Διαγώνισμα προσομοίωσης Βιολογία θετικής 2013

Ζήτημα 1ο Μονάδες 25

1. Η αποικία είναι:
Α. Ορατή με γυμνό οφθαλμό.
Β. Ένα σύνολο από μικροοργανισμούς που ανήκουν σε διαφορετικά είδη.
Γ. Κλώνοι μικροοργανισμών που περιέχουν διαφορετικό ετερόλογο τμήμα DNA ο καθένας.
Δ. Τίποτα από τα παραπάνω.
(Μονάδες 5)

2. Η γαλακτόζη είναι:
Α. Απαραίτητη για την επιβίωση του βακτηρίου E.coli
Β. Διασπάται από τα ένζυμα που κωδικοποιεί το οπερόνιο της λακτόζης.
Γ. Συστατικό της γλυκόζης.
Δ. Μονοσακχαρίτης.
(Μονάδες 5)

3. Στο γονίδιο της αλυσίδας β της HbS, το έβδομο κωδικόνιο είναι το:
Α. Το 5’GAG3’
Β. Το 3’GAG5’
Γ. Το 5’GTG3’
Δ. Το 3’GCG5’
(Μονάδες 5)

4. Στον καρυότυπό μας το πλήθος των γονιδίων των αιμοσφαιρινών, είναι:
Α. 12
Β. 20
Γ. 6
Δ. 10
(Μονάδες 5)

5. Η κυστεϊνη που μεταφέρεται από ένα μόριο tRNA μετά από χημική επεξεργασία μπορεί να αλλάξει σε αλανίνη. Αν κάποια από αυτά τα τροποποιημένα tRNA προστεθούν σε κυτταρικό εκχύλισμα σύνθεσης πρωτεϊνών που περιέχει όλα τα απαραίτητα στοιχεία που απαιτούνται για τη φυσιολογική μετάφραση, ποιο από τα παρακάτω είναι το πιθανότερο μετά την προσθήκη mRNA που έχει κωδικόνια τόσο κυστεϊνης, όσο και αλανίνης΄;
Α. Κυστεϊνη θα προστίθεται κάθε φορά κατά τη μετάφραση του κωδικονίου αλανίνης.
Β. Η αλανίνη θα προστίθεται κάθε φορά κατά τη μετάφραση του κωδικονίου της κυστεϊνης.
Γ. Η πρωτεΐνη μπορεί να έχει λιγότερες κυστεϊνες.
Δ. Η πρωτεΐνη που θα προκύψει θα είναι φυσιολογική.
(Μονάδες 5)

Ζήτημα 2ο

1. Το 1944 πραγματοποιήθηκε ένα ιστορικό πείραμα για την Βιολογία. Σε ποια συμπεράσματα οδήγησε αυτό το πείραμα;
(Μονάδες 3)
Ποια άλλα βιοχημικά δεδομένα της εποχής υποστηρίζουν τα δεδομένα αυτού του πειράματος;
(Μονάδες 3)
2. Στο γάλα των διαγονιδιακών ζώων μπορούν να εκκρίνονται φαρμακευτικές πρωτεΐνες. Ποια γνωρίζεται ότι είναι η πιο επιτυχημένη εφαρμογή παράγωγης τέτοιων πρωτεϊνών από ζώα;
(Μονάδες 8)
3. Ποια διαδικασία ακολουθήθηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993;
(Μονάδες 6)
4. Περιγράψτε το πρότυπο των πειραμάτων του Mendel, τα αποτελέσματα των οποίων τον οδήγησαν στη διατύπωση των νόμων της κληρονομικότητας;
(Μονάδες 5)
Ζήτημα 3ο

Α. Ένα ευκαρυωτικό κύτταρο που περιέχει 0,8ng μη ραδιενεργό φωσφόρο στο μοναδικό χρωμόσωμα που διαθέτει, όταν τοποθετείται σε θρεπτικό υλικό που περιέχει κατά 50% μη ραδιενεργό φώσφορο και κατά 50% ραδιενεργό φωσφόρο, πολλαπλασιάζεται. Να βρεθούν τα ng του ραδιενεργού και του μη ραδιενεργού φωσφόρου (θεωρούμε ότι δεν υπάρχει διαφορά μάζας μεταξύ ραδιενεργού και μη ραδιενεργού φωσφόρου) που θα υπάρχουν στο γενετικό υλικό των κυττάρων που θα προκύψουν:
α. Μετά τον πρώτο διπλασιασμό του αρχικού κυττάρου.
(Μονάδες 3)
β. Μετά το δεύτερο διπλασιασμό που θα συμβεί σε αυτό το θρεπτικό υλικό.
(Μονάδες 3)

γ. Το παραπάνω πείραμα χαρακτηρίζεται ως in vivo ή ως in vitro; (Μονάδες 1)

Β. Το ρυθμιστικό γονίδιο του οπερονίου της λακτόζης στο βακτήριο E.coli έχει την παρακάτω υποθετική αλληλουχία ζευγών νουκλεοτιδίων. Ένα βακτηριακό στέλεχος έχει υποστεί μετάλλαξη στο ρυθμιστικό γονίδιο το οπερονίου της λακτόζης, με συνέπεια να παράγονται μόρια καταστολέα τα οποία συνδεονται πολύ ισχυρά με τον χειριστη.

