Διαγώνισμα Προσομοίωσης 2016 Βιολογία Θετικού προσανατολισμού

Θέμα Α.

Στις παρακάτω ερωτήσεις επιλέξτε την απάντηση που συμπληρώνει σωστά την πρόταση:                                                                   Μονάδες 25

Α1. Οι μονοκύτταροι οργανισμοί:

  1. είναι μόνο τα βακτήρια
  2. είναι δυνατόν να εμφανίζουν διαφοροποιημένα τμήματα
  3. έχουν μόνο κυκλικό/α δίκλωνα μόρια DNA
  4. έχουν πάντα οπερόνια και πλασμίδια
  5. αποκλείεται να έχουν μεμβρανώδη οργανίδια.

   Α2. Ένα άτομο που θα έχει δεχθεί γονιδιακή θεραπεία για την δρεπανοκυτταρική αναιμία:

  1. η αναλογία HbS/HbA στα ερυθροκύτταρα του αναμένεται ότι θα είναι 2:1
  2. σε ένα πρόδρομο ερυθροκύτταρό του θα υπάρχουν 4 διαφορετικές αιμοσφαιρίνες και 5 διαφορετικά γονίδια υπομονάδων των αιμοσφαιρινών
  3. θα εμφανίζει δρεπανοκύτταρα κατά τη δοκιμασία δρεπάνωσης
  4. δεν θα εμφανίζουν όλα του τα κύτταρα τον ίδιο γονότυπο
  5. όλα τα παραπάνω είναι σωστά.

Α3. Η αναλογία φαινοτύπων στην F2 γενεά, κατά το πρότυπο διασταυρώσεων του Mendel, 6:3:2:1 προκύπτει, όταν:

  1. Έχουμε διασταύρωση μονοϋβριδισμού
  2. Έχουμε διασταύρωση διϋβριδισμού με τα επικρατή γονίδια να είναι εμβρυακά θνησιγόνα
  3. Έχουμε διασταύρωση διϋβριδισμού με τα υπολειπόμενα γονίδια να είναι εμβρυακά θνησιγόνα
  4. Έχουμε διασταύρωση διυβριδισμού με ένα επικρατές και εμβρυακό θνησιγόνο γονίδιο.
  5. Τίποτα από τα παραπάνω

  Α4.  Με βάση τις αλυσίδες που σας δίνονται, οι οποίες αποτελούν το γενετικό υλικό ενός ιού, μπορείτε να συμπεράνετε ότι η μορφή του DNA του ιού, είναι:

  1. Μονόκλωνο γραμμικό,
  2. Δίκλωνο κυκλικό
  3. Μονόκλωνο κυκλικό
  4. Δίκλωνο γραμμικό
  5. τίποτα από τα παραπάνω

Ι: 5′ GCTCCTA3′             II: 5′ GGAGCTA3′

A5.Δίνονται τα δωδέκατα ζεύγη χρωμοσωμάτων του ανθρώπου που ανήκουν σε ένα ζευγάρι:

20160413_223336

  1. Το ζευγάρι έχει φυσιολογικό καρυότυπο
  2. Ο σύζυγος φέρει αμοιβαία μετατόπιση
  3. Η σύζυγος ευθύνεται για την απόκτηση παιδιών με ετερόζυγη έλλειψη
  4. ο σύζυγος έχει πιθανόν φυσιολογικό φαινότυπο άλλα όχι και φυσιολογικό καρυότυπο.
  5. Το ζευγάρι δεν μπορεί να αποκτήσει φυσιολογικούς απογόνους

 

 

Θέμα Β                                                                                         μονάδες 25

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τον Σεπτέμβριο του 1990 σε ένα κορίτσι τεσσάρων ετών που έπασχε από ανεπάρκεια του ανοσοποιητικού συστήματος. Η διαδικασία που ακολουθείται για την γονιδιακή θεραπεία της παραπάνω ασθενείας είναι η εξής:

Γράψτε τα επτά βήματα που περιγράφονται στην εικόνα.                     (μονάδες 7)Ex vivo

