Αρχείο μηνός Ιανουάριος 2013

Διαγώνισμα Κεφ 1-2-4-5-7

Ζήτημα 1ο
(Μονάδες 25)
1. Η διπλή έλικα DNA:
Α. έχει μεταβαλλόμενο σκελετό
Β. έχει υδρόφιλες βάσεις που διατάσσονται προς το εσωτερικό του μορίου
Γ. έχει δεοξυριβόζες που βρίσκονται πάντα προσκείμενες στο νερό
Δ. έχει συμπληρωματικές παράλληλες αλυσίδες δεοξυριβονουκλεοτιδίων

2. Στο οπερόνιο της λακτόζης, όταν υπάρχει επαγωγέας μέσα στο κύτταρο E-coli, η πρωτεΐνη καταστολέας:
Α. συνδέεται με τον υποκινητή του ρυθμιστικού γονιδίου
Β. απομακρύνεται από τον υποκινητή οπερονίου
Γ. αλλάζει τρισδιάστατη δομή και απομακρύνεται από τον χειριστή
Δ. αλλάζει στερεοδιάταξη και συνδέεται με το χειριστή

3. Δεν μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη, για
Α. τα γονίδια του ιού HIV (ρετροϊός)
Β. τα γονίδια του λ-φάγου
Γ. το Pisum sativum
Δ. Τη ζύμη αρτοποιίας

4. Εάν η παρουσία των αλληλομόρφων του γονιδιού που ελέγχει την νόσο είναι ισοπιθανη σε έναν πληθυσμό, τότε ένα ζευγάρι που και οι δύο νοσούν από οικογενή υπερχοληστεριναιμία έχουν:
Α. ¾ πιθανότητα να αποκτήσουν παιδί που νοσεί από την ασθένεια
Β. 15/64 πιθανότητα να αποκτήσουν παιδί που νοσεί από την ασθένεια
Γ. 15/16 πιθανότητα να αποκτήσουν παιδί που νοσεί από την ασθένεια
Δ. ¼ πιθανότητα να αποκτήσουν παιδί που νοσεί από την ασθένεια

5. Τα μικροβιακά κύτταρα:
Α. αποκλείεται ορισμένα από τα είδη τους να χρειάζονται διοξείδιο του ανθρακα
Β. Όλα απαιτούν τα ίδια μεταλλικά ιόντα αλλά σε διαφορετικές συγκεντρώσεις τα διάφορα είδη μεταξύ τους
Γ. Για να διαιρεθούν πρέπει να διαθέτουν το κατάλληλο μέγεθος
Δ. Είναι ακατάλληλα για ξενιστές ανασυνδιασμένου DNA αν δεν είναι βακτήρια

6. Για να δημιουργήσουμε cDNA Βιβλιοθήκη πρέπει:
Α. Να χρησιμοποιήσουμε και S1 νουκλεάση, τρανσφεράση και DNA δεσμάση
Β. Να χρησιμοποιήσουμε μόνο περιοριστική ενδονουκλεάση και DNA δεσμάση
Γ. Να χρησιμοποιήσουμε απαραιτήτως πλασμίδιο ως φορέα κλωνοποίησης
Δ. Να χρησιμοποιήσουμε το γονιδιωματικό DNA του οργανισμού δότη

Ζήτημα 2ο
(Μονάδες 25)

1. Τι είναι η κλωνοποίηση; Δώστε τους ορισμούς της γονιδιωματικής και της cDNA βιβλιοθήκης.

2. Να αναφέρετε ποια θρεπτικά συστατικά είναι απαραίτητα για να αναπτυχθεί ένας μικροοργανισμός σε μια καλλιέργεια.

3. Μια πρωτεΐνη ενός ευκαρυωτικού κυττάρου αποτελείται από μια πολυπεπτιδική αλυσίδα 100 αμινοξέων. Το γονίδιο αυτό από το οποίο κωδικοποιήθηκε αυτή η πρωτεΐνη αποτελείται από πολύ περισσότερα νουκλεοτίδια από αυτά που κωδικοποιούν τα 100 αμινοξέα. Να αναφέρετε τους λόγους αυτής της διαφοράς.

