Αρχείο μηνός Νοέμβριος 2017

Διαγώνισμα κεφαλαίων 1-2-4 Βιολογίας ομάδας Θετικού Προσανατολισμού

ΔΙΑΓΩΝΙΣΜΑ

ΚΕΦΑΛΑΙΟ 1ο –2ο και 4ο

ΘΕΜΑ Α                                                                                                                                                                                       ΜΟΝΑΔΕΣ 25

Να απαντήσετε στις παρακάτω ερωτήσεις επιλέγοντας την λανθασμένη πρόταση ανάμεσα στις σωστές ή την σωστή ανάμεσα στις λανθασμένες.

Α. Το καλαμπόκι (zea mays) έχει μεγαλύτερη ποσότητα DNA στον πυρήνα του, απ’ ότι έχει ο άνθρωπος. Έτσι, αναμένουμε :

α. Το καλαμπόκι έχει περισσότερα χρωμοσώματα από τον άνθρωπο.

β. Ο άνθρωπος είναι σίγουρα εξελικτικά κατώτερος από το φυτό αυτό.

γ. Ο άνθρωπος και το καλαμπόκι έχουν τον ίδιο λόγο και τον ίδιο καρυότοπο και την ίδια αλληλουχία βάσεων , αλλά θα διαφέρουν ως προς την διαζώνωση.

δ. Το καλαμπόκι δεν αποκλείεται να έχει λιγότερα χρωμοσώματα από τον άνθρωπο, και διαφορετικό λόγο , και διαφορετικό καρυότυπο από τον άνθρωπο.

Β. Μιτογόνος ουσία είναι ……………… και ουσία που σταματάει την κυτταρική διαίρεση στην μετάφαση της μίτωσης είναι η…………………

α) φυτοαιματογλουτίνη , κολχικίνη

β) κολχικίνη, φυτοαιματογλουτίνη

γ) υπότονο διάλυμα , Giemsa

δ) Giemsa , υπότονο διάλυμα

Γ. Στον γενετικό κώδικα υπάρχουν ………………… αμινοξέα που κωδικοποιούνται μονοσήμαντα, ……………… αμινοξέα που κωδικοποιούνται από έξι κωδικόνια συνώνυμα μεταξύ τους και δεν υπάρχει κανένα αμινοξύ που να κωδικοποιείται από …………… συνώνυμα κωδικόνια.

α. 2, 4, 1

β. 2, 6, 7

γ. 2, 5, 3

δ. 2, 3, 5

4. Η αναδίπλωση των χρωμοσωμάτων των ευκαρυωτικών κυττάρων είναι σταδιακά από τη διπλή έλικα με διάμετρο…………….nm , σε …………….. 11 nm και κατόπιν σε ινίδιο χρωματίνης ………………… nm. Σε αυτό το στάδιο το χρωμόσωμα είναι παρατηρήσιμο με ……………….. …………….

5. Δίνεται το παρακάτω μόριο mRNA:

UACUACCACCAUGCCCAUGCCCGAGCGCUAGCCCAUG

α) Ποια είναι η κωδική αλυσίδα του γονιδίου που το κωδικοποιεί ;

β) Ποια είναι η μη-κωδική αλυσίδα του γονιδίου που κωδικοποιεί το RNA μόριο που συνδέεται με το 5ο κωδικόνιο;

γ) Ποια είναι η κωδική αλυσίδα του γονιδίου rRNA που αναγνωρίζει τμήμα τεσσάρων νουκλεοτιδίων στην 5αμετάφραστη περιοχή του mRNA ;

1.

Α) 3’ TACTACCACCATGCCCATGCCCGAGCGCTAGCCCATG 5’

B) 5’ ATGCCCTAGCGCGAGCCCATGCCCATGACCACTT3’

Γ) 5’ TACTACCACCATGCCCATGCCCGAGCGCTAGCCCATG3’

Δ)5’ΤACTACCCACCCATGCCCATGCCCGAGCGCTAGCCCATG3’

2.

A)5’AACCATGGAGCTCTGACCAA3’……

B)5’AACCATGCTCGTGTGACCAA3’…….

Γ)3’AACCCTCATGTGACTCCCAA…….

Δ)ΑACCATGCTCGTGTGACCAA5’…….

3.

A)5’ACCTACGCAC3’……..

B)3’ACGATGCACC5’……..

Γ)3’ATGCCCGAT5’………

Δ)3’CAGGTGGTGA5’……….

ΘΕΜΑ Β                                                                                                                                                                                   ΜΟΝΑΔΕΣ 25

Α. Να συμπληρωθεί ο πίνακας που παρουσιάζεται παρακάτω :

  1. 1. DNA<==> RNA–> ΠΟΛΥΠΕΠΤΙΔΙΟ
  1. 2. DNA—>  RNA—> ΠΟΛΥΠΕΠΤΙΔΙΟ
  2. 3. DNA—>RNA—> ΠΟΛΥΠΕΠΤΙΔΙΟ
  3. 4. DNA<===>  RNA—-> ΠΟΛΥΠΕΠΤΙΔΙΟ
  4. 5. DNA—-> RNA<===> ΠΟΛΥΠΕΠΤΙΔΙΟ
α) Μέσα σε ρετροϊούς.