Β2. Εξηγήστε με ποιο τρόπο τα ογκοκατασταλτικά γονίδια σχετίζονται με την καρκινογένεση.                                                                             (μονάδες 5)

Β3. Εξηγήστε ότι το pH  του θρεπτικού υλικού ανάπτυξης μιας υγρή καλλιέργειας μικροοργανισμών επηρεάζει σημαντικά την ανάπτυξη της καλλιέργειας.                                                                                                                            (μονάδες 5)

Β4. Πώς συμβάλει η κλωνοποίηση στην προστασία των ζωικών ειδών που απειλούνται με εξαφάνιση;                                                                              (μονάδες 4)

Β5. Ποιοι ήταν δυο οι στόχοι του προγράμματος του ανθρώπινου γονιδιώματος;                                                                                                               (μονάδες 4)

Θέμα Γ                                                                                              μονάδες 25

Γ1. Επαναλαμβάνετε τα κλασσικά πειράματα του F. Griffith. Διαθέτετε τρεις δοκιμαστικούς σωλήνες με άγνωστα δείγματα (Α, Β, Γ) από στελέχη του βακτηρίου D. pneumoniae και θέλετε να τα χαρακτηρίσετε.

Μολύνετε με αυτά τα δείγματα, το καθένα μόνο του, και σε συνδυασμό μεταξύ τους, ποντίκια. Κατόπιν παίρνετε αίμα από τα ποντίκια και πραγματοποιείτε στερεή καλλιέργεια.

Τα αποτελέσματα των πειραμάτων σας είναι:

Αριθμός Δείγματος Δείγμα Ποντίκι Στερεή καλλιέργεια
1 Α νεκρό Ζωντανά λεία
2 Β ζωντανό κανένα
3 Γ ζωντανό Ζωντανά αδρά
4 Α+Β νεκρό Ζωντανά λεία
5 Α+Γ νεκρό Ζωντανά λεία και αδρά
6 Β+Γ νεκρό Ζωντανά λεία και αδρά

Κάθε δείγμα (Α,Β,Γ) περιεχέι μόνο ενα τύπο βακτηριακού στελέχους, να βρείτε το στέλεχος που υπάρχει σε κάθε δείγμα. Επιλέξτε από τα παρακάτω:

  1. Ζωντανά λεία-μολυσματικά
  2. θερμοθανατωμένα λεία-μολυσματικά
  3. ζωντανά αδρά- μη μολυσματικά
  4. θερμοθανατωμένα αδρά- μη μολυσματικά (μονάδες 3)

Γ2. Δίνεται το παρακάτω μεταβολικό μονοπάτι του ανθρώπινου οργανισμού.

Διαγώνισμα 2016-01

Η Αλκαπτονουρία είναι μια μεταβολική νόσος, που οφείλεται σε ανενεργότητα του ενζύμου ΕΑΚU που εμφανίζεται στο δοθέν μεταβολικό μονοπάτι με αποτέλεσμα να μην σχηματίζεται το προϊόν Γ.

α. Έστω ένα ομόζυγο άτομο για τα παθολογικά υπολειπόμενα αλληλόμορφα που ευθύνονται για την φαινυλκετονουρία και την αλκαπτονουρία (αυτοσωμική νόσος), θα περιμένατε να εμφανίζει συμπτώματα και για τις δύο ασθένειες;                (μονάδες 2)

β. Τα γονίδια που ευθύνονται για την σύνθεση των ενζύμων ΕAKU και ΕPKU και ΕM εδράζονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. Ένα ζευγάρι που και οι δυο είναι ετερόζυγοι και για τις τρεις αυτές ασθένειες, πρόκειται να αποκτήσει το πρώτο του παιδί. Με ποια πιθανότητα αυτό το παιδί θα έχει φαινότυπο αλφικού ατόμου ή θα είναι υγιές;                                                                                                       (μονάδες 14)

Γ3. Στο τρυβλίο ανάπτυξης μιας αποικίας ενός στελέχους E. coli  έσταξε καφές. Παρατηρήθηκε κατόπιν ότι υπήρχαν κύτταρα, όπου ορισμένα μόρια tRNA με αντικωδικόνιο 5΄GUA3΄υπήρχαν σε μικρότερη  ποσότητα στα κύτταρα αυτά, όμως  υπήρχαν σε αυτά τα κύτταρα και μόρια tRNA με αντικωδικόνιο 5΄UUA3΄φορτισμενα με το ίδιο αμινοξύ, όπως εκείνα με αντικωδικόνιο 5′ GUA3′.