4. Να ταξινομήσετε τις παρακάτω μορφολογικές δομές του γενετικού υλικού ενός ευκαρυωτικού κυττάρου αρχίζοντας από το μικρότερο προς το μεγαλύτερο βαθμό συσπείρωσης.
ινίδια χρωματίνης. μεταφασικά χρωμοσώματα. «χάντρες» νουκλεοσωμάτων.
διπλή έλικα DNA. αδελφές χρωματίδες.

5. Τι είναι:
Α. Αλληλόμορφα γονίδια
Β. Πολλαπλά αλληλόμορφα
Γ. Θνησιγόνα γονίδια
Δ. Ζύμωση
Ε. Τι ορίζετε ως γονιδιακή έκφραση; Που αποσκοπεί η γονιδιακή ρύθμιση στους προκαρυωτικούς οργανισμούς;

Ζήτημα 3ο

Α. Δίνονται τα παρακάτω τμήματα DNA που περιέχουν τα κωδικόνια που κωδικοποιούν τα επτά πρώτα αμινοξέα της φυσιολογικής και της μεταλλαγμένης β-πολυπεπτιδικής αλυσίδας της HbA.
Φυσιολογική
5’… GTG CAC CTG ACT CCT GAG GAG … 3’
3’ … CAC GTG GAC TGA GGA CTC CTC … 5’
Μεταλλαγμένη
5’ … GTG CAC CTG ACT CCT GTG GAG … 3’
3’ … CAC GTG GAC TGA GGA CAC CTC … 5’
Η περιοριστική ενδονουκλεάση DdeI αναγνωρίζει την αλληλουχία:
5’ CTGAG 3’
3’ GACTC 5’
και κόβει κάθε αλυσίδα μεταξύ του C και του T (με κατεύθυνση 5’ -> 3’). Η αλληλουχία που αναγνωρίζει η DdeI βρίσκεται στο παραπάνω τμήμα DNA της φυσιολογικής αλυσίδας. Από ένα άτομο φορέα της β-θαλασσαιμίας (φορέα του μεταλλαγμένου αλληλόμορφου γονιδίου β και του φυσιολογικού γονιδίου β), απομονώθηκαν τμήματα του DNA, που περιέχουν τα κωδικόνια τα οποία κωδικοποιούν τα επτά πρώτα αμινοξέα της β-πολυπεπτιδικής αλυσίδας. Στα τμήματα αυτά επιδράσαμε με την περιοριστική ενδονουκλεάση DdeI. Πόσα τμήματα DNA διαφορετικού μήκους θα προκύψουν μετά τη δράση της DdeI; Να αιτιολογήσετε την απάντησή σας.
(Μόρια 1+6)

Β. Στους παρακάτω δοκιμαστικούς σωλήνες (1, 2, 3) φαίνεται η διαβάθμιση της συγκέντρωσης οξυγόνου και η περιοχή ανάπτυξης τριών ειδών μικροοργανισμών σε υγρό θρεπτικό υλικό. Οι μικροοργανισμοί απεικονίζονται ως μαύρες κουκίδες. Σε ποιόν από τους τρεις δοκιμαστικούς σωλήνες έχουμε καλλιέργεια μυκήτων αρτοποιίας, βακτηρίων του γένους clostridium και βακτηρίων του γένους Mycobacterium; Να αιτιολογήσετε την απάντησή σας.
(Μόρια 3+6)
test1

Γ. Δίνεται το παρακάτω τμήμα βακτηριδιακού DNA που κωδικοποιεί για ένα ολιγοπεπτίδιο
Αλυσίδα 1: GTTGAATTCTTAGCTTAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG

Γ1. Να προσδιορίσετε τα 5’ και 3’ άκρα των αλυσίδων. Να αιτιολογήσετε την απάντησή σας.
(Μόρια 1+3)

