Διαγώνισμα βιολογίας θετικού προσανατολισμού. Κεφάλαια: 1-2-4-7

Ζήτημα 1.                                                                                                   Μονάδες 25

  1. Δίνεται το παρακάτω σχήμα που αναπαριστά ένα χρωμόσωμα.

 

Επαναληπτικό 1-2-4-7-01

Το τμήμα Α θέλουμε να κλωνοποιηθεί in vitro.  Η αντιγραφή τελειώνει κάθε φορά στο τέλος του μητρικού κλώνου που λειτουργεί ως καλούπι.

Μετά από πόσους κύκλους αντιγραφής θα υπάρχει στον δοκιμαστικό σωλήνα για πρώτη φορά το επιθυμητό τμήμα Α.

α. Νo x 2κ

β. 2κ

γ. κ

δ.2

ε. 3

  1. Το τμήμα Α αποτελεί γονίδιο. Το προϊόν της μεταγραφής διαθέτει 70% πουρίνες, από αυτές το 30% δημιουργεί δυο δεσμούς υδρογόνου σε δίκλωνο μόριο. Γνωρίζετε ακόμη ότι η πουρίνη που σχηματίζει δυο δεσμούς υδρογόνου και συμμετέχει στο μεταγράψιμο τμήμα, του γονιδίου Α στην μη κωδική αλυσίδα, αποτελεί το 20% του κλώνου αυτού, στο γονίδιο Α.

Ο λόγος A+T/G+C του γονιδίου Α είναι (στον μη κωδικό κλώνο) στο τμήμα που αντιπροσωπεύεται στο προϊόν της μεταγραφής, μετά την ολοκλήρωση της διαδικασίας.

α. περίπου 7/3

β.1

γ. περίπου ½

δ. περίπου 2/3

ε. Δεν υπολογίζεται

  1. Για την μεταγραφή αυτού του γονιδίου απαιτήθηκε να ξετυλιχθούν 14 νουκλεοσώματα, στα οποία συμπεριλαμβάνονται και εκείνα στα σημεία Μ και Ν, που φαίνονται στην εικόνα 1. Το μήκος του RNA που παράχθηκε αποτελείται από 2746 νουκλεοτίδια. Το χρωμόσωμα έχει μήκος 2 χ 106 ζ.β. και ξεκινάει και τελειώνει με νουκλεόσωμα.  Ποιο είναι το πλήθος των ιστόνων που απαιτούνται για το πακετάρισμα του;

α.  περίπου 2 χ 104

β. περίπου 16 χ 104

γ. περίπου 8 χ 104

δ. 32 χ 104

ε. περίπου 106

  1. Το μεταφράσιμο τμήμα του γονιδίου Α αποτελείται από 600 κωδικόνια. Η 5’ αμετάφραστη περιοχή του, προκαλεί τη δημιουργία συμπλόκου έναρξης με τέτοιο ρυθμό ώστε το αμέσως προηγούμενο ριβόσωμα να έχει ήδη μεταφράσει 10 κωδικόνια μέχρι να συνδεθεί το επόμενο μόριο tRNA σε αυτό . Πόσα   πλήρη ριβοσώματα θα αποτελούν το πολύσωμα του mRNA του γονιδίου Α όταν το πρώτο ριβόσωμα έχει ολοκληρώσει την πολυπεπτιδική αλυσίδα;

α. 60

β.65

γ. 66

δ. 59

ε. 66,6

  1. Η θέση Ε που φαίνεται στο σχήμα έχει την αλληλουχία:

5’ ——————–GGAATTCC——————-3’

3’———————CCTTAAGG——————5’

Α. Υπάρχει η περιοριστική ενδονουλεάση MdI, η οποία αναγνωρίζει την παραπάνω αλληλουχία οκτώ νουκλεοτιδίων και πέμπτει τους φωσφοδιεστερικούς δεσμούς 5’-G-G-3’ καθώς και τους 14 δεσμούς υδρογόνου μεταξύ των παρεμβαλλόμενων ζευγών βάσεων. Πάσα διαφορετικά τμήματα που περιέχουν το γονίδιο Α προκύπτουν μετά την πέψη του χρωμοσώματος με τα ένζυμα EcoRI και MdI, ταυτόχρονα;

α. 1

β.2

γ. 3

δ. 4

ε. Κανένα.

