Διαγώνισμα Βιολογίας θετικού προσανατολισμού στα κεφάλαια 1-2

Διαγώνισμα θετικής κατεύθυνσης 

Θέμα 1ο

25 Μονάδες

Επιλέξτε τη σωστή απάντηση.

1. Ποιο από τα παρακάτω ισχύει για το DNA των οργανισμών;

α. Δίκλωνο, παράλληλο, Α+G/C+T=1

β. Δίκλωνο, αντιπαράλληλο, Α+G/C+T=1

γ. Μονόκλωνο, παράλληλο, Α+G/C+T=1

δ. Δίκλωνο, παράλληλο, Α+G/C+U=1

ε. Δίκλωνο, αντιπαράλληλο, Α+G/C+T=διάφορες τιμές

2. Από εκχύλισμα πρωτόζωων απομονώνονται μιτοχόνδρια τα οποία μολύνονται από κατάλληλους DNA ιούς (πλήθος ιών = n) μετά από κατάλληλο χρονικό διάστημα παρατηρούνται 300n ιοί. Αυτό σημαίνει ότι:

α. το γενετικό υλικό των μιτοχόνδριων είναι κυκλικό.

β. το γενετικό υλικό των μιτοχόνδριων είναι γραμμικό.

γ. τα μιτοχόνδρια διαθέτουν DNA πολυμεράση, RNA πολυμεράση, ριβοσώματα.

δ. όλα τα παραπάνω.

ε. τίποτα από τα παραπάνω.

 

3. Ο τερματισμός της μεταγραφής στα κύτταρα επιτυγχάνεται:

α. από ειδικό δίκλωνο τμήμα στο γονίδιο, που έπεται του 5′ άκρου της μη κωδικής αλυσίδας του γονιδίου .

β. από ειδικές πρωτεΐνες (μεταγραφικούς παράγοντες) που απομακρύνουν την RNA πολυμεράση.

γ. από τις αλληλουχίες λήξης της μετά-μεταγραφής.

δ. από την πρωτεΐνη που καλείται παράγοντας απελευθέρωσης.

ε. από το κωδικόνιο λήξης.

 

4. Στο οπερόνιο βιοσύνθεσης π.χ. του αμινοξέως τρυπτοφάνη, που υπάρχει στο γονιδίωμα του βακτηρίου E.coli, θα περιμένετε η πρωτεΐνη καταστολέας:

α. να είναι συνδεδεμένη στο χειριστή απουσία τρυπτοφάνης.

β. να αλλάζει στερεοδιάταξη και να απομακρύνεται από τον χειριστή παρουσία τρυπτοφάνης.

γ. να αλλάζει στερεοδιάταξη και να απομακρύνεται από τον χειριστή απουσία τρυπτοφάνης.

δ. να είναι μόνιμα συνδεδεμένη με τον χειριστή.

ε. τίποτα από τα παραπάνω.

 

5. Ένα πλασμίδιο μπορεί να ξεκινήσει την αντιγραφή του πριν ολοκληρώθεί η πρώτη αντιγραφή του. Σε αυτή την περίπτωση:

α. υπάρχουν στο πλασμίδιο δύο (2) αντιγραφικές διχάλες.

β. υπάρχουν στο πλασμίδιο τέσσερις (4) νεοσυντιθέμενοι κλώνοι DNA που κινούνται αμφίδρομα.

γ. υπάρχουν στο πλασμίδιο δώδεκα (12) νεοσυντιθέμενοι κλώνοι DNA που κινούνται αμφίδρομα.

δ. υπάρχουν στο πλασμίδιο οκτώ (8) DNA πολυμεράσες που δρουν για να ολοκληρωθεί η αντιγραφή.

ε. υπάρχουν στο πλασμίδιο οκτώ (8) νεοσυντιθέμενοι κλώνοι DNA που δημιουργούνται μονόδρομα.

Θέμα 2ο                                                                                                                                    Μονάδες 25

1. Να περιγράψετε τη δομή ενός φυσιολογικού μεταφασικού χρωμοσώματος  και τον τρόπο με τον οποίο από τα ινίδια χρωματίνης προκύπτουν τα μεταφασικά χρωμοσώματα.                                                                      Μονάδες 8

2. Η έκφραση των γονιδίων υπόκειται σε ρύθμιση. Να εξηγήσετε πως επιτυγχάνεται η γονιδιακή ρύθμιση στους ευκαρυωτικούς οργανισμούς σε επίπεδο μετάφρασης.                                                                                    Μονάδες 5

3. Να περιγράψετε τον τρόπο δημιουργίας του καρυότυπου ενός κατώτερου πρωτόζωου με απλοειδές γονιδίωμα n=7 και να τον συγκρίνετε με τον καρυότυπο του ανθρώπου.                                                                      Μονάδες 6

4. Με ποιους τρόπους τα κύτταρα εξασφαλίζουν την πιστότητα της αντιγραφής του γενετικού υλικού τους;                                                                       Μονάδες  6

Θέμα 3ο                                                                                                                                        Μονάδες 25

Α. Σε ένα εργαστήριο μοριακή μικροβιολογίας αναπτύσσονται υγρές καλλιέργειες τριών διαφορετικών στελεχών E.coli.