β) Μιτοχόνδρια, κύτταρα, χλωροπλάστες.

γ) Κύτταρα μολυσμένα από ρετροϊούς.

δ) Κύτταρα μολυσμένα από RNA ιούς με δίκλωνο RNA.

ε) Μέσα σε ιούς

στ) Δεν έχει ανακαλυφθεί τέτοια περίπτωση σε έμβια όντα.

Σημείωση: Σε κάθε παραπάνω περίπτωση ισχύει και η αντιγραφή του DNA ενώ στην 1η και 3η περίπτωση ισχύει και η αντιγραφή RNA.

5 ΜΟΝΑΔΕΣ

Β. Σε ποια στάδια της έκφρασης της γενετικής πληροφορίας σ’ ένα ανθρώπινο κύτταρο βρίσκει εφαρμογή η συμπληρωματικότητα;


4 ΜΟΝΑΔΕΣ

Γ. Να υπολογιστεί το πλήθος των νουκλεοσωμάτων ενός ανθρώπινου γαμέτη, αν γνωρίζεται ότι υπάρχουν νουκλεοσώματα στα άκρα των χρωμοσωμάτων και μεταξύ δύο νουκλεοσωμάτων υπάρχουν 54 ζεύγη νουκλεοτιδίων.

5 ΜΟΝΑΔΕΣ

Δ. Ένας οργανισμός με γονιδίωμα 16 χρωμοσωμάτων πόσα μόρια DNA έχει το κάθε κύτταρο της 1ης μειωτικής διαίρεσης του. Σε ποσα ζευγάρια από τους κλώνους του DNA σε κάθε κύτταρο από αυτά τα κύτταρα, οι κλώνοι είναι πανομοιότυποι και σε πόσα είναι συμπληρωματικοί μεταξύ τους.

3+3 ΜΟΝΑΔΕΣ

Ε. Αντιστοιχίστε με ποιο τρόπο είναι δυνατή η παρατήρηση των κυτταρικών δομών της πρώτης στήλης με τις μεθόδους της δεύτερης στήλης.

1)ΜΟΡΙΟ DNA

2)NOYΚΛΕΟΣΩΜΑ

3)ΜΕΤΑΦΑΣΙΚΟ ΧΡΩΜΟΣΩΜΑ

4)ΠΛΑΣΜΙΔΙΟ

5)ΘΗΛΙΑ ΑΝΤΙΓΡΑΦΗΣ

α)ΚΡΥΣΤΑΛΛΟΓΡΑΦΙΑ ΑΚΤΙΝΩΝ Χ

β) ΗΛΕΚΤΡΟΝΙΚΟ ΜΙΚΡΟΣΚΟΠΙΟ

γ)ΟΠΤΙΚΟ ΜΙΚΡΟΣΚΟΠΙΟ

5 ΜΟΝΑΔΕΣ

ΘΕΜΑ Γ

Α. Δίνονται δύο βακτήρια διαφορετικού είδους που το καθένα διαθέτει από ένα πλασμίδιο.

Το βακτήριο (Α) διαθέτει το πλασμίδιο (α) που φέρει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό str και τον παράγοντα μεταφοράς F+, καθώς και το γονίδιο (i)

(P)

Γονίδιο (i)

GAAATGGAATTCTGAAAATTT Υ (P)

CTTTACCTTAAGACTTTTAAA Υ

Το πλασμίδιο (β) που διαθέτει το κύτταρο (B), έχει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό Amp , και το γονίδιο (ii)

Γονίδιο (ii)

                         Υ CCATCATCGAAATGGAATTCTGAAAATTTCCTATT

(P)Y GGTAGTAGCTTTACCTTAAGACTTTTAAAGGATAA

Όπου (P) φωσφορική ομάδα.

Μεταξύ των βακτηρίων (Α) και (Β) πραγματοποιήθηκε βακτηριακή σύζευξη. To βακτήριο δέκτης του πλασμιδίου, δεν μπορεί πλέον ν’ αξιοποιήσει λειτουργικά το προϊόν που κωδικοποιούσε πριν από τη σύζευξη του το γονίδιο του πλασμιδίου του, όμως, παραμένει ανθεκτικό στο αντιβιοτικό στο οποίο διέθετε ανθεκτικότητα, ενώ παράγει και τα προϊόντα που κωδικοποιουνται από το πλασμιδιο που δεχθηκε.

Σημείωση: Τα δύο πλασμίδια δεν ανασυνδυάζονται.

