Εξώφυλλο Βιβλίου Βιολογίας Θετικής Κατεύθυνσης Β' Τόμος

Ερωτήσεις κατανόησης 2ου Κεφαλαίου Βιολογία Θετικού Προσανατολισμού.

 

  1. Τα διαφορετικά μονομερή που δομούν τα νουκλεϊκά οξέα είναι συνολικά πέντε.
  2. In vivo είναι αδύνατο να δημιουργηθεί φωσφοδιεστερικός δεσμός ανάμεσα σε δεσοξυριβονουκλεοτίδιο και ριβονουκλεοτίδιο.
  3. Όλες οι RNA πολυμεράσες δημιουργούν μόρια RNA διαβάζοντας DNA.
  4. In vivo συντίθεταιDNA με μήτρα ριβονουκλεϊκό οξύ.
  5. Οι Watson και Crick απέδειξαν τον ημισυντηρητικό τρόπο αντιγραφής του DNA.
  6. Οι διαδικασίες στα κύτταρα λαμβάνουν χώρα με την παρακάτω σειρά: Αντιγραφή->Μεταγραφή->Μετάφραση.
  7. Για τη μεταγραφή ενός γονιδίου απαιτείται η προσωρινή αποδόμηση των νουκλεοσωμάτων του .
  8. Η μεγάλη ποικιλία μεταγραφικών παραγόντων στα ευκαρυωτικά κύτταρα εξυπηρετεί την μεγάλη ποικιλία υποκινητών των γονιδίων τους.
  9. Η μεγάλη ποικιλία υποκινητών στα ευκαρυωτικά γονίδια εξυπηρετεί τον πολύ υψηλό βαθμό εξειδίκευσης των κυττάρων αυτών.
  10. Το μόριο tRNA με αντικωδικόνιο CATείναι φορτισμένομε το εναρκτήριο αμινοξύ της πρωτεϊνοσύνθεσης.
  11. Όλες οι πρωτεΐνες συντίθενται έχοντας ως πρώτο αμινοξύ την μεθειονίνη και δεν μπορούν να φέρουν αλλού αυτό το αμινοξύ.
  12. Ένα βακτηριακό στέλεχος E.coli είναι δυνατό να αδυνατεί να αναπτυχθεί παρουσία λακτόζης παρόλο που διαθέτει lac οπερόνιο.
  13. Η γονιδιακή ρύθμιση στα βακτήρια δεν μπορεί να στηρίζεται στην ποικιλία των βακτηριακών υποκινητών.
  14. Η κυτταρική διαφοροποίηση συμβαίνει μονάχα κατά την εμβρυακή ηλικία.
  15. Η υπερέκφραση ενός γονιδίου μπορεί να συμβεί με τη δημιουργία πολυσώματος και την πολλαπλή μεταγραφή του.
  16. Όταν δύο ζυγωτά φυτών βρεθούν στις ίδιες συνθήκες περιβάλλοντος θα δώσουν φυτά του ίδιου είδους.
  17. Η ικανότητα πρόσδεσης του mRNA με τα ριβοσώματα διαφέρει μεταξύ διαφορετικών μορίων mRNA.
  18. Το πολύσωμα είναι ένα σύμπλοκο ριβοσωμάτων με ένα μόριο mRNA.
  19. Το σύμπλεγμα έναρξης περιλαμβάνει ένα μόριο mRNA, ένα μόριο tRNA, ένα ορισμένο αμινοξύ και την μικρή υπομονάδα του ριβοσώματος.
  20. Το πριμόσωμα είναι ένα ειδικό σύμπλοκο ενζύμων.
  21. Την γενετική οδηγία για το χρώμα της ίριδας του προ-πάππου σας δεν αποκλείεται να την φέρετε και εσείς.
  22. Οι Monod και Jacob έθεσαν τα θεμέλια για την κατανόηση της ρύθμισης της έκφρασης της γενετικής πληροφορίας.
  23. Έστω ότι μέχρι σήμερα υπάρχουν γνήσιοι απόγονοι του Σωκράτη, τότε δεν αποκλείεται κάποιος από αυτούς να φέρει μόνο τον ένα από τους δύο κλώνους τουλάχιστον ενός από τα χρωμοσώματα του αρχαίου φιλόσοφου.