α. Η παρουσία των μεταλλαγμένων μορίων tRNA τι συνέπειες μπορεί να έχει για το κύτταρο;                                                                                           (μονάδες 4)

β. Ποια μπορεί να είναι η αίτια της παραγωγής αυτών των μορίων tRNA από το βακτηριακό κύτταρο; Δώστε μια πιθανή εξήγηση.                                 (μονάδες 2)

Δίνεται ο γενετικός κώδικας.

 

ΘΕΜΑ Δ                                                                                         (μονάδες 25)

 

Δ1. Μια cDNA βιβλιοθήκη, δημιουργήθηκε από ηπατικά κύτταρα ανθρώπου. Απομονώθηκε το δίκλωνο μόριο DNA από αυτήν την βιβλιοθήκη, το οποίο αντιπροσωπεύει το ώριμο mRNA και υποβλήθηκε σε πέψη με τα περιοριστικά ένζυμα:  EcoRI [E], HindIII [H], και BamHI [B].

Παρακάτω φαίνεται αυτό το μόριο και οι θέσεις αναγνώρισης των περιοριστικών ενζύμων πάνω σε αυτό (περιοριστικός χάρτης).

Από κύτταρα ήπατος του ίδιου ατόμου δημιουργήθηκε και η γονιδιωματική βιβλιοθήκη. Από αυτήν την βιβλιοθηκη (γονιδιωματική) απομονώθηκε το ιδιο γονίδιο, που έδωσε και την παραπάνω cDNA βιβλιοθήκη.

Διαγώνισμα 2016-02

α. Πολλές πρωτεΐνες μας παράγονται στο ήπαρ και δρουν σε άλλα όργανα μας. Αναφέρετε δύο ασθένειες του ανθρώπου που γνωρίζεται οι οποίες επηρεάζουν δυσμενώς  τους πνεύμονες.                                                                      (μονάδες 2)

β. Εξηγήστε για ποιο λόγο, διαφέρουν οι περιοριστικές θέσεις και το μέγεθος του ίδιου γονιδίου μεταξύ των δύο βιβλιοθηκών. Μπορούμε να συνάγουμε αν το γονίδιο, όπως απομονώθηκε απο την γονιδιωματική βιβλιοθήκη φέρει μάζι και τις ρυθμιστικές αλληλουχίες του;                                                 (μονάδες 5+3)

γ. Για μια νόσο του ανθρώπου που το γονίδιο το οποίο την ελέγχει εκφράζεται στο ήπαρ, αλλά η δράση της πρωτεΐνης που αυτό κωδικοποιεί εντοπίζεται στους πνεύμονες, επιχειρήθηκε η γονιδιακή θεραπεία και παραγωγή της φαρμακευτικής αυτής πρωτεΐνης που ευθύνεται, από διαγονιδιακα φυτά.

Ποια κύτταρα του ασθενούς πρέπει να δεχθούν την γονιδιακή θεραπεία;      (μονάδες 1)

δ. Η έκφραση της ανθρώπινης πρωτεΐνης πρέπει να γίνεται αποκλειστικά στα πράσινα μέρη του διαγονιδιακού  φυτού, τα οποία συλλέγονται εύκολα. Δίνεται το πλασμίδιο Ti  και το κλωνοποιημένο τμήμα DNA που περιεχέι το γονίδιο που μας ενδιαφέρει  από την γονιδιωματική βιβλιοθήκη.

