Αρχείο μηνός Σεπτέμβριος 2012

διαγώνισμα Βιολογίας Ομάδας Θετικού Προσανατολισμού κεφαλαίου 1: Το Γενετικό Υλικό.

Ζήτημα 1.

Α. Σημειώστε τη σωστή απάντηση σε κάθε μια από τις παρακάτω ερωτήσεις:                                                                                                    15 μόρια

1. Κατά πόσο συσπειρώνεται το DNA του ανθρώπου που ως ενιαίο μόριο έχει            μήκος περίπου 2m  για χωρέσει στον πυρήνα του κυττάρου:

α) κατά το ελάχιστο 105 φορές

β) τουλάχιστον κατά 2×105 φορές

γ) κατά το μέγιστο 4×102 φορές

δ) κατά 3×103 φορές ακριβως

2. Το κεντρομερίδιο υπάρχει:

α) στο κέντρο του κυττάρου

β) στην κυτταρική μεμβράνη

γ) στο γενετικό υλικό των μιτοχονδρίων

δ) σε κάθε αδελφή χρωματίδα

3. Τα μιτοχόνδρια στα κύτταρα κάποιων κατώτερων πρωτοζώων:

α) είναι γραμμικά

β) είναι μόνο μητρικής προέλευσης

γ) έχουν γραμμικό DNA

δ) δημιουργούνται de novo

4. Οι ιστόνες είναι απαραίτητες για το σχηματισμό:

α) του κυτταροσκελετού

β) του πυρήνα

γ) των νουκλεοσωμάτων

δ) του συμπλόκου έναρξης της μετάφρασης

5. Μια από τις βασικές φυσιολογικές διαδικασίες, που διαφοροποιεί τη μίτωση από τη μείωση, είναι:

α) Ο αποχωρισμός των αδελφών χρωματίδων.

β) Η σύναψη ομόλογων χρωμοσωμάτων.

γ) Ο διπλασιασμός του DNA.

δ) Η ύπαρξη νουκλεοσωμάτων.

Β. Απαντήστε αν η καθεμιά από τις παρακάτω προτάσεις είναι σωστή ή λανθασμένη γράφοντας μια σύντομη αιτιολόγηση:                                                                      10 μόρια

α. Οι ιοί μπορούν να φέρουν ως γενετικό υλικό DNA, RNA, DNA-RNA μονόκλωνο ή δίκλωνο γραμμικό ή κυκλικό.

β. Τα μισά γονίδια του μιτοχονδριακού DNA ενός οργανισμού προέρχονται από τη μητέρα και τα άλλα μισά από τον πατέρα.
γ. Η απεικόνιση των χρωμοσωμάτων κατά τη μεσόφαση όπου τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος ονομάζεται καρυότυπος.

δ. Η έλικα του DNA έχει πλάτος 2 nm ενώ ενός νουκλεοσώματος είναι 11nm.

ε. Το ραδιοσημασμένο θειο δεν ενσωματώνεται στο DNA και συνέπεια θα ήταν αδύνατον εντοπιστεί στα χρωμοσώματα.

 

Ζήτημα 2.

Απαντήστε στις παρακάτω ερωτήσεις:                                                                 25 μόρια

 

 1. Το 1944 τα πειράματα του Griffith επαναλήφθηκαν in vitro.

Σε ποια συμπεράσματα οδήγησαν αυτά τα πειράματα; Ποια άλλα επιστημονικά δεδομένα της ίδιας εποχής ενισχύουν τα παραπάνω αποτελέσματα; (μόρια 8)

2. Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι κυκλικό δίκλωνο DNA. Από ποια μόρια αποτελείται το γενετικό υλικό των προκαρυωτικών οργανισμών; Τι γνωρίζετε γι’ αυτά; (μόρια 8)

3. Τι ονομάζουμε αποικία, δώστε από ένα παράδειγμα in vitro και in vivo διαδικασίας. Για την περιγραφή του μήκους ή της αλληλουχίας ενός νουκλεϊκού οξέος ποιος όρος χρησιμοποιείται και τι σημαίνει; ( μόρια 5)

4. Στο κριθάρι τα σωματικά κύτταρα έχουν χρωμοσώματα 2n=14. Ποιος είναι ο αριθμός των χρωμοσωμάτων: α. στα κύτταρα των ριζών, β. στα έμβρυα, γ. στους γυρεόκκκοκους και δ. στα φύλλα. (μόρια 4)

Ζήτημα 3.

