Διαγώνισμα Προσομοίωσης 2014 Βιολογία Θετικής Κατεύθυνσης

Θέμα Α.

Στις παρακάτω ερωτήσεις επιλέξτε την απάντηση που συμπληρώνει σωστά την πρόταση:                                                                                                                    Μονάδες 25

Α1. Γονίδια οργανωμένα σε οπερόνια μπορούμε να βρούμε στο γονιδίωμα:

  1. Του λ φάγου
  2. του αδενοϊου που θα χρησιμοποιηθεί ως φορέας για την γονιδιακή θεραπεία της κυστικής ίνωσης
  3. στον πυρήνα, στους μύκητες αρτοποιίας
  4. αποκλειστικά των προκαρυωτικών κυττάρων.

Α2. Ένα διαγονιδιακό ζώο που είναι ομόζυγο για το ανθρωπινό γονίδιο της α1 αντιθρυψίνης παράγει την ετερόλογη πρωτεΐνη στο γάλα του, εκφράζοντας και τα δυο ανθρωπινά γονίδια. Προκειμένου να εκφράζονται στο ζώο τα ανθρωπινά γονίδια, αυτά βρίσκονται υπό τον έλεγχο του ζωικού υποκινητή της καζεϊνης του γάλακτος μιας πρωτεΐνης που παράγει φυσιολογικά το ζώο.

Πόσους υποκινητές καζεΐνης του γάλακτος φέρει το διαγονιδιακό αυτό ζώο στο στάδιο της μετάφασης της μίτωσης;

  1. 2
  2. 6
  3. 8
  4. 12

Α3. Το γονίδιο που κωδικοποιεί για το μόριο tRNA με αντικωδικόνιο 5’CCA3′ έχει ως τμήμα κωδικής αλυσίδας:

  1. Υποκινητής:5΄…GCACGATGCAAGTTGATTGACAA…3′
  2. Υποκινητής:3’…CGCTACGGGCCCAGAACTTGATG…5′
  3. Υποκινητής:5’…GCAACCAATGAGATAACTTGTCTGA..3′
  4. Υποκινητής:5’…CGGACCGATGAAGTGGTAGCCTCG..3′

Α4. Ένα φυτό με όγκους στον κορμό του είναι:

  1. γενετικώς τροποποιημένο
  2. υγιές φυσιολογικό
  3. μολυσμένο από το βακτήριο του εδάφους Bacillus thurigiencies
  4. μολυσμένο από το βακτήριο Agrobacterium tumefaciens

A5.Δίνεται η παρακάτω θέση έναρξης της αντιγραφής του DNA σε ένα χρωμόσωμα και δίνεται και η αλληλουχία της περιοχής 1και 2:

Print

5’…CTGACTGACA…3′ (περιοχή 1, αλυσίδα 1)

3’…GACTGACTGT…5′ (περιοχή 2, αλυσίδα 2)

Έστω ότι ένα πρωταρχικό τμήμα δημιουργείται εντός της περιοχής 1 αυτό θα έχει αλληλουχία:

  1. 5′ GACTGACTGT3′
  2. 5′ UGUCAGUCAG3′
  3. 5′ CUGACUGACA3′
  4. 5’CTGACTGACA3′

Θέμα Β

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Ποιες δυνατότητες μας δίνει η κατασκευή βιβλιοθηκών; Ποιες εφαρμογές βρίσκει η μέθοδος της αλυσιδωτής αντιδράσεις πολυμεράσης;                                       (μονάδες4 +4)

Β2. Ποιος είναι ο ρόλος των μονοκλωνικών αντισωμάτων ως ανοσοδιαγνωστικά;                                                                                                                                                 (μονάδες 7)

Β3. Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα; Για ποιους λόγους η μελέτη της διαδικασίας της αντιγραφής του γενετικού υλικού πραγματοποιείται στο βακτήριο E. coli ;                                                                                                         (μονάδες 4+2)

Β4. Να οριστεί η έννοια του γονιδίου.                                                                       (μονάδες 4)

Θέμα Γ

Γ1. Σε ένα πείραμα εξετάζεται η ενεργότητα του ενζύμου β-γαλακτοσιδάση. Η ενεργότητα του ενζύμου υπολογίζεται με την ικανότητα ανάπτυξης βακτηρίων E.coliσε θρεπτικό υλικό που περιεχέι X-gal και IPTG ή λακτόζη. Το X-galειναι ένα ανάλογο της λακτόζης το οποίο μετατρέπεται σε μπλε όταν μεταβολίζεται από την β-γαλακτοσιδάση όμως δεν επάγει την έκφραση του οπερονίου της λακτόζης. Το IPTG είναι ένα άλλο ανάλογο της λακτόζης που προκαλεί έκφραση του οπερονίου της αλλά δεν μεταβολίζεται από τα προϊόντα του οπερονίου της λακτόζης. Τέλος η γαλακτόζη μεταβολίζεται όπως και η γλυκόζη αλλά δεν επάγει την έκφραση του οπερονίου της λακτόζης.