Β. Το διπλανό πλασμίδιο χρησιμοποιήθηκε ως φορέας κλωνοποίησης του τμήματος Α. Πόσα διαφορετικά ανασυνδυασμένα πλασμίδια μπορούν να προκύψουν;

Δίνεται ο φορέας κλωνοποίησης  που θα χρησιμοποιηθεί.

Επαναληπτικό 1-2-4-7-02

 

α. 1

β. 2

γ. 3

δ.4

ε. Κανένα.

Ζήτημα 2.                                                                                           Μονάδες 25

  1. Να αναφέρετε τους λόγους για τους οποίους το βακτήριο Ε. coli χρησιμοποιείται ως οργανισμός μοντέλο της Μοριακής Βιολογίας. (μόρια 4)
  2. Εξηγήστε για ποιο λόγο προσθέτουμε αζωτούχες και φωσφορικές ενώσεις στις πετρελαιοκηλίδες που πρόκειται να «καθαριστούν» με την δράση μικροοργανισμών οι οποίοι μεταβολίζουν το πετρέλαιο.  (μόρια 5)
  3. Κατατάξτε τα γονίδια των οργανισμών ως προς τη θέση τους στο κύτταρο και ως προς τη θέση του γενετικού τους τόπου. (μόρια 5)
  4. Στην εικόνα 1 φαίνεται ένα μέρος μιας βιολογικής διαδικασίας που βρίσκεται σε εξέλιξη.

CUCUUTCT

GAGAAACATGCATACGAC                    Εικόνα 1

α. Να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας.               (μόρια 2)

β. Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1. (μόρια 3)

γ. Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού.              (μόρια 1)

  1. Τα παρακάτω βήματα περιγράφουν μια εργαστηριακή καλλιέργεια μικροοργανισμών. Να τοποθετήσετε τα βήματα στη σωστή σειρά, γράφοντας μόνο τον αντίστοιχο αριθμό. α.προετοιμασία κατάλληλων θρεπτικών υλικών β. εμβολιασμός μικρής ποσότητας του μικροοργανισμού γ. απομόνωση οργανισμού στο εργαστήριο δ. ανάπτυξη καλλιέργειας σε κατάλληλες συνθήκες ε. αποστείρωση θρεπτικών υλικών και μέσων.           (μόρια 5)

Ζήτημα 3.                                                                                                    Μονάδες 25

  1. Δίνονται τα παρακάτω τρία σχήματα, δυο από αυτά αφορούν ακριβώς το ίδιο τμήμα ενός κλώνου ενός μορίου DNA σε διαφορετικές χρονικές στιγμές του κυτταρικού κύκλου ενός ευκαρυωτικού κυττάρου, στο οποίο ανήκει αυτός ο κλώνος DNA. Το τρίτο σχήμα αφορά την ίδια ακριβώς διαδικασία με μια από τις δυο διαδικασίες in vivo που δίνονται. Η διαδικασία που παριστάνεται στο τρίτο σχήμα πραγματοποιείται in vitro.

 

Επαναληπτικό 1-2-4-7-03

Α. Ποιες διαδικασίες αφορούν τα σχήματα 1, 2 και 3;

Β. Να ονομάσετε τις πρωτεΐνες α,β,γ,δ και ε.

Γ. Ποια είναι η λειτουργία του σημείου 1 στο μόριο του DNA;

Ποιες διαφορές γνωρίζετε μεταξύ των σημείων 1 στο μόριο του DNA ανάμεσα στους προκαρυωτικούς και τους ευκαρυωτικούς οργανισμούς;

Υπάρχουν διαφορές μεταξύ των δυο κατηγοριών οργανισμών που αναφέρθηκαν και για τις πρωτεΐνες α, που αναγνωρίζουν τα σημεία όπως το 1;

Δ. Τι είδους βιολογικά μακρομόρια είναι οι κλώνοι ι και ιι καθώς και ιιι;

Ποια δομική διαφορά εντοπίζεται μεταξύ των κλώνων ι και ιιι;

Ε. Ποιες πρωτεΐνες έδρασαν και ποιες πρόκειται να δράσουν ακόμη εκατέρωθεν του σημείου 2;

ΣΤ. πόσες πρωτεΐνες έδρασαν στο σημείο 3; Ονομάστε τις πρωτεΐνες αυτές.