Γονίδιο:

5΄TCCGGATCCCGGAATTCCAAGGCCT——-ATG————-TGA——CGTCGACTCCGGATCCC3′

3′ AGGCCTAGGGCCTTAAGGTTCCGGA——-TAC————-ACT——GCAGCTGAGGCCTAGGG5′

Πλασμίδιο Ti:

Διαγώνισμα 2016-03

Σημείωση: Στο γονίδιο της ανθεκτικότητας στην καναμυκινη, αντί για θεση περιορισμού EcoRI υπάρχει θεση περιορισμού  KpnI.

Υπόμνημα:

Υ1: Υποκινητής του γονιδίου της μικρής υπομονάδας της Rubisco (η μικρή υπομονάδα της Rubisco κωδικοποιείται στον πυρήνα και μεταφέρεται στους χλωροπλάστες οπού και συμμετέχει στην δομή της Rubisco).

Υ2: Υποκινητής  φυτικού αυτοσωμικού γονίδιου μεταγραφικού παράγοντα ενός γονιδίου που μετέχει στην φωτοσύνθεση.

Y3: Yποκινητής του χλωροπλαστικού γονιδίου που κωδικοποιεί για την Rubisco.

Υ4:Ισχυρός βακτηριακός υποκινητής

Tum(4): Ογκογενετικό γονίδιο του πλασμιδίου Ti

ΑΛΜ: Αλληλουχίες Λήξης της Μεταγραφής.

Περιοριστικές Ενδονουκλεάσες:

BamHI: 5′ G|GATCC3′    HindIII: 5′ A|AGCTT3′   StuI: 5′ AGG|CCT3′  SalI: 5′ G|TCGAC3′

HaeIII: 5΄GG|CC3′      AluI: 5΄AG|CT3′        KpnI: 5’GGTAC|C3′    NmaI: 5’T|CCGG3′

(Δίνεται ο ένας μόνο κλώνος κάθε δίκλωνης θέσης αναγνώρισης της κάθε περιοριστικής ενδονουκλεάσης καθώς και το σημείο που πέπτει την αλληλουχία αναγνώρισης της).

 

Ποιο γονίδιο από τα 1,2,3, 4 του πλασμιδίου Ti θα επιλεγεί για να ανασυνδυαστεί με το ανθρώπινο γονίδιο;                                                                  (μονάδες 1)

Αιτιολογήστε την απάντηση σας.                                                   (μονάδες 2)

ε. Υπάρχουν δυο διαφορετικοί τρόποι ενθέσεις του ετερόλογου γονιδίου εντός του κατάλληλου γονιδίου του φορέα Ti  που δίνεται. Ποιοι είναι αυτοί;            (μονάδες 2)

στ. Ποια από τις δυο παραπάνω επιλογές θα οδηγήσει στην έκφραση του ανθρώπινου γονιδίου στα φυτικά κύτταρα;  Ποια επιλογή γονιδιου εξασφαλίζει  ότι όλα τα ανσυνδυασμενα φυτικά κύτταρα θα εκφράζουν την λειτουργική πρωτεινη;                                                     (μονάδες 1)

Αιτιολογήστε την απάντηση σας.                                                   (μονάδες 3)

ζ. Με ποιο τρόπο μπορούμε ελέγξουμε αν πράγματι έχει παραχθεί η επιθυμητή ανθρώπινη πρωτεΐνη στα φύλλα του φυτού; Απλή αναφορά των τεχνικών που θα χρησιμοποιηθούν.                                                                     (μονάδες 3)

η. Ποια από τις δυο βιβλιοθήκες του ανθρώπου θα επιλέξουν οι επιστήμονες για την παραγωγή της φαρμακευτικής πρωτεΐνης από τα φύλλα του φυτού;           (μονάδες 2)

Καλή επιτυχία

3 σχόλια στο Διαγώνισμα Προσομοίωσης 2016 Βιολογία Θετικού προσανατολισμού

  1. σταυρουλα

    Τέλειο διαγώνισμα !! Σας ευχαριστούμε, χρόνια πολλά και ο,τι επιθυμείτε σε προσωπικό και επαγγελματικό επίπεδο

  2. alex.pm

    Αρκετά δύσκολο και μακριά από τη θεματολογία των πανελλαδικών πιστεύω. Ωστόσο είναι ενδιαφέρον.

Απάντηση