  24. Τα γονίδια των ευκαρυωτικών κυττάρων που κωδικοποιούν για μεταγραφικούς παράγοντες δεν απαιτούν για τη μεταγραφή τους κατάλληλο συνδυασμό από μεταγραφικούς παράγοντες.
  25. Τα θυγατρικά κύτταρα του ζυγωτού ενός είδους, όταν αναπτυχθούν στις ίδιες ακριβώς συνθήκες, θα δώσουν το καθένα το τμήμα του οργανισμού που θα έδινε αν παρέμεναν μαζί.
  26. Σε έναν πολυκύτταρο ευκαρυωτικό οργανισμό τα κύτταρα κάθε κυτταρικού τύπου περιέχουν καθορισμένη ποιότητα και ποσότητα πρωτεϊνών που διαφέρει από τα κύτταρα των άλλων κυτταρικών τύπων του ίδιου οργανισμού.
  27. Η DNA δεσμάση δεν δρα στο νεοσυντιθέμενο κλώνο που συντίθεται συνεχώς.
  28. Σε ένα προκαρυωτικό κύτταρο κατά την αντιγραφή του DNA δρουν ταυτόχρονα τέσσερις DNA πολυμεράσες που δημιουργούν τους νέους κλώνους.
  29. Σε όλα τα κύτταρα ενός οργανισμού εκφράζονται κάποια κοινά γονίδια π.χ. αυτά των ιστόνων.
  30. Η διαδικασία σύνθεσης νέου μορίου mRNA είναι δυνατό να ξεκινήσει πριν την ολοκλήρωση της μεταγραφής του γονιδίου.
  31. Η μεταγραφή των προκαρυωτικών γονιδίων λαμβάνει χώρα κυρίως  στο πυρηνοειδές.
  32. Πολλά μόρια RNAs μπορούν να μεταγράφονται ταυτόχρονα από μία μη-κωδική αλυσίδα.
  33. Η προσθήκη ενός ζεύγους νουκλεοτιδίων στο μεταφράσιμο τμήμα ενός γονιδίου έχει ως συνέπεια μια πρωτεΐνη που διαφέρει από την φυσιολογική κατά τρία αμινοξέα.
  34. Κατά την αντιγραφή του DNA ενός ανθρώπινου κυττάρου τοποθετούνται 12*109 νέα δεσοξυνουκλεοτίδια, έτσι το γονιδίωμα μας, μετά την αντιγραφή έχει μέγεθος 12*109  ζεύγη βάσεων.
  35. Η DNA πολυμεράση αναμένεται να τοποθετήσει λάθος 120.000 νουκλεοτίδια κατά την αντιγραφή των σωματικών κυττάρων μας και 60.000 νουκλεοτίδια κατά την αντιγραφή του γενετικού υλικού του γαμέτη μας.
  36. Στην φάση της μεσόφασης μετά την αντιγραφή του γενετικού υλικού μας, αναμένεται να υπάρχει ένα μόνο λάθος σε ζεύγη νουκλεοτιδίων σε ολόκληρο το γονιδίωμα μας.
  37. Όλα τα γονίδια ενός οργανισμού έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  38. Όλα τα γονίδια όλων των οργανισμών έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  39. Όλα τα γονίδια έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  40. Όλες οι πρωτεΐνες ενός οργανισμού έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  41. Όλες οι πρωτεΐνες όλων των οργανισμών έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  42. Οι πρωτεΐνες είναι τα βιολογικά μακρομόρια που καταλύουν τις βιοχημικές αντιδράσεις και συντελούν στην δόμηση των οργανισμών.
  43. Οι πρωτεΐνες στα κύτταρα αποτελούν κατά το πλείστων ανεξάρτητες και αυτόνομες μονάδες. Τα γονίδια στα κύτταρα δεν είναι ανεξάρτητες διακριτές μονάδες.
  44. Οι προκαρυωτικοί οργανισμοί δεν διαθέτουν επιδιορθωτικά ένζυμα και δεν επιτελούν μετά-μετάφραση στις πρωτεΐνες τους.
  45. Το RNA που προκύπτει από την μεταγραφή είναι ίδιο σε αλληλουχία νουκλεοτιδίων, μόνο που αντί για θυμίνη έχει ουρακίλη, με την κωδική αλυσίδα του γονιδίου που το κωδικοποιεί.