Ζ. Ποιες από τις πρωτεΐνες που εμφανίζονται στα σχήματα εκτελούν εργασίες που έχουν το ίδιο τελικό αποτέλεσμα;

Η. Σε ποιο από τα τρία σχήματα γνωρίζετε ότι ένα προκαρυωτικό ένζυμο  «διαβάζει» ευκαρυωτικό γενετικό υλικό;

Θ. Ποια από τις διαδικασίες που φαίνονται στα σχήματα εκτελείται μια φορά στο δεδομένο τμήμα DNA, στην ζωή του κυττάρου;

Ι. Εξηγήστε τις πρακτικές εφαρμογές που βρίσκει η διαδικασία η οποία εκτελείται in vitro.                                                                                         (μόρια 1.5, 1.5, 1, 2, 2, 1, 2, 1, 1, 1)

  1. Σε ένα εργαστήριο Μοριακής Βιολογίας, επαναλήφθηκαν τα πειράματα που απέδειξαν τον μετασχηματισμό των προκαρυωτικών κυττάρων.

Οι οργανισμοί μελετήθηκαν με σύγχρονα μέσα και τεχνικές που μας παρέχει η τεχνολογία του ανασυνδυασμένου DNA.

Οι επιστήμονες δημιούργησαν την γονιδιωματική βιβλιοθήκη των δυο στελεχών του βακτηρίου D. pneumoniae και απομόνωσαν το γονίδιο που κωδικοποιεί για την πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος στα λεία στελέχη.

Στην συνέχεια με τεχνικές Γενετικής Μηχανικής μετασχημάτισαν ένα πληθυσμό από αδρά στελέχη του βακτηρίου. Από τον πληθυσμό που μετασχηματίστηκε και τον αρχικό πληθυσμό των λείων βακτηρίων, λήφθηκε δείγμα κυττάρων, στο οποίο πραγματοποιήθηκε PCR για την ενίσχυση του γονιδίου που ελέγχει για το κάλυμμα, από το γονιδίωμα των βακτηρίων. Τα αποτελέσματα αναλύθηκαν και πήραμε τα εξής:

Επαναληπτικό 1-2-4-7-04

 

Α. Ποιο από τα βακτηρία που αναλύθηκαν είναι το αδρό , ποιο το λείο και ποιο το μετασχηματισμένο αδρό σε λείο;                                                                         (μόρια 1,5)

Β. Δίνεται ο ένας από τους δύο κλώνους του γονιδίου που ενισχύθηκε και δυο μόρια tRNA που μετείχαν στην μετάφραση του.

5′ …TCAATTAGTGTACCCTTTATGATCACCTGGGTACATTGATTAGAT…3′

3′ UUA5′ και 5′ GUA 3′  τα αντικωδικόνια των δυο μορίων tRNA .

Ο κλώνος που δίνεται είναι ο κωδικός ή ο μη κωδικός του γονιδίου;

Αιτιολογήστε την απάντηση σας.                                                                           (μόρια 1 και 1,5)

Γ. Γνωρίζετε ότι μεταξύ της αλληλουχίας αναγνώρισης του mRNA από την μικρή ριβοσωμική υπομονάδα και του κωδικονίου έναρξης υπάρχουν τέσσερα νουκλεοτίδια της 5′ αμετάφραστης περιοχής. Ποια θα είναι η αλληλουχία της κωδικής αλυσίδας του γονιδίου rRNA που θα συνδέεται με το μόριο mRNA το οποίο θα προκύπτει κατά την μεταγραφή του δοθέντος γονιδίου;                                                                                                                  (μόρια 1)

Δ. Τα αδρά στελέχη του D. pneumoniae,  που χρησιμοποιήθηκαν για να μετασχηματιστούν δεν διαθέτουν πλασμίδια και είναι ανθεκτικά στο αντιβιοτικό τετρακυκλίνη (tet). Οι ερευνητές είχαν στην διάθεσή τους, τους παρακάτω φορείς κλωνοποίησης.

Ποιον  μπορούν επιλέξουν για να επιτύχουν τον μετασχηματισμό;

Αιτιολογείστε την απάντηση σας.                                                                            (μόρια 1 και 2,5)

 

Επαναληπτικό 1-2-4-7-05

Όπου: Polilynker: Πολλές, διαδοχικές, αλληλεπικαλυπτόμενες, μοναδικές θέσεις αναγνώρισης περιοριστικών ενδονουκλεασών. Τουλάχιστον μια από αυτές είναι κατάλληλη για την ένθεση του επιθυμητού γονιδίου.

