτταρο ξενιστή (μονάδες 2); Αιτιολογήστε την απάντηση σας (7).

2. Εξηγήστε πως θα μπορούσαμε να παράξουμε την αιμοσφαιρίνη Α, που αποτελείται από 2 α και 2 β πολυπεπτιδικές αλυσίδες, από βακτήρια με την τεχνολογία της cDNA βιβλιοθήκης (10).

 

 Ζήτημα 3                                                                                                                         Μονάδες 25

  1. Δίνεται το παρακάτω υποθετικό γονίδιο του λ φάγου που κωδικοποιεί για ένα ολιγοπεπτιδιο. Το γονίδιο αυτό θέλουμε να το κλωνοποιησουμε με σκοπό την παραγωγή του ολιγοπεπτιδίου που κωδικοποιεί σε ζυμομύκητα.

Υ ATTG…CGGAATTCAAATGCCCCAGTTCATGTΑGAATTCTAAGCGC…ATGCAGTAG…AAA     

 Y TAAC…GCCTTAAGTTTACGGGGTCAAGTACATCTTAAGATTCGCG…TACGTCATC…TTT

Για την κλωνοποιήση του συγκεκριμένου γονίδιου θα επιλέξετε μεταξύ των παρακάτω φορέων κλωνοποιήσης.

2017 inmid-01

 

Σημείωση: Η θέση περιορισμού  μπορεί να βρίσκεται ακριβώς δίπλα στον υποκινητή τόσο του ενός όσο και του άλλου πλασμίδιου, όμως σε κάθε περίπτωση πρεπει να λειτουργεί ως θέση αναγνώρισης της EcoRI.

Στο πλασμίδιο 1, ο εσωτερικός μητρικός κλώνος όταν αντιγράφεται στη διχάλα που εξελίσσεται προς τα αριστερά, ο νεοσυντιθέμενος συμπληρωματικός κλώνος του, συντίθεται συνεχώς.

Στο πλασμίδιο 2, ο αντίστοιχος μητρικός κλώνος, στη διχάλα που εξελίσσεται προς τα δεξιά, ο νεοσυντιθέμενος συμπληρωματικός κλώνος του συντίθεται συνεχώς.

Α. Ποια είναι κωδική και ποια μη κωδική αλυσίδα του γονιδίου του λ-φάγου (6);

Β. Ποιο ολιγοπεπτίδιο κωδικοποιεί αυτό το γονίδιο (4);

Γ. Ποιο από τα πλασμιδια θα χρησιμοποιήσετε για την κλωνοποιήση του γονιδίου (1) και αιτιολογήστε την απάντηση σας (6).

Δ. Μετά την επιτυχή έκφραση του γονιδίου στα κύτταρα ξενιστές απομονώθηκαν δυο διαφορετικά ολιγοπεπτίδια που παράγονται από τα μετασχηματισμένα κύτταρα ζυμών με τα ανασυνδυασμενα πλασμιδια. Τα δυο αυτά ολιγοπεπτιδια παράγονται από διαφορετικά μετασχηματισμένα μυκητιακα κύτταρα. Δηλαδή το ίδιο κύτταρο δεν παράγει και τα δυο ολιγοπεπτιδια. Και τα δυο είναι προϊόντα έκφρασης του ετερολογου γονιδίου που ανασυνδυάστηκε με τον φορέα κλωνοποιήσης.

Εξηγήστε το φαινόμενο (5).

Ε. Είναι δυνατόν το κύτταρο ζύμης ξενιστής να παράγει το λειτουργικό ολιγοπεπιδιο του λ-φαγου δεδομένου ότι ο λ-φαγος προσβάλει βακτηρία (3);

 

Ζήτημα 4                                                                                                                          Μοναδες 25

Δίνεται η παρακάτω αλληλουχία του γονιδίου Φ1 (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) που κωδικοποιεί για το ένζυμο του βακτηρίου Lactobacillus arabinosus που σχηματίζει την βιταμίνη Β9 (φολικό οξύ).

Από την γονιδιωματική βιβλιοθήκη του βακτηρίου απομονώθηκε το γονίδιο Φ1 με στόχο την εισαγωγή του σε κατάλληλο φορέα κλωνοποίησης που θα μετασχηματίσει κύτταρα ζυμών αρτοποιίας ώστε να εμπλουτίζεται το ψωμί με φολικό οξύ.

Στο δοθέν γονίδιο δεν περιλαμβάνεται η αλληλουχία του υποκινητή του. Υποδεικνύονται τα κωδικόνια έναρξης και λήξης του Φ1 και εντός των 1500 ζ. β. που παρεμβάλλονται μεταξύ των κωδικονίων έναρξης και λήξης δεν υπάρχουν θέσεις αναγνώρισης των περιοριστικών ενζύμων: XbaI (5′TCTAGA3′ ), SacI (5′GAGCTC3′ ), BamHI (5′GGATCC3′), BglI(5′AGATCT3′), NdeI(.5′CATATG 3′ )

5′ GTCTAGAAGAGCTCCTTGGATCCAAAGATCTACCATATGTCTCGCCTA   1500 συνέχεια του γονιδιου

5’GTCTAGAAGAGCTCTGGATCCAAGATCTACCATATGTAAGCG3′

Δίνεται επίσης ο φορέας κλωνοποίησης που θα χρησιμοποιηθεί για την κλωνοποίηση του γονιδίου Φ1 στη ζύμη αρτοποιίας. Δίνεται ακόμη η αλληλουχία του φορέα κλωνοποίησης (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) από τη θέση BglI μέχρι τη θέση SacI, όπου περιλαμβάνεται και ο υποκινητής που θα είναι υπεύθυνος για τη μεταγραφή του γονιδίου Φ1.

Τμήμα του φορέα κλωνοποίησης:

__________Διεύθυνση μεταγραφής>___XbaI__NdeI___BamHI___SacI_____________________

 

Υποκινητής

———————->

5′AGATCTCGATCCCCCGAAATTAATACGACTCACTATACGGGAATTGTCACCGCATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATCGAGCTCCGTCGAC3′

NH2-MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluLeuArgArgGlnAla-COOH

Σημείωση: Τα έντονα γράμματα αποτελούν τον υποκινητή του γονιδίου στον πλασμιδιακό φορέα κλωνοποίησης και το κωδικόνιο έναρξης αυτού του γονιδίου αναφοράς στον φορέα κλωνοποίησης, είναι μέσα στη θέση αναγνώρισης της NdeI.

α. Για την έκφραση του γονιδίου Φ1 στη ζύμη, ποιες πρωτεΐνες και από ποιον οργανισμό θα πρέπει να συνδεθούν με τον υποκινητή του φορέα κλωνοποίησης που θα χρησιμοποιηθεί;

Μονάδες 8

β. Αν υποθέσουμε ότι τα επιπλέον αμινοξέα στο αμινοτελικό άκρο της πρωτεΐνης που κωδικοποιείται από το Φ1 γονίδιο δεν επηρεάζουν την λειτουργικότητα της απαντήστε στις παρακάτω ερωτήσεις:

  1. I) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με πέψη με BamHI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματιστικαι με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

ΙΙ) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με με πέψη με το ένζυμο SacI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματιστικέ με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

Μονάδες  4Χ4=16

 

 

 

 

Απάντηση

Αυτός ο ιστότοπος χρησιμοποιεί το Akismet για να μειώσει τα ανεπιθύμητα σχόλια. Μάθετε πώς υφίστανται επεξεργασία τα δεδομένα των σχολίων σας.