Απαντήστε στις παρακάτω ερωτήσεις:

 

  1. Είναι δυνατόν ένας οργανισμός να έχει γενετικό υλικό με περιττό αριθμό νουκλεοτιδίων; Αιτιολογήστε την απάντηση σας.                                                                              7 μόρια
  2. Είναι δυνατόν ένας οργανισμός φυσιολογικά, να έχει γενετικό υλικό με περιττό αριθμό χρωμοσωμάτων; Αιτιολογήστε την απάντηση σας.                                                 6 μόρια
  3.  Δίνεται ένα υβριδικό δίκλωνο μόριο DNA-RNA που αποτελείται από 40 νουκλεοτίδια. α. Γνωρίζεται ότι η Τ (θυμίνη) αποτελεί το 15% των αζωτούχων βάσεων του υβριδικού αυτού μορίου. Να υπολογίσετε το ποσοστό και το πλήθος των υπολοίπων βάσεων  του μορίου, εάν είναι γνωστό ότι περιέχει 30% C (κυτοσίνη). β. Είναι γνωστό ότι  η Τ (θυμίνη) αποτελεί το 15% των βάσεων του κλώνου του DNA του υβριδικού αυτού μορίου.  Να υπολογιστεί το ποσοστό και το πλήθος των υπολοίπων βάσεων του μορίου, εάν είναι γνωστό ότι περιέχει 30% C (κυτοσίνη). γ. Να συγκριθούν τα δυο παραπάνω αποτελέσματα.                                                                                    12 μόρια     

Ζήτημα 4.

Να επιλυθούν οι παρακάτω ασκήσεις:

1. Εάν το βάρος 1.000 ζευγών βάσεων στο DNA είναι 10-18g και κάθε ζεύγος βάσεων απέχει από το επόμενο 3,4 x 10-10  m. Να βρείτε το βάρος του γενετικού υλικού του φυτού Λίλιουμ, που έχει μήκος 100m, θεωρώντας το ενιαίο μορίου δίκλωνου DNA. Πόσα μόρια φωσφόρου περιέχονται σε αυτό το μόριο; Θεωρούμε ότι το νουκλεοτίδιο έχει μηδενικό μηκος.                                                                                                                                                                                                             10 μόρια

2. Σε δύο διαφορετικά δείγματα DNA ιδίου μήκους που το καθένα απομονώθηκε από ένα άγνωστο είδος βακτηρίων, βρέθηκε ότι στο δείγμα Α η Θυμίνη ζευγαρώνει σε ποσοστό 32%, ενώ στο δείγμα Β το αντίστοιχο ποσοστό είναι 17% του συνολικού αριθμού των νουκλεοτιδίων του DNA του κάθε είδους βακτηρίων. Γνωρίζουμε ότι το ένα είδος απομονώθηκε από θερμοπηγές (64ο C). Μπορούμε να αποφανθούμε ποιο από τα δύο είδη προκαρυωτικών κυττάρων είναι το θερμόφιλο;                                                                                                                                                                              15 μόρια

Διαγώνισμα Βιολογίας θετικού προσανατολισμού στα κεφάλαια 1-2

Διαγώνισμα θετικής κατεύθυνσης 

Θέμα 1ο

25 Μονάδες

Επιλέξτε τη σωστή απάντηση.

1. Ποιο από τα παρακάτω ισχύει για το DNA των οργανισμών;

α. Δίκλωνο, παράλληλο, Α+G/C+T=1

β. Δίκλωνο, αντιπαράλληλο, Α+G/C+T=1

γ. Μονόκλωνο, παράλληλο, Α+G/C+T=1

δ. Δίκλωνο, παράλληλο, Α+G/C+U=1

ε. Δίκλωνο, αντιπαράλληλο, Α+G/C+T=διάφορες τιμές

2. Από εκχύλισμα πρωτόζωων απομονώνονται μιτοχόνδρια τα οποία μολύνονται από κατάλληλους DNA ιούς (πλήθος ιών = n) μετά από κατάλληλο χρονικό διάστημα παρατηρούνται 300n ιοί. Αυτό σημαίνει ότι:

α. το γενετικό υλικό των μιτοχόνδριων είναι κυκλικό.