Print

Μετά από τυχαία μεταλλαξιγέννεση που πραγματοποιήθηκε σε φυσιολογικό στέλεχος E. coli δημιουργήθηκε μεταλλαγμένο στέλεχος που αδυνατεί να δώσει μπλε αποικίες όπως φαίνεται παρακάτω.

Το στέλεχος έχει χάσει μόνο μια λειτουργιά είτε έχει μεταλλαχθεί το ρυθμιστικό γονίδιο του οπερονίου, είτε έχει μεταλλαχθεί ο υποκινητής αυτού, είτε έχει μεταλλαχθεί ο χείριστης του οπερονίου της λακτόζης, είτε ο υποκινητής του, είτε τέλος έχει μεταλλαχθεί το δομικό γονίδιο Ζ του οπερονίου της λακτόζης.

Στελέχη Ε.coli Στερεό Θρεπτικό μέσο ανάπτυξης
Γλυκόζη +X-gal + 

 

Γλυκόζη +X-gal +Λακτόζη+ X-gal +Γαλακτόζη +IPTG+ X-gal +Λακτόζη+γαλακτόζη
Φυσιολογικό Λευκές αποικίες Λευκές αποικίες Μπλε αποικίες Μπλε αποικίες
Μεταλλαγμένο 1 Λευκές αποικίες Λευκές αποικίες Λευκές αποικίες Λευκές αποικίες

 

 

α. Στο παραπάνω μεταλλαγμένο στέλεχος βακτηρίου ποια από τις αναφερόμενες αλληλουχίες του γονιδιώματος του μπορεί να έχει υποστεί μετάλλαξη ώστε να εμφανίζεται ο μεταλλαγμένος φαινότυπος;                                                              μονάδες 3

β. Ένα διαφορετικά μεταλλαγμένο στέλεχος του βακτηρίου που προέκυψε από την μεταλλαξιγέννεση εμφανίζει τον παρακάτω φαινότυπο: 

Στελέχη E.. coli Στερεό Θρεπτικό μέσο ανάπτυξης
Γλυκόζη +X-gal +  Γλυκόζη +X-gal +Λακτόζη+ X-gal +Γαλακτόζη +IPTG+ X-gal +Λακτόζη
Φυσιολογικό Λευκές αποικίες Λευκές αποικίες Μπλε αποικίες Μπλε αποικίες
Μεταλλαγμένο 2 Μπλε αποικίες Μπλε αποικίες Μπλε αποικίες Μπλε αποικίες

 

Το μεταλλαγμένο αυτό στέλεχος φέρει μετάλλαξη σε ένα μόνο συστατικό του οπερονίου της λακτόζης ή του ρυθμιστικού του γονιδίου. Ποια από αυτές τις αλληλουχίες μπορεί να έχει υποστεί μετάλλαξη για να εμφανίζεται αυτός ο φαινότυπος;                            μονάδες 3

γ. Το μεταλλαγμένο στέλεχος βακτηρίων του ερωτήματος β μετασχηματίστηκε με τα φυσιολογικά δομικά γονίδια του οπερονίου της λακτόζης και τον υποκινητή τους καθώς και με το φυσιολογικό ρυθμιστικό γονίδιο και τον υποκινητή του. Ωστόσο τα μεταλλαγμένα στελέχη εξακολουθούν να εμφανίζουν τον ίδιο φαινότυπο όπως και πριν τον μετασχηματισμό τους. Σε ποιο συμπέρασμα μπορούμε να οδηγηθούμε ως προς τον προσδιορισμό του τμήματος του γονιδιώματος που υπέστει την μετάλλαξη κατά την μεταλλαξιγέννεση; Αιτιολογήστε την απάντηση σας.                                      μονάδες 1+6 

Γ2. Το φυτό Α εμφανίζει ανθεκτικότητα στην προσβολή του από ένα είδος κάμπιας. Το ίδιο είδος κάμπιας προσβάλει και μια εμπορική ποικιλία καλαμποκιού. Στο γονιδίωμα του φυτού Α χαρτογραφήθηκε, απομονώθηκε και κλωνοποίηθηκε το αυτό το γονίδιο ανθεκτικότητας.