α. Τι γνωρίζεται για τα πλασμίδια; 5 ΜΟΝΑΔΕΣ

β. Ποια είναι η κωδική αλυσίδα του γονιδίου (ii) ; 1 ΜΟΝΑΔΑ

Αιτιολογήστε την απάντηση σας. 7 ΜΟΝΑΔΕΣ

γ. Εξηγήστε για ποιον λόγο το βακτήριο δέκτης, όπως αναφέρεται στην εκφώνηση, δεν μπορεί πλέον να χρησιμοποιεί το προϊόν της μεταγραφής του γονιδίου του. 7 ΜΟΝΑΔΕΣ

Β. Γνωρίζετε ότι η βακτηριακή DNA πολυμεράση κινείται με ταχύτητα 50 νουκλεοτίδια / δευτερόλεπτο. Σε πόσο χρόνο αναμένετε ότι θα ολοκληρωθεί η αντιγραφή του πλασμιδίου του βακτηρίου Α το οποίο έχει μέγεθος 5000 ζεύγη νουκλεοτιδίων;

Αν :

α) Στη θέση έναρξης της αντιγραφής του πλασμιδίου δημιουργείται μια θηλιά που αποτελείται από δύο αμφίδρομες διχάλες, όπου δρουν τέσσερα μόρια DNA πολυμερασών για την επιμήκυνση των νέων κλώνων.

β) Στη θέση έναρξης της αντιγραφής δημιουργείται μία θηλιά με δύο διχάλες αμφίδρομες , όπου δρουν δύο μόρια DNA πολυμερασών για την επιμήκυνση των νέων κλώνων.

3 ΜΟΝΑΔΕΣ

γ) Να αποδώσετε τα δύο σχήματα. 2 ΜΟΝΑΔΕΣ

ΘΕΜΑ Δ

Α. Σ’ ένα κύτταρο εκτελείται η διαδικασία της μετάφρασης, ένα ριβόσωμα φέρει ένα μόριο tRNA που μεταφέρει ένα πεπτίδιο με τριάντα πεπτιδικούς δεσμούς και μόλις μετακινείται κατά μία θέση, ώστε αυτό το tRNA να βρεθεί στην πρώτη θέση του ριβοσώματος. Το ολοκληρωμένο πρόδρομο πολυπεπτίδιο αποτελείται από 100 αμινοξέα. Σε ποια νουκλεοτίδια του μεταφράσιμου τμήματος του mRNA βρίσκεται το παραπάνω ριβόσωμα και σε ποια κωδικόνια ; 6 ΜΟΝΑΔΕΣ

Β. Ένα έμβρυο με καρυότοπο 46 χρωμοσωμάτων διαθέτει 3 χρωμοσώματα 21 και ένα φυλετικό χρωμόσωμα χ.

α) Πόσα μόρια DNA διαθέτει το έμβρυο αυτό στον καρυότοπο του;

β) Πόσους κλώνους DNA διαθέτει το έμβρυο αυτό στην φάση G1 ενός σωματικού κύτταρου του;

γ) Το έμβρυο αυτό πόσα ζεύγη ομόλογων χρωμοσωμάτων διαθέτει;
δ) Το έμβρυο αυτό είναι διπλοειδές άτομο;

ε) Το έμβρυο αυτό έχει πυρηνικό γονιδίωμα όσο και ένα φυσιολογικό κορίτσι; 5ΜΟΝΑΔΕΣ

Γ. Σας δίνεται το θραύσμα ενός μικρού ιικού γονιδίου που κωδικοποιεί για ένα ολιγοπεπτίδιο το οποίο έχει κοπεί με ένα ένζυμο περιορισμού κατά την κατασκευή γονιδιωματικής βιβλιοθήκης .

AAGGTTGAGAATGGGGCCCTTAATTGGCT

              AACTCTTACCCCGGGAATTAACCGATTCC

α) Να βρεθεί ο προσανατολισμός της ως προς τη θέση του υποκινητή.

β) Να βρεθεί η αλληλουχία της περιοριστικης ενδονουκλεασης που χρησιμοποιηθηκε κατά την κατασκευή της γονιδιωματικής βιβλιοθήκης αυτού του ιου που διαθέτει το παραπάνω γονίδιο. Το ένζυμο δρα με προσανατολισμό 5′ προς 3′ αναγνωρίζοντας μια αλληλουχία έξι ζευγών νουκλεοτιδιών.

γ) Να γραφεί το μόριο του RNA που θα προκύψει αν υποθέσουμε ότι είναι δυνατό το παραπάνω μόριο να μεταγράφει σε εκχύλισμα μιτοχονδρίων του ανθρώπου, όπως ακριβώς σας δίνεται.

1+2+3 ΜΟΝΑΔΕΣ

Δ. Ένα βακτήριο E. coli έχει μετασχηματιστεί μ’ ένα πλασμίδιο πάνω στο οποίο φέρεται ολόκληρο το φυσιολογικό οπερόνιο της λακτόζης αλλά απουσιάζει το ρυθμιστικό του γονίδιο.

Το βακτήριο αυτό ωστόσο, δεν μπορεί ν’ αναπτυχθεί σε περιβάλλον με μοναδική πηγή C τη λακτόζη.

Εξηγήστε δύο λόγους για τους οποίους είναι δυνατόν να γίνεται αυτό. 8 ΜΟΝΑΔΕΣ

ΚΑΛΗ ΕΠΙΤΥΧΙΑ