  46. Το RNA που προκύπτει από την μεταγραφή είναι ίδιο σε αλληλουχία αζωτούχων βάσεων, μόνο που αντί για θυμίνη έχει ουρακίλη, με την κωδική αλυσίδα του γονιδίου που το κωδικοποιεί.
  47. Ο γενετικός κώδικας είναι σχεδόν καθολικός. Όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα. Το σχεδόν αναφέρεται π.χ. στις διαφορές στην αντιστοίχηση των κωδικονίων με τα αμινοξέα που εμφανίζονται στα μιτοχόνδρια των ζωικών κυττάρων.
  48. Κωδικόνια υπάρχουν και στην μη κωδική αλυσίδα ενός γονιδίου.
  49. Το E.coli έχει περίπου 3000 γονίδια και μέγεθος γονιδιώματος περίπου τέσσερα εκατομμύρια ζεύγη βάσεων.
  50. Στο οπερόνιο της λακτόζης τα τρία δομικά γονίδια (Z-Y-A) κωδικοποιούν για τις πρωτεΐνες β-γαλακτοζιδάση, περμεάση, τρανσακετυλάση.
  51. Ένα ορισμένο μόριο mRNA  κωδικοποιεί για μια μοναδική πρόδρομη πολυπεπτιδική αλυσίδα. Μια συγκεκριμένη πρόδρομη πολυπεπτιδική αλυσίδα είναι δυνατόν να κωδικοποιείται από περισσότερες τις μιας διαφορικές αλληλουχίες νουκλεοτιδίων mRNA.
  52. Είναι δυνατόν να υπάρχουν δυο διαφορετικές πρωτεΐνες με την ίδια ποσοστιαία σύσταση σε αμινοξέα.
  53. Δεν υπάρχουν υποκινητές γονιδίων που να αποτελούνται από ριβονουκλεοτίδια.
  54. Συνήθως οι ιικοί υποκινητές είναι ισχυρότεροι από τους υποκινητές των γονιδίων των κυττάρων των ξενιστών των ιών.
  55. Το οπερόνιο που κωδικοποιεί τα ένζυμα για την βιοσύνθεση ενός αμινοξέος θα περιμέναμε να έχει ως επαγωγέας της έκφρασης του το ίδιο το αμινοξύ όταν αυτό βρίσκεται μέσα στο βακτηριακό κύτταρο.
  56. Κατά την μετα-μεταγραφή πραγματοποιείται και διάσπαση και δημιουργία ομοιοπολικών δεσμών.
  57. Κατά την μετα-μετάφραση πραγματοποιείται και διάσπαση και πιθανόν και δημιουργία ομοιοπολικών δεσμών.
  58. Κατά την ωρίμανση συμβαίνει πρώτα αποδιάταξη των δύο πολυνουκλεοτιδικών κλώνων.
  59. Μια πρόδρομη πρωτεΐνη 100 αμινοξέων υφίσταται μετα-μεταφραστική πρωτεϊνόλυση σε τρία σημεία της. Μεταξύ του πεμτου και έκτου αμινοξεος, μεταξύ του τεσσαρακοστού και του τεσσαρακοστού πρώτου και μεταξύ του εξηκοστού έκτου και εξηκοστού εβδόμου αμινοξέος. Το τμήμα με το αρχικό αμινικο άκρο απομακρύνεται η λειτουργική πρωτεΐνη θα αποτελείται από τρία πεπτίδια ενωμένα με δισουλφιδικούς δεσμούς.
  60. Οπερόνια υπάρχουν μόνο στο κυρίως γενετικό υλικό των βακτηρίων.
  61. Κάθε εξώνιο ενός διακεκομμένου γονιδίου πρέπει να αποτελείται από πλήθος ζευγών βάσεων που είναι ακέραιο πολλαπλάσιο του τρία.
  62. Τα εσώνια στα διακεκομμένα γονίδια είναι ζεύγη δεοξυνουκλεοτιδίων.
  63. Ο Τ2 έχει DNA δίκλωνα γονίδια, και μερικά έχουν και εσώνια.