β. το γενετικό υλικό των μιτοχόνδριων είναι γραμμικό.

γ. τα μιτοχόνδρια διαθέτουν DNA πολυμεράση, RNA πολυμεράση, ριβοσώματα.

δ. όλα τα παραπάνω.

ε. τίποτα από τα παραπάνω.

 

3. Ο τερματισμός της μεταγραφής στα κύτταρα επιτυγχάνεται:

α. από ειδικό δίκλωνο τμήμα στο γονίδιο, που έπεται του 5′ άκρου της μη κωδικής αλυσίδας του γονιδίου .

β. από ειδικές πρωτεΐνες (μεταγραφικούς παράγοντες) που απομακρύνουν την RNA πολυμεράση.

γ. από τις αλληλουχίες λήξης της μετά-μεταγραφής.

δ. από την πρωτεΐνη που καλείται παράγοντας απελευθέρωσης.

ε. από το κωδικόνιο λήξης.

 

4. Στο οπερόνιο βιοσύνθεσης π.χ. του αμινοξέως τρυπτοφάνη, που υπάρχει στο γονιδίωμα του βακτηρίου E.coli, θα περιμένετε η πρωτεΐνη καταστολέας:

α. να είναι συνδεδεμένη στο χειριστή απουσία τρυπτοφάνης.

β. να αλλάζει στερεοδιάταξη και να απομακρύνεται από τον χειριστή παρουσία τρυπτοφάνης.

γ. να αλλάζει στερεοδιάταξη και να απομακρύνεται από τον χειριστή απουσία τρυπτοφάνης.

δ. να είναι μόνιμα συνδεδεμένη με τον χειριστή.

ε. τίποτα από τα παραπάνω.

 

5. Ένα πλασμίδιο μπορεί να ξεκινήσει την αντιγραφή του πριν ολοκληρώθεί η πρώτη αντιγραφή του. Σε αυτή την περίπτωση:

α. υπάρχουν στο πλασμίδιο δύο (2) αντιγραφικές διχάλες.

β. υπάρχουν στο πλασμίδιο τέσσερις (4) νεοσυντιθέμενοι κλώνοι DNA που κινούνται αμφίδρομα.

γ. υπάρχουν στο πλασμίδιο δώδεκα (12) νεοσυντιθέμενοι κλώνοι DNA που κινούνται αμφίδρομα.

δ. υπάρχουν στο πλασμίδιο οκτώ (8) DNA πολυμεράσες που δρουν για να ολοκληρωθεί η αντιγραφή.

ε. υπάρχουν στο πλασμίδιο οκτώ (8) νεοσυντιθέμενοι κλώνοι DNA που δημιουργούνται μονόδρομα.

Θέμα 2ο                                                                                                                                    Μονάδες 25

1. Να περιγράψετε τη δομή ενός φυσιολογικού μεταφασικού χρωμοσώματος  και τον τρόπο με τον οποίο από τα ινίδια χρωματίνης προκύπτουν τα μεταφασικά χρωμοσώματα.                                                                      Μονάδες 8

2. Η έκφραση των γονιδίων υπόκειται σε ρύθμιση. Να εξηγήσετε πως επιτυγχάνεται η γονιδιακή ρύθμιση στους ευκαρυωτικούς οργανισμούς σε επίπεδο μετάφρασης.                                                                                    Μονάδες 5

3. Να περιγράψετε τον τρόπο δημιουργίας του καρυότυπου ενός κατώτερου πρωτόζωου με απλοειδές γονιδίωμα n=7 και να τον συγκρίνετε με τον καρυότυπο του ανθρώπου.                                                                      Μονάδες 6

4. Με ποιους τρόπους τα κύτταρα εξασφαλίζουν την πιστότητα της αντιγραφής του γενετικού υλικού τους;                                                                       Μονάδες  6

Θέμα 3ο                                                                                                                                        Μονάδες 25

Α. Σε ένα εργαστήριο μοριακή μικροβιολογίας αναπτύσσονται υγρές καλλιέργειες τριών διαφορετικών στελεχών E.coli.