Στέλεχος Α →            Δεν διαθέτει πλασμίδια και δεν είναι ανθεκτικό σε κανένα αντιβιοτικό.

Στέλεχος Β →            Διαθέτει το πλασμίδιο pKam+F+ και έτσι είναι ανθεκτικό στο αντιβιοτικό Kam και ακόμη στο πλασμίδιο φέρεται το γονίδιο F+ που επιτρέπει τη μεταφορά  του πλασμιδίου σε άλλο βακτήριο μετά την αντιγραφή του.

Στέλεχος Γ →            Διαθέτει το πλασμίδιο pPen+ και έτσι είναι ανθεκτικό στην πενικιλλίνη.

Οι φοιτητές εμβολίασαν μία αποστειρωμένη φιάλη που περιέχει 1L κατάλληλο θρεπτικό υλικό για την ανάπτυξη της Ε.coli με 10ml από την καλλιέργεια Α, 1ml από την καλλιέργεια Γ και 0,1ml από την καλλιέργεια Β και μετά από ανάπτυξη 24 ωρών σε ιδανικές συνθήκες (pΗ=7, θoC=37o, αερισμό) παίρνοντας δείγμα από την καλλιέργεια που δημιούργησαν κατόρθωσαν να αναπτύξουν καθαρές καλλιέργειες (αποτελούμενες από κύτταρα ενός μόνο στελέχους) για ποια στελέχη κατέστει δυνατό αυτό και με ποιο τρόπο;

 

Σημείωση: Τα στελέχη Ε.coli δεν είχαν καμία μορφολογική διαφορά. Θεωρούμε ότι δεν συμβαίνει ανταλλαγή γενετικού υλικού μεταξύ πλασμιδίων ούτε μεταξύ πλασμιδίου και κυρίως μορίου γενετικού υλικού των βακτηρίων.

 

           

Θέμα 4ο                                                                                                                             Μονάδες 25

Α. Στο 11ο χρωμόσωμά μας εδράζεται το γονίδιο Α και στο 21ο χρωμόσωμά μας εδράζεται το γονίδιο Β. Ένας άνθρωπος για τα δύο αυτά γονίδια έχει την εξής σύσταση  (ΑαΒβ).

1. Ποια μπορεί να είναι η σύσταση των γαμετών ως προς τα συγκεκριμένα γονίδια;                              Μονάδες 6

2. Κατά τη 2η μειωτική διαίρεση του στο ένα 21ο χρωμόσωμά του δεν μπορούν να συνδεθούν τα ινίδια της ατράκτου με τα κατάλληλο σημείο στο χρωμόσωμα με αποτέλεσμα να μην μπορεί να πραγματοποιηθεί ο αποχωρισμός των αδελφών χρωματίδων του χρωμοσώματος. Ποια θα είναι τώρα η πιθανή σύσταση των γαμετών του ατόμου;

Μονάδες 6

 Β. Δίνεται η παρακάτω αλληλουχία DNA του βακτηρίου D.pneumoniae, που περιέχει γονίδιο υπεύθυνα για τη σύνθεση ενός ολιγοπεπτιδίου.

Αλυσίδα 1  CAGTGAATTACTTCAATGTCGAAGTGGACACATCGATTAAGTGCACTTAATAATTCCGG
Αλυσίδα 2  GTCACTTAATGAAGTTACAGCTTCACCTGTGTAGCTAATTCACGTGAATTATTAAGGCC

Η αλληλουχία             3’GTGAATTA5′   αποτελεί τον έναν από τους δυο κλώνους του υποκινητή του γονιδίου.

1. Να γράψετε ποια από τις δύο αλυσίδες είναι η μη-κωδική και να σημειώσετε τον προσανατολισμό των κλώνων του δοθέντος μορίου DNA. Να αιτιολογήσετε τις απαντήσεις σας.

Μονάδες 8

2. Ποίο είναι το mRNA που προκύπτει από τη μεταγραφή του γονιδίου;   Μονάδες 5

 

2 σχόλια στο Διαγώνισμα Βιολογίας θετικού προσανατολισμού στα κεφάλαια 1-2

  1. Μαριετίνα

    Δεν μπορώ να λύσω το θέμα 4ο , κυρίως το ερώτημα Β. Δεν μου υπολογίζονται σωστά τα κωδικόνια ώστε να βρω κωδικόνια λήξης σε καμία από τις 2 αλυσίδες

Απάντηση

Αυτός ο ιστότοπος χρησιμοποιεί το Akismet για να μειώσει τα ανεπιθύμητα σχόλια. Μάθετε πώς υφίστανται επεξεργασία τα δεδομένα των σχολίων σας.