Οι γεωπόνοι θέλουν να δημιουργήσουν μια εμπορική ανθεκτική ποικιλία καλαμποκιού σε αυτό το είδος κάμπιας. Με δεδομένο ότι τα δυο είδη φυτών είναι συγγενικά αναμένεται να είναι δυνατή η έκφραση του ετερόλογου γονιδίου του φυτού Α στο καλαμπόκι, όταν το γονίδιο της ανθεκτικότητας στις κάμπιες ενθέτεται στο γονιδίωμα του καλαμποκιού μαζί με την ρυθμιστική αλληλουχία του.

α,Έχοντας στην διάθεση σας τους χάρτες με τις θέσεις περιορισμού του πλασμίδιο Τi και του γονιδίου ανθεκτικότητας στις κάμπιες του φυτού Α, ποιο περιοριστικό ένζυμο θα επιλέγατε για τον ανασυνδυασμό του πλασμιδίου Ti, με το συγκεκριμένο γονίδιο;                                                                                                                                              μονάδες 2

Print 

β. Πώς το πλασμίδιο Ti του βακτηρίου Agrobacterium tumefaciens επιτρέπει την δημιουργία διαγονιδιακών φυτών;                                                                               μονάδες 7

γ. Απο ποιο είδος βιβλιοθήκης θα επιλέξουμε το γονίδιο της τοξίνης του βακτηρίου Bacillus thurigiensisγια την δημιουργία φυτών καλαμποκιού Bt;                          μονάδες 3

 ΘΕΜΑ Δ

 Δ1. Από την διασταύρωση δυο εντόμων Drosophilla, που και τα δυο είχαν μακριά φτερά και κόντες κεραίες προέκυψαν οι παρακάτω απόγονοι.

Άτομα F1 Γενεάς
420 με μακριά φτερά και κόντες κεραίες
211 με μακριά φτερά και μεγάλες κεραίες
206 με κοντά φτερά και κόντες κεραίες
98 με κοντά φτερά και μεγάλες κεραίες

Θεωρώντας ότι ο φυλοκαθορισμός στα έντομα αυτά προσδιορίζεται όπως και στον άνθρωπο και με δεδομένο ότι οι δυο χαρακτήρες που εξετάζονται είναι ανεξάρτητοι, να ερμηνευθούν τα αποτελέσματα ποu προέκυψαν.                                        Μονάδες 10

Δ2. Τα γονίδια β και γ των αιμοσφαιρινών μας είναι αυτοσωμικά και εδράζονται σε διαδοχικούς γενετικούς τόπους στο ίδιο ζεύγος ομολόγων χρωμοσωμάτων.

Ένας άνδρας ετερόζυγος και για τα δυο γονίδια και η σύζυγος του επίσης ετερόζυγη και για τα δυο γονίδια έχουν ιστορικό τριών συνεχόμενων πρωίμων αποβολών στην προσπάθεια τους για να τεκνοποιήσουν.

α. Ποιοι είναι οι πιθανοί γονότυποι των συζύγων αυτών;                             Μονάδες 3

β. Πώς μπορούν να εξηγηθούν οι πρώιμες αποβολές σε αυτό το ζευγάρι                                                                                                                               Μονάδες 4

γ. Η γυναίκα κυοφορεί και βρίσκεται στην 13η εβδομάδα της κύησης. Ποια μέθοδος λήψης εμβρυακών κυττάρων για την πραγματοποίηση προγεννητικού έλεγχου μπορεί να εφαρμοστεί σε αυτό το στάδιο της κύησης;

Ποια τεχνική διάγνωσης μπορεί να εφαρμοστεί στα κύτταρα του εμβρύου που ελήφθησαν ώστε να προσδιοριστεί αν το παιδί θα νοσεί από β-θαλασσαίμια;

Με ποια πιθανότητα αυτό είναι ομόζυγο για το παθολογικό αλληλόμορφο του γονιδίου γ;                                                                                                                                Μονάδες 1+1+1

δ. Το έμβρυο διαπιστώθηκε ότι είναι υγιές και ομόζυγο για τα γονίδια β και γ της αιμοσφαιρίνης Α και F αντίστοιχα, ποια είναι η πιθανότητα το επόμενο παιδί του ζευγαριού που θα γεννηθεί να είναι και αυτό υγιές; Αιτιολογήστε την απάντηση σας.                                                                                                                                         Μονάδες 5

Καλή επιτυχία

Ένα σχόλιο στο Διαγώνισμα Προσομοίωσης 2014 Βιολογία Θετικής Κατεύθυνσης

Απάντηση