Φυσιολογικό γονίδιο:
Αλυσίδα 1: GTTGAATTCTTAGCTTAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG

Μεταλλαγμένο γονίδιο:
Αλυσίδα 1: GTTGAATTCTTAGCTTAATAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTATTCAGCCCGTACTTAAGAG

α. Εξηγείστε ποιός θα είναι ο φαινότυπος του συγκεκριμένου στελέχους σε περιβάλλον με μοναδική πηγή άνθρακα τη γλυκόζη (Μονάδες 3) και σε περιβάλλον με μοναδική πηγή άνθρακα τη λακτόζη (Μονάδες 3).

β. Εντοπίστε το είδος της μετάλλαξης που έχει συμβεί (Μονάδες 1) και εξηγείστε με ποιό τρόπο αυτή επηρεάζει το γονιδιακό προϊόν (Μονάδες 3).

γ. Οι επιστήμονες τροποποίησαν γενετικά το συγκεκριμένο βακτηριακό στέλεχος , το οποίο στερείται πλασμιδίων και περιοριστικών ενζύμων, με το φυσιολογικό ρυθμιστικό γονίδιο.
Έχοντας στη διάθεσή τους τις περιοριστικές ενδονουκλεάσες (EcoRI, TruqI, TscI)και φορείς κλωνοποίησης, εξηγήστε ποια περιοριστική ενδονουκλεάση και ποιος φορέας κλωνοποίησης θα επιλεγεί για τον μετασχηματισμό.
(Μονάδες 1)
Αιτιολογήστε την απάντησή σας.
(Μονάδες 3)
Διαγώνισμα 2

δ. Το μετασχηματισμένο βακτηριακό στέλεχος αναπτύχθηκε σε θρεπτικό υλικό με μοναδική πηγή άνθρακα τη λακτόζη, μαζί με το φυσιολογικό στέλεχος του βακτηρίου, πώς θα γίνει δυνατή η διάκριση των δύο στελεχών;
Το φυσιολογικό στέλεχος στερείται πλασμιδίων.
(Μονάδες 4)

Ζήτημα 4ο

Το παρακάτω γενεαλογικό δένδρο αφορά την ασθένεια της οικογενούς υπερχοληστερολαιμίας
Διαγώνισμα 1

α. Με ποιό τύπο κληρονομικότητας γνωρίζεται ότι κληρονομείται η παρακάτω νόσος;
(Μονάδες 1)
Ποια διασταύρωση του δένδρου αποδεικνύει αυτόν τον τύπο κληρονομικότητας και ποια τον αποκλείει (Μονάδες 2); Αιτιολογήστε την απάντησή σας.
(Μονάδες 3)
β. Το ζευγάρι ΙΙΙ1 και ΙΙΙ2 ζήτησε γενετική καθοδήγηση σχετικά με το αν πρόκειται να αποκτήσουν απόγονο με οικογενή υπερχοληστερολαιμία.
Τι είναι η γενετική καθοδήγηση;
(Μονάδες 3)
Ποιες είναι οι προϋποθέσεις που πρέπει να διαθέτει ο ειδικός επιστήμονας ώστε να συμβουλέψει τους ενδιαφερόμενους;
(Μονάδες 3)
Ποια ήταν η απάντηση του ειδικού επιστήμονα στο ζευγάρι;
(Μονάδες 1)
γ. Το παιδί IV1 γεννήθηκε και νοσεί από οικογενή υπερχοληστεριναιμία. Από τις διαγνωστικές εξετάσεις που έγιναν διαπιστώθηκε ότι οι γονείς έχουν φυσιολογικό καρυότυπο και το παιδί έχει φυσιολογικό αριθμό χρωμοσωμάτων, αλλά φέρει το ένα από τα δύο αντίγραφα του γονιδίου που ελέγχει για την ασθένεια, μαζί με γειτονικούς του γενετικούς τόπους, σε διαφορετικά χρωμοσώματα από το χρωμόσωμα που φέρεται φυσιολογικά ο γενετικός τόπος του γονιδίου.
Τι είδους μετάλλαξη φέρει το παιδί;
(Μονάδες 2)
Πώς εξηγείται η γέννηση του παιδιού IV1 το οποίο εκφράζει το παθολογικό επικρατές αλληλόμορφο για την νόσο, από υγιείς γονείς, δηλαδή ομόζυγους για το υπολειπόμενο φυσιολογικό αλληλόμορφο για την ασθένεια, αποκλείοντας την γονιδιακή μετάλλαξη;
(Μονάδες 10)

2 σχόλια στο Διαγώνισμα προσομοίωσης Βιολογία θετικής 2013

Απάντηση