Γ2. Το παραπάνω γονίδιο θέλουμε να το κλωνοποιήσουμε in vitro. Ποιο από τα παρακάτω πρωταρχικά τμήματα είναι τα κατάλληλα για αυτή την κλωνοποίηση; Να αιτιολογήσετε την απάντησή σας.
i) 5’ TTAAGCTA 3’
ii) 5’ GAGAATTC 3’
iii) 5’ GTTGAATT 3’
iv) 3’ CAACTTAA5’
v) 3’ GTTGAATT 5’
vi) 3’ CTCTTAAG 5’
(Μόρια 2+3)

Ζήτημα 4ο

Μια γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που έγινε σε εμβρυακά κύτταρα διαπιστώθηκε ότι το έμβρυο διαθέτει φυσιολογικό αριθμό χρωμοσωμάτων, αλλά διαθέτει μόνο ένα φυλετικό χρωμόσωμα, αυτό του Χ φυλετικού χρωμοσώματος και τρία χρωμοσώματα για το 18ο χρωμόσωμα.

Α1. Να περιγράψετε τη διαδικασία κατασκευής του καρυότυπου.
(Μόρια 5)

Α2.
i) Πόσα μόρια DNA υπάρχουν στα χρωμοσώματα που παρατηρούνται;
ii) Πόσα κεντρομερίδια υπάρχουν στα χρωμοσώματα του εμβρύου;
iii) Πόσες αδελφές χρωματίδες παρατηρούνται;
iv) Πόσοι βραχίονες παρατηρούνται;
v) Πόσα ινίδια χρωματίνης παρατηρούνται;
vi) Πόσες ελεύθερες φωσφορικές ομάδες υπάρχουν στα χρωμοσώματα που παρατηρούνται;
vii) Πόσα αντίγραφα ενός γονιδίου που εδράζεται σε γενετικό τόπο του χρωμοσώματος 18 υπάρχουν;
viii) Ποιο είναι το φύλο του εμβρύου και γιατί;
ix) Πόσα αντίγραφα ενός γονιδίου που εδράζεται στα φυλετικά X χρωμοσώματα υπάρχουν στο έμβρυο;
x) Πόσα ζεύγη ομολόγων χρωμοσωμάτων παρατηρούνται;
(Μόρια 5)

Α3. Δίνεται το παρακάτω τμήμα DNA το οποίο αντιγράφεται. Τα σημεία Α και Γ υποδεικνύουν τη θέση έναρξης της αντιγραφής.
test2
Να σχεδιάσετε στο τετράδιό σας το παραπάνω σχήμα και να σημειώσετε πάνω σε αυτό τους προσανατολισμούς των μητρικών αλυσίδων (1). Τα ασυνεχή και τα συνεχή τμήματα των δύο νέων αλυσίδων με βέλη και να σημειώσετε πάνω σ’ αυτά τους προσανατολισμούς τους (2).
Η μητρική αλυσίδα του DNA που αντιγράφεται με συνεχή τρόπο, αμέσως μετά μεταγράφεται. Να γράψετε το τμήμα του RNA που σχηματίζεται κατά τη μεταγραφή και να σημειώσετε τον προσανατολισμό του (2).
(Μόρια 1+2+2)

Β. Το παρακάτω γενεαλογικό δένδρο απεικονίζει τον τρόπο με τον οποίο κληρονομείται μια ασθένεια του μεταβολισμού στον άνθρωπο
test3

Β1. Η ασθένεια αυτή οφείλεται σε επικρατές ή σε υπολειπόμενο γονίδιο; Να αιτιολογήσετε την απάντησή σας. Κληρονομείται ως αυτοσωμικός ή φυλοσύνδετος χαρακτήρας; Να αιτιολογήσετε την απάντησή σας. (4)

Β2. Να προσδιορίσετε τους γονότυπους όλων των μελών της οικογένειας που απεικονίζονται στο παραπάνω γενεαλογικό δένδρο. (3)

Β3. Ο άνδρας ΙΙΙ1 αποκτά με ετερόζυγη γυναίκα για την ασθένεια αυτή ένα αγόρι. Με ποια πιθανότητα αυτό το αγόρι νοσεί από την νόσο αυτή, αιτιολογώντας την απάντησή σας. (3)
(Μόρια 4+3+3)