Στέλεχος Α →            Δεν διαθέτει πλασμίδια και δεν είναι ανθεκτικό σε κανένα αντιβιοτικό.

Στέλεχος Β →            Διαθέτει το πλασμίδιο pKam+F+ και έτσι είναι ανθεκτικό στο αντιβιοτικό Kam και ακόμη στο πλασμίδιο φέρεται το γονίδιο F+ που επιτρέπει τη μεταφορά  του πλασμιδίου σε άλλο βακτήριο μετά την αντιγραφή του.

Στέλεχος Γ →            Διαθέτει το πλασμίδιο pPen+ και έτσι είναι ανθεκτικό στην πενικιλλίνη.

Οι φοιτητές εμβολίασαν μία αποστειρωμένη φιάλη που περιέχει 1L κατάλληλο θρεπτικό υλικό για την ανάπτυξη της Ε.coli με 10ml από την καλλιέργεια Α, 1ml από την καλλιέργεια Γ και 0,1ml από την καλλιέργεια Β και μετά από ανάπτυξη 24 ωρών σε ιδανικές συνθήκες (pΗ=7, θoC=37o, αερισμό) παίρνοντας δείγμα από την καλλιέργεια που δημιούργησαν κατόρθωσαν να αναπτύξουν καθαρές καλλιέργειες (αποτελούμενες από κύτταρα ενός μόνο στελέχους) για ποια στελέχη κατέστει δυνατό αυτό και με ποιο τρόπο;

 

Σημείωση: Τα στελέχη Ε.coli δεν είχαν καμία μορφολογική διαφορά. Θεωρούμε ότι δεν συμβαίνει ανταλλαγή γενετικού υλικού μεταξύ πλασμιδίων ούτε μεταξύ πλασμιδίου και κυρίως μορίου γενετικού υλικού των βακτηρίων.

 

           

Θέμα 4ο                                                                                                                             Μονάδες 25

Α. Στο 11ο χρωμόσωμά μας εδράζεται το γονίδιο Α και στο 21ο χρωμόσωμά μας εδράζεται το γονίδιο Β. Ένας άνθρωπος για τα δύο αυτά γονίδια έχει την εξής σύσταση  (ΑαΒβ).

1. Ποια μπορεί να είναι η σύσταση των γαμετών ως προς τα συγκεκριμένα γονίδια;                              Μονάδες 6

2. Κατά τη 2η μειωτική διαίρεση του στο ένα 21ο χρωμόσωμά του δεν μπορούν να συνδεθούν τα ινίδια της ατράκτου με τα κατάλληλο σημείο στο χρωμόσωμα με αποτέλεσμα να μην μπορεί να πραγματοποιηθεί ο αποχωρισμός των αδελφών χρωματίδων του χρωμοσώματος. Ποια θα είναι τώρα η πιθανή σύσταση των γαμετών του ατόμου;

Μονάδες 6

 Β. Δίνεται η παρακάτω αλληλουχία DNA του βακτηρίου D.pneumoniae, που περιέχει γονίδιο υπεύθυνα για τη σύνθεση ενός ολιγοπεπτιδίου.

Αλυσίδα 1  CAGTGAATTACTTCAATGTCGAAGTGGACACATCGATTAAGTGCACTTAATAATTCCGG
Αλυσίδα 2  GTCACTTAATGAAGTTACAGCTTCACCTGTGTAGCTAATTCACGTGAATTATTAAGGCC

Η αλληλουχία             3’GTGAATTA5′   αποτελεί τον έναν από τους δυο κλώνους του υποκινητή του γονιδίου.

1. Να γράψετε ποια από τις δύο αλυσίδες είναι η μη-κωδική και να σημειώσετε τον προσανατολισμό των κλώνων του δοθέντος μορίου DNA. Να αιτιολογήσετε τις απαντήσεις σας.

Μονάδες 8

2. Ποίο είναι το mRNA που προκύπτει από τη μεταγραφή του γονιδίου;   Μονάδες 5