Ε. Τα ανασυνδυασμένα βακτήρια καλλιεργήθηκαν στο εργαστήριο και πήραμε τις παρακάτω καμπύλες: Βιομάζα = f(t) και Πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος = f(t).

Επαναληπτικό 1-2-4-7-06

 

Γνωρίζουμε ότι το γονίδιο του λείου πνευμονιόκοκκου που ανασυνδυάστηκε, διαθέτει μια θέση περιορισμού NdeI, εντός του μεταφράσιμου τμήματος του. Μια καλλιέργεια,  όπως η παραπάνω (διάγραμμα 2), παρουσίασε την εξής εικόνα ως προς την παραγωγή της ετερόλογης πρωτεΐνης από τα μετασχηματισμένα αδρά στελέχη.

Μέτα από την απομόνωση των κυττάρων της καλλιέργειας και στη συνέχεια την απομόνωση των γονιδίων από τους πλασμιδιακούς φορείς κλωνοποίησης και στην  περαιτέρω πορεία πέψης του γονιδίου που ευθύνεται για το κάλυμμα των λείων στελεχών του πνευμονιόκοκκου από την NdeI, έδειξε ότι τα μισά γονίδια μπορούσαν να κοπούν και τα άλλα μισά όχι. Εξηγήστε σύντομα το φαινόμενο. Είναι γνωστό ότι  η καλλιέργεια δεν εκτέθηκε σε κανέναν  εξωγενή μεταλλαξιγόνο παράγοντα και  θεωρούμε ότι σε κάθε κύτταρο ξενιστή εισέρχεται μόνο ένα πλασμίδιο φορέας κλωνοποίησης, το οποίο αντιγράφεται μόνο μια φορά εντός του ξενιστή του.                                                    (μόρια 2,5)

Ζήτημα 4ο                                                                                                   Μονάδες 25

  1. Ένα στέλεχος E. coli, μετασχηματίζεται με το γονίδιο που ευθύνεται για το κάλυμμα (κάψα) του λείου στελέχους του πνευμονόκοκκου. Για τον μετασχηματισμό χρησιμοποιήθηκαν τρεις διαφορετικοί φορείς κλωνοποίησης, όπως φαίνονται παρακάτω και δημιουργηθηκαν τρεις διαφορετικες υγρες καλλιεργειες των μετασχηματισμενων κυτταρων που η καθεμιά έχει μετασχηματιστεί με διαφορετικό  φορέα κλωνοποίησης. Οι καλλιέργειες αναπτύσσονται αρχικά σε γλυκόζη και μετά την εξάντληση της, η αύξηση της κάθε καλλιέργειας συνεχίζεται με λακτόζη. Σε ποια χρονική στιγμή αναμένεται να εκφράζεται η ετερόλογη πρωτεΐνη σε καθεμιά από τις τρεις καλλιέργειες;

Επαναληπτικό 1-2-4-7-08

2.

Επαναληπτικό 1-2-4-7-07

2. Δίνονται οι παραπάνω καμπύλες α, β, γ που αφορούν τρεις διαφορετικές υγρές καλλιέργειες. Ποια από αυτές αντιστοιχεί στην αύξηση της καλλιέργειας E. coli, σε υγρό θρεπτικό υλικό με πηγή άνθρακα  λακτόζη, ποια με γλυκόζη και ποια με γαλακτόζη. Γνωρίζεται ότι σε κάθε μια από τις καλλιέργειες η πηγή άνθρακα βρίσκεται σε ίσες συγκεντρώσεις  με τις υπόλοιπες καλλιέργειες που εξετάζονται;

Δίνεται ακόμη ότι το βακτήριο E. coli, μπορεί να προσλάβει και να μεταβολίσει την γαλακτόζη. Η γαλακτόζη εντός του κυττάρου μετατρέπεται μετά από τρία μεταβολικά βήματα σε 6-φωσφόρο-γλυκόζη που αποτελεί το προϊόν και του πρώτου μεταβολικού βήματος της καταβολικής οδού διάσπασης της γλυκόζης στο κύτταρο.

 

 

 

Ένα σχόλιο στο Διαγώνισμα βιολογίας θετικού προσανατολισμού. Κεφάλαια: 1-2-4-7

Απάντηση

Αυτός ο ιστότοπος χρησιμοποιεί το Akismet για να μειώσει τα ανεπιθύμητα σχόλια. Μάθετε πώς υφίστανται επεξεργασία τα δεδομένα των σχολίων σας.