  64. Πριν από την απόδειξη του ημισυντηριτικού μηχανισμού της αντιγραφής, ένα από τα προτεινόμενα μοντέλα του μηχανισμού της αντιγραφής του DNA, ήταν ο δισπαρτικος. Σύμφωνα με αυτό τον μηχανισμό στο τέλος κάθε αντιγραφής προκύπτουν δυο νέα μόρια DNA αποτελούμενα το καθένα από δυο κλώνους, που ο καθένας αποτελείται από τυχαία τμήματα μητρικού και θυγατρικού κλώνου. Αν ένα βακτήριο αρχικά αναπτύσσεται σε περιβάλλον με 100% βαρύ Ν και μετά μεταφερθεί σε περιβάλλον με 100% ελαφρύ Ν και πραγματοποιηθούν  δυο διαδοχικές κυτταρικές διαιρέσεις, κάθε κύτταρο που προέκυψε από την δεύτερη διαίρεση θα φέρει ίση ποσότητα βαρύ Ν με κάθε κύτταρο που προέκυψε από την πρώτη διαίρεση, θεωρώντας ότι τα τμήματα του κάθε μορίου DNA που σχηματίζεται δημιουργούνται με τυχαία μεν άλλα ισοπίθανη κατανομή τμημάτων DNA μητρικών και θυγατρικών.
  65. Όλοι οι επιδιορθωτικοί μηχανισμοί που λειτουργούν κατά την αντιγραφή λειτουργούν και σε όλη την διάρκεια της μεσόφασης.
  66. οι 5΄και 3΄ αμετάφραστες  περιοχές ενός γονιδίου έχουν το ίδιο μέγεθος και διαφορετικό ρυθμιστικό ρόλο στην έκφραση των γονιδίων.
  67. Σύμφωνα με την θεωρία για την εξελικτική προέλευση των μιτοχονδρίων και των χλωροπλαστών, θα αναμένετο τα γονίδια του DNA των οργανιδίων αυτών να μην έχουν εσώνια.
  68. Αποκοπή των εσωνίων και συρραφή των εξωνίων υφίστανται μόνο τα πρόδρομα mRNA των διακεκομμένων γονιδίων που κωδικοποιούν για πολυπεπτίδιο.
  69. Το σύνολο των διαδικασιών που περιλαμβάνει η ωρίμανση αφορά όλα τα πρόδρομα RNA.
  70. Τα tRNA γονίδια φέρουν τα αντικωδικόνια στην μη κωδική αλυσίδα τους.
  71. Υπάρχουν και μονόκλωνοι υποκινητές γονιδίων.
  72. ο κλώνος που αντιγράφεται ασυνεχώς έχει το 5′ άκρο του προς την ΘΕΑ.
  73. ο κλώνος που συντίθεται ασυνεχώς έχει το 3′ άκρο του προς τη ΘΕΑ.
  74. Στην φάση G2 του κυτταρικού κύκλου έχουμε 4 αντίγραφα ενός αυτοσωμικού γονιδίου και αν το γονίδιο εκφράζεται, τότε εκφράζονται και τα 4 αντίγραφα.
  75. Ο κανόνας της συμπληρωματικότητας και της αντιπαραλληλίας είναι τα κριτήρια της επιλογής από το ένζυμο της μεταγραφής, για το ποιος κλώνος του γονιδίου είναι ο μεταγραφόμενος.
  76. Η διατύπωση » έτσι τα δυο θυγατρικά μόρια DNA που προκύπτουν από την αντιγραφή είναι πανομοιότυπα μεταξύ τους και με το μητρικό μόριο DNA» ,είναι λανθασμένη καθώς τα θυγατρικά μόρια είναι μεταξύ τους πανομοιότυπα άλλα όχι και πανομοιότυπα με το μητρικό μόριο DNA από το οποίο προήλθαν.
  77. Τα θυγατρικά μόρια DNA που προκύπτουν από την αντιγραφή είναι μικρότερου μήκους (σε πλήθος ζευγών βάσεων) από το μητρικό μόριο DNA.
  78. Η DNA δεσμάση δρα στην αρχή κάθε πρωταρχικού τμήματος κατά την αντικατάσταση του από την κατάλληλη DNA πολυμεράση.
  79. Τα αυτοσωμικά ομόλογα χρωμοσώματα έχουν ακριβώς τις ίδιες Θέσεις Έναρξης της Αντιγραφής.
  80. Οι αδελφές χρωματίδες έχουν ακριβώς τις ίδιες ΘΕΑ.
  81. Εντός ενός φυσιολογικού βακτηρίου E.coli, υπάρχουν ένας χείριστης του οπερονίου της λακτόζης και ένα πλήθος από πρωτεΐνες καταστολής.
  82. Το οπερόνιο της λακτόζης εκφράζεται πάντα σε φυσιολογικό κύτταρο E.coli  αρκεί να υπάρχουν μόρια λακτόζης εντός του, σε οποιοδήποτε πλήθος.
  83. Ένας ευκαρυωτικός γενετικός τόπος μπορεί να κωδικοποιεί για περισσότερες από ενός είδους διαφορετικές πολυπεπτιδικές αλυσίδες.
  84. Δίνεται η παρακάτω υποθετική κωδική αλυσίδα του γονιδίου Ζ του οπερονίου της λακτόζης: 5΄ΥΠΟΚΙΝΗΤΗΣ-ΧΕΙΡΙΣΤΗΣ-ATGACTGGATCATGCCATGGGGATG……………ΠΛΗΘΟΣ ΝΟΥΚΛΕΟΤΙΔΙΩΝ ΑΚΕΡΑΙΟ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΤΡΙΑ………………………………………………….ATGATGΤΑΑTGAGGTAGCCTAAGTCTGTA3′ το κωδικόνιο έναρξης βρίσκεται σίγουρα 11 νουκλεοτίδια μετά τον χειριστή.
  85. Ένα διακεκομμένο γονίδιο με 3 εσώνια δίνει 1 πρόδρομο και 8 διαφορετικά ώριμα μόρια mRNA.
  86. Εντός της μεγάλης υπομοναδας του ριβοσωματος κατά την επιμήκυνση του πολυπεπτιδίου κάθε φορα δημιουργείται ένας ομοιοπολικός δεσμός και διασπάται ένας ομοιοπολικός δεσμός.
  87.  H DNA πολυμεράση μπαίνει στον πυρήνα όπως και τα μόρια snRNA.
  88. Τα μορια tRNA των προκαρυωτων και των ευκαρυωτων έχουν το ίδιο μέγεθος , δευτεροταγή δομή, και αλληλουχία και μορια με το ίδιο αντικωδικόνιο είναι φορτισμένα με το ίδιο αμινοξύ.
  89. Τα γονίδια που κωδικοποιούν για tRNA τόσο στους ευκαρυωτες όσο και στους  προκαρυωτες έχουν την ιδια αλληλουχία και το ίδιο μέγεθος.
  90. Το βακτηριακό γενετικό υλικο «κονταίνει» σε κάθε κύκλο αντιγραφής.
  91. Είναι δυνατόν να εισάγουμε βακτηριακο mRNA σε φυτικό εκχύλισμα και να πάρουμε πολυπεπτιδιο μικρότερο από το φυσιολογικό βακτηριακο πολυπεπτιδιο.
  92. Σε ένα πολυπεπτιδικό μόριο είναι δυνατόν το πλήθος των ομοιοπολικών δεσμών του που ενώνουν τα μονομερή  να είναι όσο και το πλήθος των μονομερών του.
  93. Μεταξύ των διαδικασιών του κεντρικού δόγματος της Βιολογιας που λαμβάνουν χώρα  σε ένα φυσιολογικό κύτταρο, η αντιγραφή, συμβαίνει μόνο μια φορά και η μεταγραφή και η μετάφραση πολλές φορές σε ίσο όμως πλήθος.
  94.  Οι χλωροπλαστες ειναι ημιαυτονομα σωματιδια οπως και τα ριβοσωματα που εχουν τα δικα τους νουκλεικα οξεα.
  95. Κάθε εσώνιο βρίσκεται πάντα ανάμεσα στο τελευταίο κωδικόνιο του προηγουμενου εξωνιου και στο πρώτο κωδικόνιο του εξωνιου που έπεται αυτού του εσωνιου.
  96. Ένα κωδικόνιο μπορεί να ανήκει σε διαφορετικά, αλλα διαδοχικά εξώνια ενός διακεκκομενου γονιδιου.
  97. Η θεση έναρξης της αντιγραφής μπορεί να βρίσκεται μεσα σε ένα γενετικό τόπο αλλα μπορεί και όχι.

2 σχόλια στο Ερωτήσεις κατανόησης 2ου Κεφαλαίου Βιολογία Θετικού Προσανατολισμού.

Απάντηση

Αυτός ο ιστότοπος χρησιμοποιεί το Akismet για να μειώσει τα ανεπιθύμητα σχόλια. Μάθετε πώς υφίστανται επεξεργασία τα δεδομένα των σχολίων σας.